Foliar Spraying of NaHS Alleviates Cucumber Salt Stress by Maintaining N+/K+ Balance and Activating Salt Tolerance Signaling Pathways
Abstract
:1. Introduction
2. Results
2.1. Exogenous NaHS Enhanced Cucumber Seedlings Growth under Salt Stress
2.2. Exogenous NaHS Enhanced Photosynthesis of Cucumber Seedlings under Salt Stress
2.3. Exogenous NaHS Maintains Chlorophyll Fluorescence of Cucumber Seedlings under Salt Stress
2.4. Exogenous NaHS Inhibited the Accumulation of O2·− in Cucumber Seedlings Induced by Salt Stress
2.5. Exogenous NaHS Maintained Redox Balance by Enhancing AsA–GSH Cycle
2.6. Exogenous NaHS Maintained Na+/K+ Balance of Cucumber Seedlings under Salt Stress
2.7. Exogenous NaHS Alleviated the Inhibition of Cucumber Seedlings on the Absorption of Mineral Elements under Salt Stress
2.8. Exogenous NaHS Upregulated SOS Pathway Genes to Improve Cucumber Salt Resistance
2.9. Exogenous NaHS Enhanced Salt Tolerance of Cucumber by Upregulating MAPK Pathway-Related Genes
3. Discussion
4. Materials and Methods
4.1. Growth Index
4.2. Measurement of Photosynthetic Parameters and Chlorophyll Fluorescence Characteristics
4.3. Determination and Dyeing of Superoxide Anion (O2−)
4.4. AsA–GSH Cycle Determination
4.5. Measurement of Mineral Element Content
4.6. Real-Time Fluorescence Quantification
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
H2S | hydrogen sulfide |
NaHS | sodium hydrosulfide |
O2·− | superoxide anion |
AsA | ascorbic acid |
GSH | glutathione |
GSSG | oxidized glutathione |
DHA | oxidized ascorbic acid |
SOS | salt overly sensitive |
HKT | high-affinity potassium transporter |
NHX | Na+/H+ antiporters |
AKT | Arabidopsis-like potassium transporter |
MAPK | mitogen-activated protein kinase |
L-CD | L-cysteine desulfhydrase |
NBT | Nitroblue tetrazolium |
References
- Sun, Y.; Ma, C.; Kang, X.; Zhang, L.; Wang, J.; Zheng, S.; Zhang, T. Hydrogen sulfide and nitric oxide are involved in melatonin-induced salt tolerance in cucumber. Plant Physiol. Biochem. 2021, 167, 101–112. [Google Scholar] [CrossRef] [PubMed]
- Yildirim, E.; Ekinci, M.; Turan, M.; Dursun, A.; Kul, R.; Parlakova, F. Roles of glycine betaine in mitigating deleterious effect of salt stress on lettuce (Lactuca sativa L.). Arch. Agron. Soil Sci. 2015, 61, 1673–1689. [Google Scholar] [CrossRef]
- Ragaey, M.M.; Sadak, M.S.; Dawood, M.F.; Mousa, N.H.; Hanafy, R.S.; Latef, A.A.H.A. Role of signaling molecules sodium nitroprusside and arginine in alleviating salt-Induced oxidative stress in wheat. Plants 2022, 11, 1786. [Google Scholar] [CrossRef] [PubMed]
- Abobatta, W.F. Plant responses and tolerance to combined salt and drought stress. In Salt and Drought Stress Tolerance in Plants; Springer: Berlin/Heidelberg, Germany, 2020; pp. 17–52. [Google Scholar]
- Chhabra, R. Salt-Affected Soils and Marginal Waters: Global Perspectives and Sustainable Management; Springer Nature: Berlin/Heidelberg, Germany, 2022. [Google Scholar]
- Gong, Z. Plant abiotic stress: New insights into the factors that activate and modulate plant responses. J. Integr. Plant Biol. 2021, 63, 429. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, J.-K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar] [CrossRef] [Green Version]
