Regulation of Protein-Induced Apoptosis and Autophagy in Human Hepatocytes Treated with Metformin and Paclitaxel In Silico and In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Evaluation of Antitumor Effects
2.2. Assessing the Apoptosis in Treated HepG2 Cells Using Annexin V-PE/7-AAD
2.3. Flow Cytometric Assessment of Cell Cycle Progression in Treated HepG2 Cells Using the Propidium Iodide
2.4. Molecular Docking Study: Ligand and Protein Determination and Preparation
2.5. The Gene Expression of Adenosine Monophosphate Kinase (AMPK-α), Epidermal Growth Factor (EGFR), Total p53 (Tp53), Caspase-3, Beclin 1, and ATG4A
2.5.1. Extraction of RNA
2.5.2. cDNA Synthesis
2.5.3. Real-Time qPCR with SYBR Green
2.6. Statistical Analysis
3. Results
3.1. Antitumor Effects of Paclitaxel and Metformin and Their Association on HepG2, HCT116, and MCF-7 Cells
3.2. Percentage of Apoptosis in HepG2 Treated Cells
3.3. Flow Cytometry Analysis of the Cell Cycle
3.4. Metformin and Paclitaxel Bind to Related Protein Signaling Pathway
3.5. Genes Expression of AMPK-α, EGFR, TP53, Caspase-3, Beclin 1, and ATG4A in Treated HepG2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Johnstone, R.W.; Ruefli, A.A.; Lowe, S.W. Apoptosis: A link between cancer genetics and chemotherapy. Cell 2002, 108, 153–164. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Peng, M.; Wang, Z.; Zhou, S.; Xiao, D.; Deng, J.; Yang, X.; Peng, J.; Yang, X. Novel application of metformin combined with targeted drugs on anticancer treatment. Cancer Sci. 2019, 110, 23–30. [Google Scholar] [CrossRef] [PubMed]
- Kasznicki, J.; Sliwinska, A.; Drzewoski, J. Metformin in cancer prevention and therapy. Ann. Transl. Med. 2014, 2, 57. [Google Scholar] [PubMed]
- Khanna, C.; Rosenberg, M.; Vail, D. A review of paclitaxel and novel formulations including those suitable for use in dogs. J. Vet. Intern. Med. 2015, 29, 1006–1012. [Google Scholar] [CrossRef]
- Zi, F.; Zi, H.; Li, Y.; He, J.; Shi, Q.; Cai, Z. Metformin and cancer: An existing drug for cancer prevention and therapy. Oncol. Lett. 2018, 15, 683–690. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zhou, P.; Xu, K.; Chen, T.; Jiao, J.; Wei, H.; Yang, X.; Xu, W.; Wan, W.; Xiao, J. Metformin induces cell cycle arrest, apoptosis and autophagy through ROS/JNK signaling pathway in human osteosarcoma. Int. J. Biol. Sci. 2020, 16, 74. [Google Scholar] [CrossRef]
- Kim, S.M.; Ha, S.E.; Lee, H.J.; Rampogu, S.; Vetrivel, P.; Kim, H.H.; Venkatarame Gowda Saralamma, V.; Lee, K.W.; Kim, G.S. Sinensetin induces autophagic cell death through p53-related AMPK/mTOR signaling in hepatocellular carcinoma HepG2 cells. Nutrients 2020, 12, 2462. [Google Scholar] [CrossRef]
- Amaravadi, R.K.; Kimmelman, A.C.; Debnath, J. Targeting Autophagy in Cancer: Recent Advances and Future DirectionsTargeting Autophagy in Cancer. Cancer Discov. 2019, 9, 1167–1181. [Google Scholar] [CrossRef]
