Mesenchymal Stromal Cell-Derived Extracellular Vesicles for Reversing Hepatic Fibrosis in 3D Liver Spheroids
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. EV Isolation
2.3. Hepatic Stellate Cell Activation
2.4. Generation of Hepatic Spheroids
2.5. Molecular Analysis
2.6. Western Blot
2.7. Immunostaining
2.8. Statistical Analyses
3. Results
3.1. Liver Spheroid Formation Using HepG2 and LX-2
3.2. Liver Spheroid Formation Using UpHep and LX-2
3.3. Characterization of EVs
3.4. EVs Alleviated Fibrosis in Liver Spheroids
3.5. EVs Mitigated the Activated Phenotype of HSCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Roehlen, N.; Crouchet, E.; Baumert, T.F. Liver Fibrosis: Mechanistic Concepts and Therapeutic Perspectives. Cells 2020, 9, 875. [Google Scholar] [CrossRef] [PubMed]
- Kisseleva, T.; Brenner, D. Molecular and Cellular Mechanisms of Liver Fibrosis and Its Regression. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 151–166. [Google Scholar] [CrossRef] [PubMed]
- Higashi, T.; Friedman, S.L.; Hoshida, Y. Hepatic Stellate Cells as Key Target in Liver Fibrosis. Adv. Drug Deliv. Rev. 2017, 121, 27–42. [Google Scholar] [CrossRef] [PubMed]
- Tsuchida, T.; Friedman, S.L. Mechanisms of Hepatic Stellate Cell Activation. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 397–411. [Google Scholar] [CrossRef]
- D’Amico, G.; Morabito, A.; D’Amico, M.; Pasta, L.; Malizia, G.; Rebora, P.; Valsecchi, M.G. New Concepts on the Clinical Course and Stratification of Compensated and Decompensated Cirrhosis. Hepatol. Int. 2018, 12, 34–43. [Google Scholar] [CrossRef]
- Tan, Z.; Sun, H.; Xue, T.; Gan, C.; Liu, H.; Xie, Y.; Yao, Y.; Ye, T. Liver Fibrosis: Therapeutic Targets and Advances in Drug Therapy. Front. Cell Dev. Biol. 2021, 9, 730176. [Google Scholar] [CrossRef]
- Asrani, S.K.; Devarbhavi, H.; Eaton, J.; Kamath, P.S. Burden of Liver Diseases in the World. J. Hepatol. 2019, 70, 151–171. [Google Scholar] [CrossRef]
- Fattovich, G.; Stroffolini, T.; Zagni, I.; Donato, F. Hepatocellular Carcinoma in Cirrhosis: Incidence and Risk Factors. Gastroenterology 2004, 127, S35–S50. [Google Scholar] [CrossRef]
- Baglieri, J.; Brenner, D.A.; Kisseleva, T. The Role of Fibrosis and Liver-Associated Fibroblasts in the Pathogenesis of Hepatocellular Carcinoma. Int. J. Mol. Sci. 2019, 20, 1723. [Google Scholar] [CrossRef]
- Friedman, S.L.; Pinzani, M. Hepatic Fibrosis 2022: Unmet Needs and a Blueprint for the Future. Hepatology 2022, 75, 473–488. [Google Scholar] [CrossRef]
- Chen, L.; Guo, W.; Mao, C.; Shen, J.; Wan, M. Liver Fibrosis: Pathological Features, Clinical Treatment and Application of Therapeutic Nanoagents. J. Mater. Chem. B 2024, 12, 1446–1466. [Google Scholar] [CrossRef] [PubMed]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Jiang, J.; Gu, Z.; Zhang, J.; Chen, Y.; Liu, X. Mesenchymal Stromal Cell Therapies: Immunomodulatory Properties and Clinical Progress. Stem Cell Res. Ther. 2020, 11, 345. [Google Scholar] [CrossRef] [PubMed]
- Qin, L.; Liu, N.; Bao, C.; Yang, D.; Ma, G.; Yi, W.; Xiao, G.; Cao, H. Mesenchymal Stem Cells in Fibrotic Diseases—The Two Sides of the Same Coin. Acta Pharmacol. Sin. 2023, 44, 268–287. [Google Scholar] [CrossRef] [PubMed]