- Shams, M.; Ekinci, M.; Ors, S.; Turan, M.; Agar, G.; Kul, R.; Yildirim, E. Nitric oxide mitigates salt stress effects of pepper seedlings by altering nutrient uptake, enzyme activity and osmolyte accumulation. Physiol. Mol. Biol. Plants 2019, 25, 1149–1161. [Google Scholar] [CrossRef]
- Van Zelm, E.; Zhang, Y.; Testerink, C. Salt tolerance mechanisms of plants. Annu. Rev. Plant Biol. 2020, 71, 403–433. [Google Scholar] [CrossRef] [Green Version]
- Sadak, M.S. Physiological Role of Arbuscular Mycorrhizae and Vitamin B1 on Productivity and Physio-Biochemical Traits of White Lupine (Lupinus termis L.) Under Salt Stress. Gesunde Pflanz. 2023, 1–12. [Google Scholar] [CrossRef]
- da-Silva, C.J.; Modolo, L.V. Hydrogen sulfide: A new endogenous player in an old mechanism of plant tolerance to high salinity. Acta Bot. Bras. 2017, 32, 150–160. [Google Scholar] [CrossRef] [Green Version]
- Srivastava, V.; Chowdhary, A.A.; Verma, P.K.; Mehrotra, S.; Mishra, S. Hydrogen sulfide-mediated mitigation and its integrated signaling crosstalk during salinity stress. Physiol. Plant. 2022, 174, e13633. [Google Scholar] [CrossRef]
- Chen, P.; Yang, W.; Jin, S.; Liu, Y. Hydrogen sulfide alleviates salinity stress in Cyclocarya paliurus by maintaining chlorophyll fluorescence and regulating nitric oxide level and antioxidant capacity. Plant Physiol. Biochem. 2021, 167, 738–747. [Google Scholar] [CrossRef]
- Jiang, J.-L.; Tian, Y.; Li, L.; Yu, M.; Hou, R.-P.; Ren, X.-M. H2S alleviates salinity stress in cucumber by maintaining the Na+/K+ balance and regulating H2S metabolism and oxidative stress response. Front. Plant Sci. 2019, 10, 678. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.-L.; Shen, Z.-J.; Simon, M.; Li, H.; Ma, D.-N.; Zhu, X.-Y.; Zheng, H.-L. Comparative proteomic analysis reveals the regulatory effects of H2S on salt tolerance of mangrove plant Kandelia obovata. Int. J. Mol. Sci. 2019, 21, 118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deng, Y.-Q.; Bao, J.; Yuan, F.; Liang, X.; Feng, Z.-T.; Wang, B.-S. Exogenous hydrogen sulfide alleviates salt stress in wheat seedlings by decreasing Na+ content. Plant Growth Regul. 2016, 79, 391–399. [Google Scholar] [CrossRef]
- Wei, M.-Y.; Liu, J.-Y.; Li, H.; Hu, W.-J.; Shen, Z.-J.; Qiao, F.; Zhu, C.-Q.; Chen, J.; Liu, X.; Zheng, H.-L. Proteomic analysis reveals the protective role of exogenous hydrogen sulfide against salt stress in rice seedlings. Nitric Oxide 2021, 111, 14–30. [Google Scholar] [CrossRef] [PubMed]
- Julkowska, M.M.; Koevoets, I.T.; Mol, S.; Hoefsloot, H.; Feron, R.; Tester, M.A.; Keurentjes, J.J.; Korte, A.; Haring, M.A.; de Boer, G.-J. Genetic components of root architecture remodeling in response to salt stress. Plant Cell 2017, 29, 3198–3213. [Google Scholar] [CrossRef] [Green Version]
- Rus, A.; Lee, B.-h.; Munoz-Mayor, A.; Sharkhuu, A.; Miura, K.; Zhu, J.-K.; Bressan, R.A.; Hasegawa, P.M. AtHKT1 facilitates Na+ homeostasis and K+ nutrition in planta. Plant Physiol. 2004, 136, 2500–2511. [Google Scholar] [CrossRef] [Green Version]