- Zou, Z.; Tao, T.; Li, H.; Zhu, X. mTOR signaling pathway and mTOR inhibitors in cancer: Progress and challenges. Cell Biosci. 2020, 10, 1–11. [Google Scholar] [CrossRef]
- Ali, E.M.; Elashkar, A.A.; El-Kassas, H.Y.; Salim, E.I. Methotrexate loaded on magnetite iron nanoparticles coated with chitosan: Biosynthesis, characterization, and impact on human breast cancer MCF-7 cell line. Int. J. Biol. Macromol. 2018, 120, 1170–1180. [Google Scholar] [CrossRef]
- Salim, E.I.; Abd El Khalik, E.A.; Shalaby, T.I.; Ali, E.M. Synthesis, characterisation and enhanced apoptotic effect of gemcitabine-loaded albumin nanoparticles coating with chitosan. Arch. Physiol. Biochem. 2022, 128, 970–978. [Google Scholar] [CrossRef] [PubMed]
- Derby, E.; Reddy, V.; Kopp, W.; Nelson, E.; Baseler, M.; Sayers, T.; Malyguine, A. Three-color flow cytometric assay for the study of the mechanisms of cell-mediated cytotoxicity. Immunol. Lett. 2001, 78, 35–39. [Google Scholar] [CrossRef]
- Fried, J.; Perez, A.G.; Clarkson, B.D. Flow cytofluorometric analysis of cell cycle distributions using propidium iodide. Properties of the method and mathematical analysis of the data. J. Cell Biol. 1976, 71, 172–181. [Google Scholar] [CrossRef] [PubMed]
- Bikadi, Z.; Hazai, E. Application of the PM6 semi-empirical method to modeling proteins enhances docking accuracy of AutoDock. J. Cheminformatics 2009, 1, 15. [Google Scholar] [CrossRef]
- Stewart, J.J. Application of the PM6 method to modeling proteins. J. Mol. Model. 2009, 15, 765–805. [Google Scholar] [CrossRef]
- Bilal, M.S.; Ejaz, S.A.; Zargar, S.; Akhtar, N.; Wani, T.A.; Riaz, N.; Aborode, A.T.; Siddique, F.; Altwaijry, N.; Alkahtani, H.M.; et al. Computational investigation of 1, 3, 4 oxadiazole derivatives as lead inhibitors of VEGFR 2 in comparison with EGFR: Density functional theory, molecular docking and molecular dynamics simulation studies. Biomolecules 2022, 12, 1612. [Google Scholar] [CrossRef] [PubMed]
- Solis, F.J.; Wets, R.J.-B. Minimization by random search techniques. Math. Oper. Res. 1981, 6, 19–30. [Google Scholar] [CrossRef]
- Huey, R.; Morris, G.M.; Olson, A.J.; Goodsell, D.S. A semiempirical free energy force field with charge-based desolvation. J. Comput. Chem. 2007, 28, 1145–1152. [Google Scholar] [CrossRef]
- Salentin, S.; Schreiber, S.; Haupt, V.J.; Adasme, M.F.; Schroeder, M. PLIP: Fully automated protein–ligand interaction profiler. Nucleic Acids Res. 2015, 43, W443–W447. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Evans, J.M.; Donnelly, L.A.; Emslie-Smith, A.M.; Alessi, D.R.; Morris, A.D. Metformin and reduced risk of cancer in diabetic patients. BMJ 2005, 330, 1304–1305. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, M.-X.; Duan, X.; Zhou, S.; Ermek, T.; Wang, Y.; Cai, H.; Wang, J. Effects of antidiabetic drug metformin on human breast carcinoma cells with different estrogen receptor expressing in vitro. Chin. J. Cell. Mol. Immunol. 2011, 27, 253–256. [Google Scholar]