- Musiał-Wysocka, A.; Kot, M.; Majka, M. The Pros and Cons of Mesenchymal Stem Cell-Based Therapies. Cell Transplant. 2019, 28, 801–812. [Google Scholar] [CrossRef]
- Kumar, M.A.; Baba, S.K.; Sadida, H.Q.; Marzooqi, S.A.; Jerobin, J.; Altemani, F.H.; Algehainy, N.; Alanazi, M.A.; Abou-Samra, A.-B.; Kumar, R.; et al. Extracellular Vesicles as Tools and Targets in Therapy for Diseases. Signal Transduct. Target. Ther. 2024, 9, 27. [Google Scholar] [CrossRef]
- Zhu, L.; Wang, Q.; Guo, M.; Fang, H.; Li, T.; Zhu, Y.; Jiang, H.; Xiao, P.; Hu, M. Mesenchymal Stem Cell-Derived Exosomes in Various Chronic Liver Diseases: Hype or Hope? J. Inflamm. Res. 2024, 17, 171–189. [Google Scholar] [CrossRef]
- Bruno, S.; Chiabotto, G.; Camussi, G. Extracellular Vesicles: A Therapeutic Option for Liver Fibrosis. Int. J. Mol. Sci. 2020, 21, 4255. [Google Scholar] [CrossRef]
- Bruno, S.; Pasquino, C.; Herrera Sanchez, M.B.; Tapparo, M.; Figliolini, F.; Grange, C.; Chiabotto, G.; Cedrino, M.; Deregibus, M.C.; Tetta, C.; et al. HLSC-Derived Extracellular Vesicles Attenuate Liver Fibrosis and Inflammation in a Murine Model of Non-Alcoholic Steatohepatitis. Mol. Ther. J. Am. Soc. Gene Ther. 2020, 28, 479–489. [Google Scholar] [CrossRef]
- Chiabotto, G.; Ceccotti, E.; Pasquino, C.; Sanchez, M.B.H.; Cedrino, M.; Camussi, G.; Bruno, S. Human Liver Stem Cell-Derived Extracellular Vesicles Modulate Long Non-Coding RNA Expression Profile in an In Vivo Model of Non-Alcoholic Steatohepatitis. Explor. Dig. Dis. 2023, 2, 172–187. [Google Scholar] [CrossRef]
- Chiabotto, G.; Ceccotti, E.; Tapparo, M.; Camussi, G.; Bruno, S. Human Liver Stem Cell-Derived Extracellular Vesicles Target Hepatic Stellate Cells and Attenuate Their Pro-Fibrotic Phenotype. Front. Cell Dev. Biol. 2021, 9, 777462. [Google Scholar] [CrossRef] [PubMed]
- Zheng, W.; Bian, S.; Qiu, S.; Bishop, C.E.; Wan, M.; Xu, N.; Sun, X.; Sequeira, R.C.; Atala, A.; Gu, Z.; et al. Placenta Mesenchymal Stem Cell-Derived Extracellular Vesicles Alleviate Liver Fibrosis by Inactivating Hepatic Stellate Cells through a miR-378c/SKP2 Axis. Inflamm. Regen. 2023, 43, 47. [Google Scholar] [CrossRef] [PubMed]
- Messner, C.J.; Schmidt, S.; Özkul, D.; Gaiser, C.; Terracciano, L.; Krähenbühl, S.; Suter-Dick, L. Identification of miR-199a-5p, miR-214-3p and miR-99b-5p as Fibrosis-Specific Extracellular Biomarkers and Promoters of HSC Activation. Int. J. Mol. Sci. 2021, 22, 9799. [Google Scholar] [CrossRef] [PubMed]
- Kmiotek-Wasylewska, K.; Bobis-Wozowicz, S.; Karnas, E.; Orpel, M.; Woźnicka, O.; Madeja, Z.; Dawn, B.; Zuba-Surma, E.K. Anti-Inflammatory, Anti-Fibrotic and Pro-Cardiomyogenic Effects of Genetically Engineered Extracellular Vesicles Enriched in miR-1 and miR-199a on Human Cardiac Fibroblasts. Stem Cell Rev. Rep. 2023, 19, 2756–2773. [Google Scholar] [CrossRef] [PubMed]
- Chiabotto, G.; Ceccotti, E.; Bruno, S. Narrative Review of In Vitro Experimental Models of Hepatic Fibrogenesis. Dig. Med. Res. 2022, 5, 33–51. [Google Scholar] [CrossRef]
- van Grunsven, L.A. 3D In Vitro Models of Liver Fibrosis. Adv. Drug Deliv. Rev. 2017, 121, 133–146. [Google Scholar] [CrossRef]