- Sahoo, D.P.; Kumar, S.; Mishra, S.; Kobayashi, Y.; Panda, S.K.; Sahoo, L. Enhanced salinity tolerance in transgenic mungbean overexpressing Arabidopsis antiporter (NHX1) gene. Mol. Breed. 2016, 36, 144. [Google Scholar] [CrossRef]
- Shi, H.; Ishitani, M.; Kim, C.; Zhu, J.-K. The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc. Natl. Acad. Sci. USA 2000, 97, 6896–6901. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Ishitani, M.; Halfter, U.; Kim, C.-S.; Zhu, J.-K. The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proc. Natl. Acad. Sci. USA 2000, 97, 3730–3734. [Google Scholar] [CrossRef] [PubMed]
- Ishitani, M.; Liu, J.; Halfter, U.; Kim, C.-S.; Shi, W.; Zhu, J.-K. SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding. Plant Cell 2000, 12, 1667–1677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, K.; Raina, S.K.; Sultan, S.M. Arabidopsis MAPK signaling pathways and their cross talks in abiotic stress response. J. Plant Biochem. Biotechnol. 2020, 29, 700–714. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, S. Mitogen-activated protein kinase cascades in signaling plant growth and development. Trends Plant Sci. 2015, 20, 56–64. [Google Scholar] [CrossRef]
- Hoang, M.H.T.; Nguyen, X.C.; Lee, K.; Kwon, Y.S.; Pham, H.T.T.; Park, H.C.; Yun, D.-J.; Lim, C.O.; Chung, W.S. Phosphorylation by AtMPK6 is required for the biological function of AtMYB41 in Arabidopsis. Biochem. Biophys. Res. Commun. 2012, 422, 181–186. [Google Scholar] [CrossRef]
- Moustafa, K.; AbuQamar, S.; Jarrar, M.; Al-Rajab, A.J.; Trémouillaux-Guiller, J. MAPK cascades and major abiotic stresses. Plant Cell Rep. 2014, 33, 1217–1225. [Google Scholar] [CrossRef] [Green Version]
- Wen, Y.; Li, X.; Guo, C.; Ma, C.; Duan, W.; Lu, W.; Xiao, K. Characterization and expression analysis of mitogen-activated protein kinase cascade genes in wheat subjected to phosphorus and nitrogen deprivation, high salinity, and drought. J. Plant Biochem. Biotechnol. 2015, 24, 184–196. [Google Scholar] [CrossRef]
- Shahid, M.A.; Sarkhosh, A.; Khan, N.; Balal, R.M.; Ali, S.; Rossi, L.; Gómez, C.; Mattson, N.; Nasim, W.; Garcia-Sanchez, F. Insights into the physiological and biochemical impacts of salt stress on plant growth and development. Agronomy 2020, 10, 938. [Google Scholar] [CrossRef]
- Wang, Q.; Huo, Z.; Zhang, L.; Wang, J.; Zhao, Y. Impact of saline water irrigation on water use efficiency and soil salt accumulation for spring maize in arid regions of China. Agric. Water Manag. 2016, 163, 125–138. [Google Scholar] [CrossRef]
- Dawood, M.F.; Sofy, M.R.; Mohamed, H.I.; Sofy, A.R.; Abdel-kader, H.A. Hydrogen sulfide modulates salinity stress in common bean plants by maintaining osmolytes and regulating nitric oxide levels and antioxidant enzyme expression. J. Soil Sci. Plant Nutr. 2022, 22, 3708–3726. [Google Scholar] [CrossRef]
- Verma, T.; Bhardwaj, S.; Raza, A.; Djalovic, I.; Prasad, P.V.; Kapoor, D. Mitigation of salt stress in Indian mustard (Brassica juncea L.) by the application of triacontanol and hydrogen sulfide. Plant Signal. Behav. 2023, 18, 2189371. [Google Scholar] [CrossRef] [PubMed]