- Rocha, G.Z.; Dias, M.M.; Ropelle, E.R.; Osório-Costa, F.; Rossato, F.A.; Vercesi, A.E.; Saad, M.J.; Carvalheira, J.B. Metformin amplifies chemotherapy-induced AMPK activation and antitumoral growth. Clin. Cancer Res. 2011, 17, 3993–4005. [Google Scholar] [CrossRef] [PubMed]
- Hanna, R.K.; Zhou, C.; Malloy, K.M.; Sun, L.; Zhong, Y.; Gehrig, P.A.; Bae-Jump, V.L. Metformin potentiates the effects of paclitaxel in endometrial cancer cells through inhibition of cell proliferation and modulation of the mTOR pathway. Gynecol. Oncol. 2012, 125, 458–469. [Google Scholar] [CrossRef]
- Saraei, P.; Asadi, I.; Kakar, M.A.; Moradi-Kor, N. The beneficial effects of metformin on cancer prevention and therapy: A comprehensive review of recent advances. Cancer Manag. Res. 2019, 11, 3295. [Google Scholar] [CrossRef]
- Min, J.; Shen, H.; Xi, W.; Wang, Q.; Yin, L.; Zhang, Y.; Yu, Y.; Yang, Q.; Wang, Z.-N. Synergistic anticancer activity of combined use of caffeic acid with paclitaxel enhances apoptosis of non-small-cell lung cancer H1299 cells in vivo and in vitro. Cell. Physiol. Biochem. 2018, 48, 1433–1442. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Moudgil, T.; Ross, H.; Hu, H.-M. Apoptosis of non-small-cell lung cancer cell lines after paclitaxel treatment involves the BH3-only proapoptotic protein Bim. Cell Death Differ. 2005, 12, 292–303. [Google Scholar] [CrossRef]
- Zhu, Z.; Chen, D.; Zhang, W.; Zhao, J.; Zhi, L.; Huang, F.; Ji, H.; Zhang, J.; Liu, H.; Zou, L. Modulation of alternative splicing induced by paclitaxel in human lung cancer. Cell Death Dis. 2018, 30, 491. [Google Scholar] [CrossRef]
- Guo, W.; Zeng, C.; Dong, F.; Lei, W. Paclitaxel-induced apoptosis in osteosarcoma cell line U-2 OS. Chin. Med. J. 2002, 115, 1796–1801. [Google Scholar]
- Sacco, F.; Calderone, A.; Castagnoli, L.; Cesareni, G. The cell-autonomous mechanisms underlying the activity of metformin as an anticancer drug. Br. J. Cancer 2016, 115, 1451–1456. [Google Scholar] [CrossRef]
- Al-Zahrani, N.S.; Ali, E.M.; Kalantan, A.A.; Abdulaziz, M. European Journal of Cell Science. Eur. J. Cell Sci. 2020, 2, 10–19. [Google Scholar] [CrossRef]
- Ko, G.; Kim, T.; Ko, E.; Park, D.; Lee, Y. Synergistic enhancement of paclitaxel-induced inhibition of cell growth by metformin in melanoma cells. Dev. Reprod. 2019, 23, 119. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Zhang, N.; Wang, R.; Huang, F.; Li, G. Paclitaxel induces apoptosis and reduces proliferation by targeting epidermal growth factor receptor signaling pathway in oral cavity squamous cell carcinoma. Oncol. Lett. 2015, 10, 2378–2384. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.; Wang, Y.; Zhan, X. The MAPK pathway-based drug therapeutic targets in pituitary adenomas. Front. Endocrinol. 2019, 10, 330. [Google Scholar] [CrossRef]
- Meloche, S.; Pouysségur, J. The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1-to S-phase transition. Oncogene 2007, 26, 3227–3239. [Google Scholar] [CrossRef]
