Parnassin, a Novel Therapeutic Peptide, Alleviates Skin Lesions in a DNCB-Induced Atopic Dermatitis Mouse Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Peptide Discovery
2.2. Peptide Synthesis
2.3. Animal Study
2.4. Histological Analysis
2.5. Cell Culture
2.6. Cell Viability Assay
2.7. Real-Time Quantitative PCR (RT-qPCR) Analysis
2.8. Western Blot Analysis
2.9. Statistical Analysis
3. Results
3.1. Effect of Parnassin in a DNCB-Induced AD Mouse Model
3.2. Effect of Parnassin on CCL17 and CCL22 mRNA Expression in TNF-α/IFN-γ-Stimulated HaCaT Cells
3.3. Effect of Parnassin on TSLP and IL-31 mRNA Expression in TNF-α/IFN-γ-Stimulated HaCaT Cells
3.4. Effect of Parnassin on the Activation of JAK2, p38 MAPK, and STAT1 in TNF-α/IFN-γ-Stimulated HaCaT Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Davidson, W.F.; Leung, D.Y.M.; Beck, L.A.; Berin, C.M.; Boguniewicz, M.; Busse, W.W.; Chatila, T.A.; Geha, R.S.; Gern, J.E.; Guttman-Yassky, E.; et al. Report from the National Institute of Allergy and Infectious Diseases workshop on “Atopic dermatitis and the atopic march: Mechanisms and interventions”. J. Allergy Clin. Immunol. 2019, 143, 894–913. [Google Scholar] [CrossRef]
- Biagini Myers, J.M.; Sherenian, M.G.; Baatyrbek Kyzy, A.; Alarcon, R.; An, A.; Flege, Z.; Morgan, D.; Gonzalez, T.; Stevens, M.L.; He, H.; et al. Events in Normal Skin Promote Early-Life Atopic Dermatitis-The MPAACH Cohort. J. Allergy Clin. Immunol. Pract. 2020, 8, 2285–2293.e6. [Google Scholar] [CrossRef]
- Salvati, L.; Cosmi, L.; Annunziato, F. From Emollients to Biologicals: Targeting Atopic Dermatitis. Int. J. Mol. Sci. 2021, 22, 10381. [Google Scholar] [CrossRef] [PubMed]
- Katoh, N.; Ohya, Y.; Ikeda, M.; Ebihara, T.; Katayama, I.; Saeki, H.; Shimojo, N.; Tanaka, A.; Nakahara, T.; Nagao, M.; et al. Japanese guidelines for atopic dermatitis 2020. Allergol. Int. 2020, 69, 356–369. [Google Scholar] [CrossRef] [PubMed]
- Hawro, T.; Przybylowicz, K.; Spindler, M.; Hawro, M.; Stec, M.; Altrichter, S.; Weller, K.; Magerl, M.; Reidel, U.; Alarbeed, E.; et al. The characteristics and impact of pruritus in adult dermatology patients: A prospective, cross-sectional study. J. Am. Acad. Dermatol. 2021, 84, 691–700. [Google Scholar] [CrossRef] [PubMed]
- Moniaga, C.S.; Tominaga, M.; Takamori, K. The Pathology of Type 2 Inflammation-Associated Itch in Atopic Dermatitis. Diagnostics 2021, 11, 2090. [Google Scholar] [CrossRef]
- Salimi, M.; Barlow, J.L.; Saunders, S.P.; Xue, L.; Gutowska-Owsiak, D.; Wang, X.; Huang, L.C.; Johnson, D.; Scanlon, S.T.; McKenzie, A.N.; et al. A role for IL-25 and IL-33-driven type-2 innate lymphoid cells in atopic dermatitis. J. Exp. Med. 2013, 210, 2939–2950. [Google Scholar] [CrossRef]
- Cosmi, L.; Maggi, L.; Mazzoni, A.; Liotta, F.; Annunziato, F. Biologicals targeting type 2 immunity: Lessons learned from asthma, chronic urticaria and atopic dermatitis. Eur. J. Immunol. 2019, 49, 1334–1343. [Google Scholar] [CrossRef]
- Hijnen, D.; De Bruin-Weller, M.; Oosting, B.; Lebre, C.; De Jong, E.; Bruijnzeel-Koomen, C.; Knol, E. Serum thymus and activation-regulated chemokine (TARC) and cutaneous T cell- attracting chemokine (CTACK) levels in allergic diseases: TARC and CTACK are disease-specific markers for atopic dermatitis. J. Allergy Clin. Immunol. 2004, 113, 334–340. [Google Scholar] [CrossRef]