- Hernández, J.A.; Almansa, M.S. Short-term effects of salt stress on antioxidant systems and leaf water relations of pea leaves. Physiol. Plant. 2002, 115, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Acosta-Motos, J.R.; Diaz-Vivancos, P.; Álvarez, S.; Fernández-García, N.; Sánchez-Blanco, M.J.; Hernández, J.A. NaCl-induced physiological and biochemical adaptative mechanisms in the ornamental Myrtus communis L. plants. J. Plant Physiol. 2015, 183, 41–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hameed, A.; Ahmed, M.Z.; Hussain, T.; Aziz, I.; Ahmad, N.; Gul, B.; Nielsen, B.L. Effects of salinity stress on chloroplast structure and function. Cells 2021, 10, 2023. [Google Scholar] [CrossRef]
- Yan, F.; Zhang, J.; Li, W.; Ding, Y.; Zhong, Q.; Xu, X.; Wei, H.; Li, G. Exogenous melatonin alleviates salt stress by improving leaf photosynthesis in rice seedlings. Plant Physiol. Biochem. 2021, 163, 367–375. [Google Scholar] [CrossRef]
- Ding, H.; Ma, D.; Huang, X.; Hou, J.; Wang, C.; Xie, Y.; Wang, Y.; Qin, H.; Guo, T. Exogenous hydrogen sulfide alleviates salt stress by improving antioxidant defenses and the salt overly sensitive pathway in wheat seedlings. Acta Physiol. Plant. 2019, 41, 123. [Google Scholar] [CrossRef]
- Ekinci, M.; Yildirim, E.; Turan, M. Ameliorating effects of hydrogen sulfide on growth, physiological and biochemical characteristics of eggplant seedlings under salt stress. S. Afr. J. Bot. 2021, 143, 79–89. [Google Scholar] [CrossRef]
- Turan, M.; Ekinci, M.; Kul, R.; Boynueyri, F.G.; Yildirim, E. Mitigation of salinity stress in cucumber seedlings by exogenous hydrogen sulfide. J. Plant Res. 2022, 135, 517–529. [Google Scholar] [CrossRef]
- Maxwell, K.; Johnson, G.N. Chlorophyll fluorescence—A practical guide. J. Exp. Bot. 2000, 51, 659–668. [Google Scholar] [CrossRef]
- Ikbal, F.E.; Hernández, J.A.; Barba-Espín, G.; Koussa, T.; Aziz, A.; Faize, M.; Diaz-Vivancos, P. Enhanced salt-induced antioxidative responses involve a contribution of polyamine biosynthesis in grapevine plants. J. Plant Physiol. 2014, 171, 779–788. [Google Scholar] [CrossRef] [Green Version]
- Christou, A.; Manganaris, G.A.; Papadopoulos, I.; Fotopoulos, V. Hydrogen sulfide induces systemic tolerance to salinity and non-ionic osmotic stress in strawberry plants through modification of reactive species biosynthesis and transcriptional regulation of multiple defence pathways. J. Exp. Bot. 2013, 64, 1953–1966. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Guo, Y. Unraveling salt stress signaling in plants. J. Integr. Plant Biol. 2018, 60, 796–804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, H.J.; Kim, W.-Y.; Yun, D.-J. A new insight of salt stress signaling in plant. Mol. Cells 2016, 39, 447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, H.; Ye, T.; Chan, Z. Exogenous application of hydrogen sulfide donor sodium hydrosulfide enhanced multiple abiotic stress tolerance in bermudagrass (Cynodon dactylon (L). Pers.). Plant Physiol. Biochem. 2013, 71, 226–234. [Google Scholar] [CrossRef] [PubMed]
- Shan, C.; Liu, H.; Zhao, L.; Wang, X. Effects of exogenous hydrogen sulfide on the redox states of ascorbate and glutathione in maize leaves under salt stress. Biol. Plant. 2014, 58, 169–173. [Google Scholar] [CrossRef]