- Kralova, J.; Dvorak, M.; Koc, M.; Kral, V. p38 MAPK plays an essential role in apoptosis induced by photoactivation of a novel ethylene glycol porphyrin derivative. Oncogene 2008, 27, 3010–3020. [Google Scholar] [CrossRef]
- Tan, G.; Heqing, L.; Jiangbo, C.; Ming, J.; Yanhong, M.; Xianghe, L.; Hong, S.; Li, G. Apoptosis induced by low-dose paclitaxel is associated with p53 upregulation in nasopharyngeal carcinoma cells. Int. J. Cancer 2002, 97, 168–172. [Google Scholar] [CrossRef]
- Weaver, B.A. How Taxol/paclitaxel kills cancer cells. Mol. Biol. Cell 2014, 25, 2677–2681. [Google Scholar] [CrossRef]
- Yi, Y.; Zhang, W.; Yi, J.; Xiao, Z.-X. Role of p53 family proteins in metformin anti-cancer activities. J. Cancer 2019, 10, 2434. [Google Scholar] [CrossRef]
- Lu, K.H.; Lue, K.H.; Chou, M.C.; Chung, J.G. Paclitaxel induces apoptosis via caspase-3 activation in human osteogenic sarcoma cells (U-2 OS). J. Orthop. Res. 2005, 23, 988–994. [Google Scholar] [CrossRef]
- Queiroz, E.A.; Puukila, S.; Eichler, R.; Sampaio, S.C.; Forsyth, H.L.; Lees, S.J.; Barbosa, A.M.; Dekker, R.F.; Fortes, Z.B.; Khaper, N. Metformin induces apoptosis and cell cycle arrest mediated by oxidative stress, AMPK and FOXO3a in MCF-7 breast cancer cells. PLoS ONE 2014, 9, e98207. [Google Scholar] [CrossRef] [PubMed]
- Jung, S.; Jeong, H.; Yu, S.-W. Autophagy as a decisive process for cell death. Exp. Mol. Med. 2020, 52, 921–930. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Huang, Z.; Hong, L.; Lu, J.H.; Feng, D.; Yin, X.M.; Li, M. Targeting ATG4 in cancer therapy. Cancers 2011, 11, 649. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.L.; Liu, J.F.; Liu, Y.; Wang, Y.X.; Fu, K.F.; Yu, X.J.; Pu, Q.; Chen, X.X.; Zhou, L.J. Beclin1 inhibition enhances paclitaxel-mediated cytotoxicity in breast cancer in vitro and in vivo. Int. J. Mol. Med. 2019, 43, 1866–1878. [Google Scholar] [CrossRef]
- Tsapras, P.; Nezis, I.P. Caspase involvement in autophagy. Cell Death Differ. 2017, 24, 1369–1379. [Google Scholar] [CrossRef]
- Chen, K.; Shi, W. Autophagy regulates resistance of non-small cell lung cancer cells to paclitaxel. Tumor Biol. 2016, 37, 10539–10544. [Google Scholar] [CrossRef]
- Peng, X.; Gong, F.; Chen, Y.; Jiang, Y.; Liu, J.; Yu, M.; Zhang, S.; Wang, M.; Xiao, G.; Liao, H. Autophagy promotes paclitaxel resistance of cervical cancer cells: Involvement of Warburg effect activated hypoxia-induced factor 1-α-mediated signaling. Cell Death Dis. 2014, 5, e1367. [Google Scholar] [CrossRef]
- De Santi, M.; Baldelli, G.; Diotallevi, A.; Galluzzi, L.; Schiavano, G.F.; Brandi, G. Metformin prevents cell tumorigenesis through autophagy-related cell death. Sci. Rep. 2019, 9, 66. [Google Scholar] [CrossRef]
Gene |
Forward Primer (5\------3\) |
Reverse Primer (5\------3\) |
---|---|---|
AMPKα | CCGAGAAGCAGAAACACGACG | CCTACCACATCAAGGCTCCGA |
EGFR | TATTGATCGGGAGAGCCGGA | TGCGTGAGCTTGTTACTCGT |
TP53 | GCCCTCCTCAGCATCTTAT | GGTACAGTCAGAGCCAACCT |
Caspase3 | AGGTATCCATGGAGAACACTGA | GAGTCCATTGATTCGCTTCCA |
Beclin1 | AATGGTGGCTTTCCTGGACT | TGATGGAATAGGAGCCGCCA |