- Lee, J.; Mun, S.J.; Shin, Y.; Lee, S.; Son, M.J. Advances in Liver Organoids: Model Systems for Liver Disease. Arch. Pharm. Res. 2022, 45, 390–400. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Hui, A.Y.; Albanis, E.; Arthur, M.J.; O’Byrne, S.M.; Blaner, W.S.; Mukherjee, P.; Friedman, S.L.; Eng, F.J. Human Hepatic Stellate Cell Lines, LX-1 and LX-2: New Tools for Analysis of Hepatic Fibrosis. Gut 2005, 54, 142–151. [Google Scholar] [CrossRef]
- Koliha, N.; Wiencek, Y.; Heider, U.; Jüngst, C.; Kladt, N.; Krauthäuser, S.; Johnston, I.C.D.; Bosio, A.; Schauss, A.; Wild, S. A Novel Multiplex Bead-Based Platform Highlights the Diversity of Extracellular Vesicles. J. Extracell. Vesicles 2016, 5, 29975. [Google Scholar] [CrossRef]
- Wiklander, O.P.B.; Bostancioglu, R.B.; Welsh, J.A.; Zickler, A.M.; Murke, F.; Corso, G.; Felldin, U.; Hagey, D.W.; Evertsson, B.; Liang, X.-M.; et al. Systematic Methodological Evaluation of a Multiplex Bead-Based Flow Cytometry Assay for Detection of Extracellular Vesicle Surface Signatures. Front. Immunol. 2018, 9, 1326. [Google Scholar] [CrossRef]
- Deregibus, M.C.; Figliolini, F.; D’Antico, S.; Manzini, P.M.; Pasquino, C.; De Lena, M.; Tetta, C.; Brizzi, M.F.; Camussi, G. Charge-Based Precipitation of Extracellular Vesicles. Int. J. Mol. Med. 2016, 38, 1359–1366. [Google Scholar] [CrossRef] [PubMed]
- Welsh, J.A.; Goberdhan, D.C.I.; O’Driscoll, L.; Buzas, E.I.; Blenkiron, C.; Bussolati, B.; Cai, H.; Di Vizio, D.; Driedonks, T.A.P.; Erdbrügger, U.; et al. Minimal Information for Studies of Extracellular Vesicles (MISEV2023): From Basic to Advanced Approaches. J. Extracell. Vesicles 2024, 13, e12404. [Google Scholar] [CrossRef]
- Hora, S.; Wuestefeld, T. Liver Injury and Regeneration: Current Understanding, New Approaches, and Future Perspectives. Cells 2023, 12, 2129. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Tian, X.; Hao, J.; Xu, G.; Zhang, W. Mesenchymal Stem Cell-Derived Extracellular Vesicles in Tissue Regeneration. Cell Transplant. 2020, 29, 0963689720908500. [Google Scholar] [CrossRef] [PubMed]
- Rong, X.; Liu, J.; Yao, X.; Jiang, T.; Wang, Y.; Xie, F. Human Bone Marrow Mesenchymal Stem Cells-Derived Exosomes Alleviate Liver Fibrosis through the Wnt/β-Catenin Pathway. Stem Cell Res. Ther. 2019, 10, 98. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Yan, Y.; Wang, B.; Qian, H.; Zhang, X.; Shen, L.; Wang, M.; Zhou, Y.; Zhu, W.; Li, W.; et al. Exosomes Derived from Human Umbilical Cord Mesenchymal Stem Cells Alleviate Liver Fibrosis. Stem Cells Dev. 2013, 22, 845–854. [Google Scholar] [CrossRef]
- Jiang, W.; Tan, Y.; Cai, M.; Zhao, T.; Mao, F.; Zhang, X.; Xu, W.; Yan, Z.; Qian, H.; Yan, Y. Human Umbilical Cord MSC-Derived Exosomes Suppress the Development of CCl4-Induced Liver Injury through Antioxidant Effect. Stem Cells Int. 2018, 2018, 6079642. [Google Scholar] [CrossRef]
- Yuan, M.; Yao, L.; Chen, P.; Wang, Z.; Liu, P.; Xiong, Z.; Hu, X.; Li, L.; Jiang, Y. Human Umbilical Cord Mesenchymal Stem Cells Inhibit Liver Fibrosis via the microRNA-148a-5p/SLIT3 Axis. Int. Immunopharmacol. 2023, 125, 111134. [Google Scholar] [CrossRef]
- de Cássia Noronha, N.; Mizukami, A.; Caliári-Oliveira, C.; Cominal, J.G.; Rocha, J.L.M.; Covas, D.T.; Swiech, K.; Malmegrim, K.C.R. Priming Approaches to Improve the Efficacy of Mesenchymal Stromal Cell-Based Therapies. Stem Cell Res. Ther. 2019, 10, 131. [Google Scholar] [CrossRef]