- Mostofa, M.G.; Saegusa, D.; Fujita, M.; Tran, L.-S.P. Hydrogen sulfide regulates salt tolerance in rice by maintaining Na+/K+ balance, mineral homeostasis and oxidative metabolism under excessive salt stress. Front. Plant Sci. 2015, 6, 1055. [Google Scholar] [CrossRef] [Green Version]
- Kaya, C.; Ugurlar, F.; Ashraf, M.; Alam, P.; Ahmad, P. Nitric oxide and hydrogen sulfide work together to improve tolerance to salinity stress in wheat plants by upraising the AsA–GSH cycle. Plant Physiol. Biochem. 2023, 194, 651–663. [Google Scholar] [CrossRef]
- Lai, D.; Mao, Y.; Zhou, H.; Li, F.; Wu, M.; Zhang, J.; He, Z.; Cui, W.; Xie, Y. Endogenous hydrogen sulfide enhances salt tolerance by coupling the reestablishment of redox homeostasis and preventing salt-induced K+ loss in seedlings of Medicago sativa. Plant Sci. 2014, 225, 117–129. [Google Scholar] [CrossRef]
- Horie, T.; Karahara, I.; Katsuhara, M. Salinity tolerance mechanisms in glycophytes: An overview with the central focus on rice plants. Rice 2012, 5, 11. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Wang, W.-H.; Wu, F.-H.; He, E.-M.; Liu, X.; Shangguan, Z.-P.; Zheng, H.-L. Hydrogen sulfide enhances salt tolerance through nitric oxide-mediated maintenance of ion homeostasis in barley seedling roots. Sci. Rep. 2015, 5, 12516. [Google Scholar] [CrossRef] [Green Version]
- Zhao, N.; Zhu, H.; Zhang, H.; Sun, J.; Zhou, J.; Deng, C.; Zhang, Y.; Zhao, R.; Zhou, X.; Lu, C.; et al. Hydrogen sulfide mediates K+ and Na+ homeostasis in the roots of salt-resistant and salt-sensitive poplar species subjected to NaCl stress. Front. Plant Sci. 2018, 9, 1366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, S.; Wang, Y.; Yan, Y.; Liu, Y.; Wang, J.; Chen, S. A review on plant responses to salt stress and their mechanisms of salt resistance. Horticulturae 2021, 7, 132. [Google Scholar] [CrossRef]
- Yildirim, E.; Ekinci, M.; Turan, M.; Ors, S.; Dursun, A. Physiological, morphological and biochemical responses of exogenous hydrogen sulfide in salt-stressed tomato seedlings. Sustainability 2023, 15, 1098. [Google Scholar] [CrossRef]
- Sottosanto, J.B.; Gelli, A.; Blumwald, E. DNA array analyses of Arabidopsis thaliana lacking a vacuolar Na+/H+ antiporter: Impact of AtNHX1 on gene expression. Plant J. 2004, 40, 752–771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garriga, M.; Raddatz, N.; Véry, A.-A.; Sentenac, H.; Rubio-Meléndez, M.E.; González, W.; Dreyer, I. Cloning and functional characterization of HKT1 and AKT1 genes of Fragaria spp.—Relationship to plant response to salt stress. J. Plant Physiol. 2017, 210, 9–17. [Google Scholar] [CrossRef]
- Cheng, P.; Zhang, Y.; Wang, J.; Guan, R.; Pu, H.; Shen, W. Importance of hydrogen sulfide as the molecular basis of heterosis in hybrid Brassica napus: A case study in salinity response. Environ. Exp. Bot. 2022, 193, 104693. [Google Scholar] [CrossRef]
- Wei, M.-Y.; Li, H.; Zhang, L.-D.; Guo, Z.-J.; Liu, J.-Y.; Ding, Q.-S.; Zhong, Y.-H.; Li, J.; Ma, D.-N.; Zheng, H.-L. Exogenous hydrogen sulfide mediates Na+ and K+ fluxes of salt gland in salt-secreting mangrove plant Avicennia marina. Tree Physiol. 2022, 42, 1812–1826. [Google Scholar] [CrossRef]