ATG4A | ACTGGAGCTGGGAGAAACAA | GTCCAAACCATTCTCCAATTGAT |
GAPDH | GACAGTCAGCCGCATCTTCT | GCGCCCAATACGACCAAATC |
Drugs | MET | PXT | PXT and MET | |
---|---|---|---|---|
Cells | ||||
HepG2 | ||||
Range | 328.9–451.4 | 2.249–2.885 | 1.132–1.782 | |
Mean ± SD | 385 ± 61.31 | 2.55 ± 0.318 | 1.42 ± 0.326 | |
HCT116 | ||||
Range | 224.6–390.1 | 3.403–4.164 | 2.624–3.292 | |
Mean ± SD | 296 ± 83.01 | 3.77 ± 0.381 | 2.94 ± 0.334 | |
MCF7 | ||||
Range | 227.2–342.1 | 8.267–10.88 | 6.302–7.545 | |
Mean ± SD | 279 ± 57.55 | 9.48 ± 1.308 | 6.89 ± 0.622 |
Target Protein Name | AMPK (PDB: 4EAG) | EGFRK (PDB: 1M17) | FKBP12-Rapamycin-mTOR-FRB (PDB: 1FAP) | |||
---|---|---|---|---|---|---|
Drug Name | M | P | M | P | M | P |
Estimated free energy of binding (kcal/mol) | −2.76 | −11.01 | −4.92 | −10.59 | −4.76 | −15.63 |
Estimated inhibition constant, Ki | 9.53 mM | 8.49 nM | 248.54 μM | 17.22 nM | 325.8 μM | 3.4 pM |
vdW + Hbond + desolving energy | −3.42 | −13.12 | −3.75 | −10.38 | −3.50 | −15.71 |
Electrostatic energy (kcal/mol) | +0.66 | −0.09 | −1.17 | +0.58 | −1.25 | +0.09 |
Total intermolecular. energy (kcal/mol) | −2.76 | −13.21 | −4.92 | −9.79 | −4.76 | −15.62 |
Frequency | 100% | 4% | 97% | 7% | 99% | 10% |
Interaction surface | 433.077 | 1387.968 | 330.443 | 1062.054 | 414.376 | 1314.83 |
Target Protein Name | Ppiase Domain of FKBP51-Rapamycin-mTOR-FRB (PDB: 4DRH) | Beclin1(PDB: 3Q8T) | ATG16L1d (PDB: 5NUV) | |||
Drug Name | M | P | M | P | M | P |
Estimated free energy of binding (kcal/mol) | −4.99 | −14.15 | −7.41 | −6.92 | −4.31 | −7.33 |
Estimated inhibition constant, Ki | 221.4 μM | 42.3 pM | 3.67 μM | 8.45 μM | 689.0 μM | 4.23 μM |
vdW + Hbond + desolving energy | −3.84 | −16.94 | −3.03 | −5.54 | −2.53 | −8.18 |
Electrostatic energy (kcal/mol) | −1.15 | +0.09 | −4.39 | +0.46 | −1.78 | −0.18 |
Total intermolecular energy (kcal/mol) | −4.99 | −16.85 | −7.41 | −5.08 | −4.31 | −8.35 |
Frequency | 37% | 17% | 98% | 1% | 86% | 1% |
Interaction surface | 438.319 | 1496.8 | 362.6 | 640.21 | 337.058 | 804.10 |
Target Protein Name | ATG4A(PDB: 2P82) | TP53(PDB: 3DCY) | Caspase3 (PDB: 3GJQ) | |||
Drug Name | M | P | M | P | M | P |
Estimated free energy of binding (kcal/mol) | −5.27 | −8.85 | −3.25 | −6.04 | −3.78 | −8.42 |
Estimated inhibition constant, Ki | 136.6 μM | 325.5 nM | 4.13 mM | 37.32 μM | 1.69 mM | 668.36 nM |
vdW + Hbond + desolving energy | −4.29 | −8.05 | −2.72 | −6.49 | −3.50 | −5.25 |
Electrostatic energy (kcal/mol) | −0.98 | −0.15 | −0.53 | −0.05 | −0.28 | −0.82 |
Total intermolecular energy (kcal/mol) | −5.27 | −8.20 | −3.25 | −6.54 | −3.78 | −6.07 |
Frequency | 80% | 5% | 11% | 1% | 31% | 1% |
Interaction surface | 354.99 | 827.38 | 332.852 | 773.58 | 293.164 | 723.251 |
AMPK (PDB: 4EAG) | |||||
---|---|---|---|---|---|
M | −2.76 | 3 | LYS126, MET84, ARG117, GLN122 | 3 | THR86, ARG117, GLN122, ASP89 |
P | −11.01 | 4 | ASP89(2), GLN122, ARG223 | 10 | THR88, TYR120, GLN122, LYS126, VAL129(2), ILE149(2), HIS150, ARG223 |