- Bader, A.M.; Klose, K.; Bieback, K.; Korinth, D.; Schneider, M.; Seifert, M.; Choi, Y.-H.; Kurtz, A.; Falk, V.; Stamm, C. Hypoxic Preconditioning Increases Survival and Pro-Angiogenic Capacity of Human Cord Blood Mesenchymal Stromal Cells In Vitro. PLoS ONE 2015, 10, e0138477. [Google Scholar] [CrossRef]
- Gómez-Ferrer, M.; Villanueva-Badenas, E.; Sánchez-Sánchez, R.; Sánchez-López, C.M.; Baquero, M.C.; Sepúlveda, P.; Dorronsoro, A. HIF-1α and Pro-Inflammatory Signaling Improves the Immunomodulatory Activity of MSC-Derived Extracellular Vesicles. Int. J. Mol. Sci. 2021, 22, 3416. [Google Scholar] [CrossRef]
- Harting, M.T.; Srivastava, A.K.; Zhaorigetu, S.; Bair, H.; Prabhakara, K.S.; Toledano Furman, N.E.; Vykoukal, J.V.; Ruppert, K.A.; Cox, C.S.; Olson, S.D. Inflammation-Stimulated Mesenchymal Stromal Cell-Derived Extracellular Vesicles Attenuate Inflammation. Stem Cells 2018, 36, 79–90. [Google Scholar] [CrossRef] [PubMed]
- Cavallero, S.; Dekali, S.; Guitard, N.; Théry, H.; Hélissey, C.; François, S. Effects of Preconditioning with TNFα and IFNγ in Angiogenic Potential of Mesenchymal Stromal Cell-Derived Extracellular Vesicles. Front. Cell Dev. Biol. 2023, 11, 1291016. [Google Scholar] [CrossRef]
- Rovere, M.; Reverberi, D.; Arnaldi, P.; Palamà, M.E.F.; Gentili, C. Spheroid Size Influences Cellular Senescence and Angiogenic Potential of Mesenchymal Stromal Cell-Derived Soluble Factors and Extracellular Vesicles. Front. Bioeng. Biotechnol. 2023, 11, 1297644. [Google Scholar] [CrossRef] [PubMed]
- Staubach, S.; Bauer, F.N.; Tertel, T.; Börger, V.; Stambouli, O.; Salzig, D.; Giebel, B. Scaled Preparation of Extracellular Vesicles from Conditioned Media. Adv. Drug Deliv. Rev. 2021, 177, 113940. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; Rhim, W.-K.; Yoo, Y.-I.; Kim, D.-S.; Ko, K.-W.; Heo, Y.; Park, C.G.; Han, D.K. Defined MSC Exosome with High Yield and Purity to Improve Regenerative Activity. J. Tissue Eng. 2021, 12, 20417314211008626. [Google Scholar] [CrossRef]
- Kim, J.Y.; Rhim, W.-K.; Cha, S.-G.; Woo, J.; Lee, J.Y.; Park, C.G.; Han, D.K. Bolstering the Secretion and Bioactivities of Umbilical Cord MSC-Derived Extracellular Vesicles with 3D Culture and Priming in Chemically Defined Media. Nano Converg. 2022, 9, 57. [Google Scholar] [CrossRef]
- Hanai, H.; Hart, D.A.; Jacob, G.; Shimomura, K.; Ando, W.; Yoshioka, Y.; Ochiya, T.; Nakagawa, S.; Nakamura, M.; Okada, S.; et al. Small Extracellular Vesicles Derived from Human Adipose-Derived Mesenchymal Stromal Cells Cultured in a New Chemically-Defined Contaminate-Free Media Exhibit Enhanced Biological and Therapeutic Effects on Human Chondrocytes In Vitro and in a Mouse Osteoarthritis Model. J. Extracell. Vesicles 2023, 12, e12337. [Google Scholar] [CrossRef]
- Tan, C.Y.; Lai, R.C.; Wong, W.; Dan, Y.Y.; Lim, S.-K.; Ho, H.K. Mesenchymal Stem Cell-Derived Exosomes Promote Hepatic Regeneration in Drug-Induced Liver Injury Models. Stem Cell Res. Ther. 2014, 5, 76. [Google Scholar] [CrossRef]