- Jahnz-Rozyk, K.; Targowski, T.; Paluchowska, E.; Owczarek, W.; Kucharczyk, A. Serum thymus and activation-regulated chemokine, macrophage-derived chemokine and eotaxin as markers of severity of atopic dermatitis. Allergy 2005, 60, 685–688. [Google Scholar] [CrossRef]
- Chovatiya, R.; Paller, A.S. JAK inhibitors in the treatment of atopic dermatitis. J. Allergy Clin. Immunol. 2021, 148, 927–940. [Google Scholar] [CrossRef] [PubMed]
- Rohner, M.H.; Thormann, K.; Cazzaniga, S.; Yousefi, S.; Simon, H.U.; Schlapbach, C.; Simon, D. Dupilumab reduces inflammation and restores the skin barrier in patients with atopic dermatitis. Allergy 2021, 76, 1268–1270. [Google Scholar] [CrossRef]
- Wollenberg, A.; Barbarot, S.; Bieber, T.; Christen-Zaech, S.; Deleuran, M.; Fink-Wagner, A.; Gieler, U.; Girolomoni, G.; Lau, S.; Muraro, A.; et al. Consensus-based European guidelines for treatment of atopic eczema (atopic dermatitis) in adults and children: Part I. J. Eur. Acad. Dermatol. Venereol. 2018, 32, 657–682. [Google Scholar] [CrossRef]
- Megna, M.; Napolitano, M.; Patruno, C.; Villani, A.; Balato, A.; Monfrecola, G.; Ayala, F.; Balato, N. Systemic Treatment of Adult Atopic Dermatitis: A Review. Dermatol. Ther. 2017, 7, 1–23. [Google Scholar] [CrossRef]
- Newsom, M.; Bashyam, A.M.; Balogh, E.A.; Feldman, S.R.; Strowd, L.C. New and Emerging Systemic Treatments for Atopic Dermatitis. Drugs 2020, 80, 1041–1052. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Kim, M.S.; Jung, S.J.; Kim, D.; Park, H.J.; Cho, D. ERK activating peptide, AES16-2M promotes wound healing through accelerating migration of keratinocytes. Sci. Rep. 2018, 8, 14398. [Google Scholar] [CrossRef]
- Kim, M.S.; Song, J.; Park, S.; Kim, T.S.; Park, H.J.; Cho, D. The Wound Healing Peptide, AES16-2M, Ameliorates Atopic Dermatitis In Vivo. Molecules 2021, 26, 1168. [Google Scholar] [CrossRef] [PubMed]
- Kiatsurayanon, C.; Niyonsaba, F.; Smithrithee, R.; Akiyama, T.; Ushio, H.; Hara, M.; Okumura, K.; Ikeda, S.; Ogawa, H. Host defense (Antimicrobial) peptide, human beta-defensin-3, improves the function of the epithelial tight-junction barrier in human keratinocytes. J. Investig. Dermatol. 2014, 134, 2163–2173. [Google Scholar] [CrossRef]
- Hakuta, A.; Yamaguchi, Y.; Okawa, T.; Yamamoto, S.; Sakai, Y.; Aihara, M. Anti-inflammatory effect of collagen tripeptide in atopic dermatitis. J. Dermatol. Sci. 2017, 88, 357–364. [Google Scholar] [CrossRef]
- Lee, K.W.; Kim, J.G.; Veerappan, K.; Chung, H.; Natarajan, S.; Kim, K.Y.; Park, J. Utilizing Red Spotted Apollo Butterfly Transcriptome to Identify Antimicrobial Peptide Candidates against Porphyromonas gingivalis. Insects 2021, 12, 466. [Google Scholar] [CrossRef]
- Hancock, R.E.; Haney, E.F.; Gill, E.E. The immunology of host defence peptides: Beyond antimicrobial activity. Nat. Rev. Immunol. 2016, 16, 321–334. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Chen, Z.; Tian, P.; Han, Q.; Zhang, J.; Zhang, A.-M.; Song, Y. Wound healing mechanism of antimicrobial peptide cathelicidin-DM. Front. Bioeng. Biotechnol. 2022, 10, 977159. [Google Scholar] [CrossRef]