- Sharma, D.; Verma, N.; Pandey, C.; Verma, D.; Bhagat, P.K.; Noryang, S.; Singh, K.; Tayyeba, S.; Banerjee, G.; Sinha, A.K. MAP kinase as regulators for stress responses in plants: An overview. In Protein Kinases and Stress Signaling in Plants: Functional Genomic Perspective; Wiley: Hoboken, NJ, USA, 2020; pp. 369–392. [Google Scholar]
- Cai, G.; Wang, G.; Wang, L.; Pan, J.; Liu, Y.; Li, D. ZmMKK1, a novel group A mitogen-activated protein kinase kinase gene in maize, conferred chilling stress tolerance and was involved in pathogen defense in transgenic tobacco. Plant Sci. 2014, 214, 57–73. [Google Scholar] [CrossRef]
- Zhang, T.; Shi, Z.; Zhang, X.; Zheng, S.; Wang, J.; Mo, J. Alleviating effects of exogenous melatonin on salt stress in cucumber. Sci. Hortic. 2020, 262, 109070. [Google Scholar] [CrossRef]
- Qi, Q.; Guo, Z.; Liang, Y.; Li, K.; Xu, H. Hydrogen sulfide alleviates oxidative damage under excess nitrate stress through MAPK/NO signaling in cucumber. Plant Physiol. Biochem. 2019, 135, 1–8. [Google Scholar] [CrossRef]
- Wu, Y.; Jin, X.; Liao, W.; Hu, L.; Dawuda, M.M.; Zhao, X.; Tang, Z.; Gong, T.; Yu, J. 5-Aminolevulinic acid (ALA) alleviated salinity stress in cucumber seedlings by enhancing chlorophyll synthesis pathway. Front. Plant Sci. 2018, 9, 635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, S.; Tang, Z.; Yu, J.; Liao, W.; Xie, J.; Lv, J.; Feng, Z.; Dawuda, M.M. Hydrogen sulfide negatively regulates cd-induced cell death in cucumber (Cucumis sativus L) root tip cells. BMC Plant Biol. 2020, 20, 480. [Google Scholar] [CrossRef] [PubMed]
- Mostofa, M.G.; Fujita, M. Salicylic acid alleviates copper toxicity in rice (Oryza sativa L.) seedlings by up-regulating antioxidative and glyoxalase systems. Ecotoxicology 2013, 22, 959–973. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
Actin | GCCCTCCCTCATGCCATTCT | TCGGCAGTGGTGGTGAACAT |
SOS1 | CGGTAGCATGGTTGATTTTCG | GATTCGACCGGCTATGAGATG |
SOS2 | TGTGGAACCCCTGCTTATGTC | CGCACGACCAAATATCAGCTT |
SOS3 | CAAGGAAGAGTGGCGAAACC | TGGGAACGTGGTCGTGATATC |
MPK3 | GTCCTCCGATTATGCCTATTGG | TCTTAACCGCAACCATTTCGT |
MPK4 | AATCGACGCCAAAAGGACAT | CTCTTTTTGGCGGCCTAATG |
MPK6 | CCGTGCACCAGAGCTCTTACT | CAAGGGCTTCCGATCCATTA |
MPK9 | CGTGCTCCCGAACTTTGTG | TTCCAGTAAGCATTTCCGCA |
NHX1 | TGCTTTTGCCACCCTTTCA | TTCCAACCAGAACCAATCCC |
AKT1 | CTGTTCGTACAAAGCGATTG | TCCAACAAAACTCCTTCCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, S.; Liu, Z.; Wan, Z.; He, X.; Lv, J.; Yu, J.; Zhang, G. Foliar Spraying of NaHS Alleviates Cucumber Salt Stress by Maintaining N+/K+ Balance and Activating Salt Tolerance Signaling Pathways. Plants 2023, 12, 2450. https://doi.org/10.3390/plants12132450
Luo S, Liu Z, Wan Z, He X, Lv J, Yu J, Zhang G. Foliar Spraying of NaHS Alleviates Cucumber Salt Stress by Maintaining N+/K+ Balance and Activating Salt Tolerance Signaling Pathways. Plants. 2023; 12(13):2450. https://doi.org/10.3390/plants12132450
Chicago/Turabian StyleLuo, Shilei, Zeci Liu, Zilong Wan, Xianxia He, Jian Lv, Jihua Yu, and Guobin Zhang. 2023. "Foliar Spraying of NaHS Alleviates Cucumber Salt Stress by Maintaining N+/K+ Balance and Activating Salt Tolerance Signaling Pathways" Plants 12, no. 13: 2450. https://doi.org/10.3390/plants12132450