- Ohara, M.; Ohnishi, S.; Hosono, H.; Yamamoto, K.; Yuyama, K.; Nakamura, H.; Fu, Q.; Maehara, O.; Suda, G.; Sakamoto, N. Extracellular Vesicles from Amnion-Derived Mesenchymal Stem Cells Ameliorate Hepatic Inflammation and Fibrosis in Rats. Stem Cells Int. 2018, 2018, 3212643. [Google Scholar] [CrossRef]
- Kaur, I.; Vasudevan, A.; Rawal, P.; Tripathi, D.M.; Ramakrishna, S.; Kaur, S.; Sarin, S.K. Primary Hepatocyte Isolation and Cultures: Technical Aspects, Challenges and Advancements. Bioengineering 2023, 10, 131. [Google Scholar] [CrossRef]
- Gómez-Lechón, M.J.; Tolosa, L.; Conde, I.; Donato, M.T. Competency of Different Cell Models to Predict Human Hepatotoxic Drugs. Expert Opin. Drug Metab. Toxicol. 2014, 10, 1553–1568. [Google Scholar] [CrossRef] [PubMed]
- Donato, M.T.; Jover, R.; Gómez-Lechón, M.J. Hepatic Cell Lines for Drug Hepatotoxicity Testing: Limitations and Strategies to Upgrade Their Metabolic Competence by Gene Engineering. Curr. Drug Metab. 2013, 14, 946–968. [Google Scholar] [CrossRef] [PubMed]
- Burkard, A.; Dähn, C.; Heinz, S.; Zutavern, A.; Sonntag-Buck, V.; Maltman, D.; Przyborski, S.; Hewitt, N.J.; Braspenning, J. Generation of Proliferating Human Hepatocytes Using Upcyte® Technology: Characterisation and Applications in Induction and Cytotoxicity Assays. Xenobiotica Fate Foreign Compd. Biol. Syst. 2012, 42, 939–956. [Google Scholar] [CrossRef] [PubMed]
- Psaraki, A.; Ntari, L.; Karakostas, C.; Korrou-Karava, D.; Roubelakis, M.G. Extracellular Vesicles Derived from Mesenchymal Stem/Stromal Cells: The Regenerative Impact in Liver Diseases. Hepatology 2022, 75, 1590. [Google Scholar] [CrossRef]
Gene | Forward Primer Sequence | Reverse Primer Sequence |
---|---|---|
ACTA2 | TGGCTATTCCTTCGTTACTACTGCT | CTCATTTTCAAAGTCCAGAGCTACAT |
ALB | TTATGCCCCGGAACTCCTTT | ACAGGCAGGCAGCTTTATCAG |
COL1A1 | CAAGAGGAAGGCCAAGTCGAG | TTGTCGCAGACGCAGATCC |
CYP1A1 | GGGCGTTCTGTCTTTGTAA | TGGGTTGACCCATAGCTTCT |
CYP3A4 | AATCTGTGCCTGAGAACACCAGA | AGTCCATTGGATGAAGCCCA |
TBP | TGTGCACAGGAGCCAAGAGT | ATTTTCTTGCTGCCAGTCTGG |
TGFB1 | GACTACTACGCCAAGGAGGT | GGAGCTCTGATGTGTTGAAG |
Antibody | Code | Source |
---|---|---|
Primary anti-Alix | CST#2171 | mouse |
Primary anti-CD9 | CST#13174 | rabbit |
Primary anti-CD63 | CST#52090 | rabbit |
Primary anti-CD81 | CST#56039 | rabbit |
Primary anti-GM130 | CST#12480 | rabbit |
Primary anti-TSG101 | CST#72312 | rabbit |
Secondary anti-mouse | Invitrogen #31430 | goat |
Secondary anti-rabbit | Invitrogen #31462 | goat |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chiabotto, G.; Semnani, A.; Ceccotti, E.; Guenza, M.; Camussi, G.; Bruno, S. Mesenchymal Stromal Cell-Derived Extracellular Vesicles for Reversing Hepatic Fibrosis in 3D Liver Spheroids. Biomedicines 2024, 12, 1849. https://doi.org/10.3390/biomedicines12081849
Chiabotto G, Semnani A, Ceccotti E, Guenza M, Camussi G, Bruno S. Mesenchymal Stromal Cell-Derived Extracellular Vesicles for Reversing Hepatic Fibrosis in 3D Liver Spheroids. Biomedicines. 2024; 12(8):1849. https://doi.org/10.3390/biomedicines12081849
Chicago/Turabian StyleChiabotto, Giulia, Armina Semnani, Elena Ceccotti, Marco Guenza, Giovanni Camussi, and Stefania Bruno. 2024. "Mesenchymal Stromal Cell-Derived Extracellular Vesicles for Reversing Hepatic Fibrosis in 3D Liver Spheroids" Biomedicines 12, no. 8: 1849. https://doi.org/10.3390/biomedicines12081849