- Waghu, F.H.; Gopi, L.; Barai, R.S.; Ramteke, P.; Nizami, B.; Idicula-Thomas, S. CAMP: Collection of sequences and structures of antimicrobial peptides. Nucleic Acids Res. 2014, 42, D1154–D1158. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.T.; Lee, C.C.; Yang, J.R.; Lai, J.Z.; Chang, K.Y. A large-scale structural classification of antimicrobial peptides. Biomed. Res. Int. 2015, 2015, 475062. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Li, X.; Wang, Z. APD3: The antimicrobial peptide database as a tool for research and education. Nucleic Acids Res. 2016, 44, D1087–D1093. [Google Scholar] [CrossRef] [PubMed]
- Minkiewicz, P.; Iwaniak, A.; Darewicz, M. BIOPEP-UWM Database of Bioactive Peptides: Current Opportunities. Int. J. Mol. Sci. 2019, 20, 5978. [Google Scholar] [CrossRef]
- Lee, J.H.; Chen, S.Y.; Yu, C.H.; Chu, S.W.; Wang, L.F.; Sun, C.K.; Chiang, B.L. Noninvasive in vitro and in vivo assessment of epidermal hyperkeratosis and dermal fibrosis in atopic dermatitis. J. Biomed. Opt. 2009, 14, 014008. [Google Scholar] [CrossRef]
- Jung, M.; Lee, T.H.; Oh, H.J.; Kim, H.; Son, Y.; Lee, E.H.; Kim, J. Inhibitory effect of 5,6-dihydroergosteol-glucoside on atopic dermatitis-like skin lesions via suppression of NF-kappaB and STAT activation. J. Dermatol. Sci. 2015, 79, 252–261. [Google Scholar] [CrossRef]
- Klonowska, J.; Glen, J.; Nowicki, R.J.; Trzeciak, M. New Cytokines in the Pathogenesis of Atopic Dermatitis-New Therapeutic Targets. Int. J. Mol. Sci. 2018, 19, 3086. [Google Scholar] [CrossRef]
- Brandt, E.B.; Sivaprasad, U. Th2 Cytokines and Atopic Dermatitis. J. Clin. Cell Immunol. 2011, 2, 110. [Google Scholar] [CrossRef]
- Ju, S.M.; Song, H.Y.; Lee, S.J.; Seo, W.Y.; Sin, D.H.; Goh, A.R.; Kang, Y.H.; Kang, I.J.; Won, M.H.; Yi, J.S.; et al. Suppression of thymus- and activation-regulated chemokine (TARC/CCL17) production by 1,2,3,4,6-penta-O-galloyl-beta-D-glucose via blockade of NF-kappaB and STAT1 activation in the HaCaT cells. Biochem. Biophys. Res. Commun. 2009, 387, 115–120. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, T.; Hieshima, K.; Nagakubo, D.; Sato, E.; Nakayama, M.; Kawa, K.; Yoshie, O. Selective induction of Th2-attracting chemokines CCL17 and CCL22 in human B cells by latent membrane protein 1 of Epstein-Barr virus. J. Virol. 2004, 78, 1665–1674. [Google Scholar] [CrossRef] [PubMed]
- Park, J.W.; Lee, H.S.; Lim, Y.; Paik, J.H.; Kwon, O.K.; Kim, J.H.; Paryanto, I.; Yunianto, P.; Choi, S.; Oh, S.R.; et al. Rhododendron album Blume extract inhibits TNF-alpha/IFN-gamma-induced chemokine production via blockade of NF-kappaB and JAK/STAT activation in human epidermal keratinocytes. Int. J. Mol. Med. 2018, 41, 3642–3652. [Google Scholar] [CrossRef] [PubMed]
- Kwon, D.J.; Bae, Y.S.; Ju, S.M.; Goh, A.R.; Youn, G.S.; Choi, S.Y.; Park, J. Casuarinin suppresses TARC/CCL17 and MDC/CCL22 production via blockade of NF-kappaB and STAT1 activation in HaCaT cells. Biochem. Biophys. Res. Commun. 2012, 417, 1254–1259. [Google Scholar] [CrossRef]