EGFRK(PDB: 1M17) | |||||
M | −4.92 | 4 | CYS773(2), PHE771,TYR777 | 1 | ASP776 |
P | −10.59 | 1 | ASP776 | 10 | LEU694, PHE699(2), VAL(3), ALA719, ARG817, LEU820 |
FKBP12-rapamycinmTOR-FRB (PDB: 1FAP) | |||||
M | −4.76 | 5 | LYS47(2), GLU54, TYR210(2) | GLU54(2) | |
P | −15.63 | 2 | TYR82, GLU54 | 15 | TYR26, PHE46, VAL55, ILE56, TRP59, TYR82, ILE90, PHE99, PHE2039(2), THR2098, TYR2105, HIS8, SER203, ASP37 |
Ppiase domain of FKBP51-rapamycin-mTOR-FRB (PDB: 4DRH) | |||||
M | −4.99 | 5 | GLY117, LEU119, PHE203, SER118, TYR203 | 3 | ARG204, ALA116, TYR2038 |
P | −14.15 | 3 | TYR57, GLN85, SER2035 | 17 | PHE67, PHE77(3), GLN85, VAL86, LYS121, ILE122, GLU2032, ARG2036, PHE2039(2), TRP2101, TYR2105, TRP90(2), ARG2036 |
Beclin 1, (PDB: 3Q8T) | |||||
M | −7.41 | 3 | GLU224, ASPB221, ALA217 | 3 | LEU220, ASPA221(2) |
P | −6.92 | 4 | GLU216A, GLU216B, ARGA219(2) | 9 | LEU220, ALA215, LYS212, GLU216A (2), GLU216(B), GLU 223, ARG219A, ARG219B |
ATG16L1d (PDB ID: 5NUV) | |||||
M | −4.31 | 2 | CYS356, GLU357 | 4 | PHE318, PHE358, TRP349,CYS316 |
P | −7.33 | 2 | ARG345, LYS347 | 7 | PHE318(3), ASP319, TRP349(2), PHE358, GLU357, PHE358 |
ATG4A (PDB: 2P82) | |||||
M | −5.27 | 6 | ASP174(2), SER172,ASN175(2), PRO228 | 1 | ASP174 |
P | −8.85 | 1 | ASN175 | 4 | PRO228,ARG230,ILE233(2) |
TP53 (PDB: 3DCY) | |||||
M | −3.25 | 4 | PRO30, LEU31(2), GLU29 | 4 | ARG15, PHE36, SER32, GLU33 |
P | −6.04 | 0 | 0 | 10 | ASP28,85, LEU59, LYS63, GLN64, HIS67, TYR83, TYR83, LYS63, LYS63 |
Caspase3 (PDB: 3GJQ) | |||||
M | −3.78 | 4 | SER63, SER65(3), THR62, HIS121 | 1 | ARG64 |
P | −8.42 | 3 | THR62(2), SER65 | 6 | ARG64, CYS163, HIS121, SER65, ASP70, GLN161 |
Genes | MET | PXT | PXT and MET |
---|---|---|---|
AMPK-α | 5.57 ± 0.436 | 0.6 ± 0.073 | 2.92 ± 0.278 |
EGFR | 0.936 ± 0.618 | 3.82 ± 0.583 | 8.44 ± 0.122 |
TP53 | 5.41 ± 2.06 | 4.568 ± 1.62 | 7.99 ± 2.13 |
Caspase3 | 3.6 ± 0.61 | 66.5 ± 4.14 | 33.0 ± 1.61 |
Beclin1 | 10.7 ± 1.33 | 4.26 ± 0.41 | 12.1 ± 0.431 |
ATG4A | 11.06 ± 1.90 | 1.77 ± 0.38 | 11.98 ± 1.18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Zahrani, N.S.; Zamzami, M.A.; Baghdadi, M.A.; El-Gowily, A.H.; Ali, E.M.M. Regulation of Protein-Induced Apoptosis and Autophagy in Human Hepatocytes Treated with Metformin and Paclitaxel In Silico and In Vitro. Biomedicines 2023, 11, 2688. https://doi.org/10.3390/biomedicines11102688
Al-Zahrani NS, Zamzami MA, Baghdadi MA, El-Gowily AH, Ali EMM. Regulation of Protein-Induced Apoptosis and Autophagy in Human Hepatocytes Treated with Metformin and Paclitaxel In Silico and In Vitro. Biomedicines. 2023; 11(10):2688. https://doi.org/10.3390/biomedicines11102688
Chicago/Turabian StyleAl-Zahrani, Norah Saeed, Mazin Abdulaziz Zamzami, Mohammed A. Baghdadi, Afnan H. El-Gowily, and Ehab M. M. Ali. 2023. "Regulation of Protein-Induced Apoptosis and Autophagy in Human Hepatocytes Treated with Metformin and Paclitaxel In Silico and In Vitro" Biomedicines 11, no. 10: 2688. https://doi.org/10.3390/biomedicines11102688