- Nowicki, R.; Trzeciak, M.; Wilkowska, A.; Sokolowska-Wojdylo, M.; Ługowska-Umer, H.; Barańska-Rybak, W.; Kaczmarski, M.; Kowalewski, C.; Kruszewski, J.; Maj, J.; et al. Atopic dermatitis: Current treatment guidelines. Statement of the experts of the Dermatological Section, Polish Society of Allergology, and the Allergology Section, Polish Society of Dermatology. Postepy Dermatol. Alergol. 2015, 32, 239–249. [Google Scholar] [CrossRef]
- Cao, S.J.; Xu, S.; Wang, H.M.; Ling, Y.; Dong, J.; Xia, R.D.; Sun, X.H. Nanoparticles: Oral Delivery for Protein and Peptide Drugs. AAPS PharmSciTech 2019, 20, 190. [Google Scholar] [CrossRef]
- Porter, R.M.; Reichelt, J.; Lunny, D.P.; Magin, T.M.; Lane, E.B. The relationship between hyperproliferation and epidermal thickening in a mouse model for BCIE. J. Investig. Dermatol. 1998, 110, 951–957. [Google Scholar] [CrossRef]
- Kim, M.; Kim, H.; Ryu, J.; Jo, S.; Lee, G.; Ryu, M.H.; Kim, H.; Cho, S.I. Anti-inflammatory effects of Cryptotympana atrata Fabricius slough shed on contact dermatitis induced by dinitrofluorobenzene in mice. Pharmacogn Mag. 2014, 10, S377–S382. [Google Scholar] [CrossRef]
- Lee, H.S.; Paik, J.H.; Kwon, O.K.; Paryanto, I.; Yuniato, P.; Ryu, H.W.; Choi, S.H.; Oh, S.R.; Han, S.B.; Park, J.W.; et al. Anti-Inflammatory Effects of Lagerstroemia ovalifolia Teijsm. & Binn. in TNFalpha/IFNgamma-Stimulated Keratinocytes. Evid. Based Complement Alternat Med. 2021, 2021, 2439231. [Google Scholar] [CrossRef]
- Albanesi, C.; Madonna, S.; Gisondi, P.; Girolomoni, G. The Interplay Between Keratinocytes and Immune Cells in the Pathogenesis of Psoriasis. Front. Immunol. 2018, 9, 1549. [Google Scholar] [CrossRef]
- Lee, H.; Lee, D.H.; Oh, J.H.; Chung, J.H. Skullcapflavone II Suppresses TNF-alpha/IFN-gamma-Induced TARC, MDC, and CTSS Production in HaCaT Cells. Int. J. Mol. Sci. 2021, 22, 6428. [Google Scholar] [CrossRef] [PubMed]
- Fujisawa, T.; Fujisawa, R.; Kato, Y.; Nakayama, T.; Morita, A.; Katsumata, H.; Nishimori, H.; Iguchi, K.; Kamiya, H.; Gray, P.W.; et al. Presence of high contents of thymus and activation-regulated chemokine in platelets and elevated plasma levels of thymus and activation-regulated chemokine and macrophage-derived chemokine in patients with atopic dermatitis. J. Allergy Clin. Immunol. 2002, 110, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Furukawa, H.; Takahashi, M.; Nakamura, K.; Kaneko, F. Effect of an antiallergic drug (Olopatadine hydrochloride) on TARC/CCL17 and MDC/CCL22 production by PBMCs from patients with atopic dermatitis. J. Dermatol. Sci. 2004, 36, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Leung, T.F.; Ma, K.C.; Hon, K.L.; Lam, C.W.; Wan, H.; Li, C.Y.; Chan, I.H. Serum concentration of macrophage-derived chemokine may be a useful inflammatory marker for assessing severity of atopic dermatitis in infants and young children. Pediatr. Allergy Immunol. 2003, 14, 296–301. [Google Scholar] [CrossRef]
- Shimada, Y.; Takehara, K.; Sato, S. Both Th2 and Th1 chemokines (TARC/CCL17, MDC/CCL22, and Mig/CXCL9) are elevated in sera from patients with atopic dermatitis. J. Dermatol. Sci. 2004, 34, 201–208. [Google Scholar] [CrossRef]
- Mollanazar, N.K.; Smith, P.K.; Yosipovitch, G. Mediators of Chronic Pruritus in Atopic Dermatitis: Getting the Itch Out? Clin. Rev. Allergy Immunol. 2016, 51, 263–292. [Google Scholar] [CrossRef]
- Nygaard, U.; Hvid, M.; Johansen, C.; Buchner, M.; Folster-Holst, R.; Deleuran, M.; Vestergaard, C. TSLP, IL-31, IL-33 and sST2 are new biomarkers in endophenotypic profiling of adult and childhood atopic dermatitis. J. Eur. Acad. Dermatol. Venereol. 2016, 30, 1930–1938. [Google Scholar] [CrossRef]
- Komine, M.; Kakinuma, T.; Kagami, S.; Hanakawa, Y.; Hashimoto, K.; Tamaki, K. Mechanism of thymus- and activation-regulated chemokine (TARC)/CCL17 production and its modulation by roxithromycin. J. Investig. Dermatol. 2005, 125, 491–498. [Google Scholar] [CrossRef]
- Jung, M.R.; Lee, T.H.; Bang, M.H.; Kim, H.; Son, Y.; Chung, D.K.; Kim, J. Suppression of thymus- and activation-regulated chemokine (TARC/CCL17) production by 3-O-beta-D-glucopyanosylspinasterol via blocking NF-kappaB and STAT1 signaling pathways in TNF-alpha and IFN-gamma-induced HaCaT keratinocytes. Biochem. Biophys. Res. Commun. 2012, 427, 236–241. [Google Scholar] [CrossRef]
- Catherine, J.; Roufosse, F. What does elevated TARC/CCL17 expression tell us about eosinophilic disorders? Semin Immunopathol. 2021, 43, 439–458. [Google Scholar] [CrossRef]
- Qi, X.F.; Teng, Y.C.; Yoon, Y.S.; Kim, D.H.; Cai, D.Q.; Lee, K.J. Reactive oxygen species are involved in the IFN-gamma-stimulated production of Th2 chemokines in HaCaT keratinocytes. J. Cell Physiol. 2011, 226, 58–65. [Google Scholar] [CrossRef] [PubMed]
Propensity | Tools | Descriptions/Parameters | Cutoff | Parnassin |
---|---|---|---|---|
Physicochemical | Pepstats | Peptide Length | ≥2 to 50 | 4 |
Pepstats | Charge | >0 (+) | 2 | |
Pepstats | Isoelectric Point(pI) | ≥8 to ≤12 | 11.65 | |
AMPA | Stretch | ≥1 | 1 | |
Aggregation (In vitro) | Aggrescan | Na4vSS | ≥−40 Na4vSS ≤60 | −38.6 |
Aggregation (In vivo) | Tango | AGG | ≤500 | 0 |
Tango | Helix | ≥0 Helix ≤25 | 0 | |
Tango | Beta | ≥25 Beta ≤100 | 30.81 |
Genes | Specific Primer Sequences | |
---|---|---|
Forward (5′-3′) | Reverse (5′-3′) | |
CCL17 | ACTGCTCCAGGGATGCCATCGTTTTT | ACAAGGGGATGGATCTCCCTCACTG |
CCL22 | AGGACAGAGCATGGCTCGCCTACAGA | TAATGGCAGGGAGGTAGGGCTCCTGA |
TSLP | GGGGCTAAACCATGACAGAA | GTTTGGCTGAAGGCTTGTTC |
IL-31 | CGACGTCTGTGCTCTTTCTG | AGCATCTTCGAGAGGGACTG |
GAPDH | GACCCTCGAAATCCCATCACAG | GTGCGAACTTCCACGGTGTGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hwang-Bo, J.; Veerappan, K.; Moon, H.; Lee, T.-H.; Lee, K.-W.; Park, J.; Chung, H. Parnassin, a Novel Therapeutic Peptide, Alleviates Skin Lesions in a DNCB-Induced Atopic Dermatitis Mouse Model. Biomedicines 2023, 11, 1389. https://doi.org/10.3390/biomedicines11051389
Hwang-Bo J, Veerappan K, Moon H, Lee T-H, Lee K-W, Park J, Chung H. Parnassin, a Novel Therapeutic Peptide, Alleviates Skin Lesions in a DNCB-Induced Atopic Dermatitis Mouse Model. Biomedicines. 2023; 11(5):1389. https://doi.org/10.3390/biomedicines11051389
Chicago/Turabian StyleHwang-Bo, Jeon, Karpagam Veerappan, Hyunhye Moon, Tae-Hoon Lee, Kang-Woon Lee, Junhyung Park, and Hoyong Chung. 2023. "Parnassin, a Novel Therapeutic Peptide, Alleviates Skin Lesions in a DNCB-Induced Atopic Dermatitis Mouse Model" Biomedicines 11, no. 5: 1389. https://doi.org/10.3390/biomedicines11051389