A Mechanism by which Ergosterol Inhibits the Promotion of Bladder Carcinogenesis in Rats
Abstract
:1. Introduction
2. Experimental Section
2.1. Materials
2.2. Animals
2.3. Short-Term Carcinogenicity Study
2.4. Measurement of Plasma Testosterone Concentration
2.5. Con A Agglutination Assay
2.6. Real-Time PCR
2.7. Androgen Receptor (AR) Binding Assay
2.8. Statistical Analysis
3. Results
3.1. Inhibitory Effect of Ergosterol on Bladder Carcinogenesis
3.2. The mRNA Expression Level of Cyclin D1 in Bladder Epithelial Cells
3.3. The mRNA Expression Levels of Cyclooxygenase-1 (COX-1) and Cyclooxygenase-2 (COX-2) in Bladder Epithelial Cells
3.4. Effect of Ergosterol on the Plasma Testosterone Concentration
3.5. The mRNA Expression Levels of 5α-Reductase and AR in Bladder Epithelial Cells
3.6. Effect of Ergosterol on the Binding Properties of AR and DHT
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Torre, L.A.; Bray, F.; Siegel, R.L.; Ferlay, J.; Lortet-Tieulent, J.; Jemal, A. Global cancer statistics, 2012. CA Cancer J. Clin. 2015, 65, 87–108. [Google Scholar] [CrossRef] [Green Version]
- DeGeorge, K.C.; Holt, H.R.; Hodges, S.C. Bladder cancer: Diagnosis and treatment. Am. Fam. Physician 2017, 96, 507–514. [Google Scholar]
- Schlack, K.; Boegemann, M.; Steinestel, J.; Schrader, A.J.; Krabbe, L.M. The safety and efficacy of gemcitabine for the treatment of bladder cancer. Expert Rev. Anticancer Ther. 2016, 16, 255–271. [Google Scholar] [CrossRef]
- Unda-Urzaiz, M.; Fernandez-Gomez, J.M.; Cozar-Olmo, J.M.; Juarez, A.; Palou, J.; Martinez-Pineiro, L. Update on the role of endovesical chemotherapy in nonmuscle-invasive bladder cancer. Actas Urol. Esp. 2018, 42, 73–76. [Google Scholar] [CrossRef] [PubMed]
- Guallar-Garrido, S.; Julian, E. Bacillus calmette-guerin (bcg) therapy for bladder cancer: An update. Immunotargets Ther. 2020, 9, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Morales, A.; Eidinger, D.; Bruce, A.W. Intracavitary bacillus calmette-guerin in the treatment of superficial bladder tumors. J. Urol. 1976, 116, 180–183. [Google Scholar] [CrossRef]
- Leal, J.; Luengo-Fernandez, R.; Sullivan, R.; Witjes, J.A. Economic burden of bladder cancer across the european union. Eur. Urol. 2016, 69, 438–447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugiyama, K.; Azuhata, Y.; Matsuura, D.; Kameda, Y.; Yokota, M. Antitumor-promoting effect of kampo formulations on rat urinary bladder carcinogenesis in a short-term test with concanavalin a. J. Trad Med. 1994, 11, 148–155. [Google Scholar]
- Sugiyama, K.; Azuhata, Y.; Matsuura, D. Antitumor promoting effect of components of chorei-to on rat urinary bladder carcinogenesis in a short-term test with concanavalin a. J. Trad Med. 1994, 11, 214–219. [Google Scholar]
- Yazawa, Y.; Yokota, M.; Sugiyama, K. Antitumor promoting effect of an active component of polyporus, ergosterol and related compounds on rat urinary bladder carcinogenesis in a short-term test with concanavalin a. Biol. Pharm. Bull. 2000, 23, 1298–1302. [Google Scholar] [CrossRef] [Green Version]
- Yazawa, Y.; Ikarashi, N.; Hoshino, M.; Kikkawa, H.; Sakuma, F.; Sugiyama, K. Inhibitory effect of ergosterol on bladder carcinogenesis is due to androgen signaling inhibition by brassicasterol, a metabolite of ergosterol. J. Nat. Med. 2020. [Google Scholar] [CrossRef] [PubMed]
- Kakizoe, T.; Kawachi, T.; Okada, M. Concanavalin a agglutination of bladder cells of rats treated with bladder carcinogens; a rapid new test to detect bladder carcinogens. Cancer Lett. 1978, 5, 285–290. [Google Scholar] [CrossRef]
- Kakizoe, T.; Hasegawa, F.; Kawachi, T.; Sugimura, T. Isolation of transitional epithelial cells from the rat urinary bladder. Investig. Urol. 1977, 15, 242–244. [Google Scholar]
- Kakizoe, T.; Komatsu, H.; Niijima, T.; Kawachi, T.; Sugimura, T. Increased agglutinability of bladder cells by concanavalin a after administration of carcinogens. Cancer Res. 1980, 40, 2006–2009. [Google Scholar]
- Lee, C.C.; Yamamoto, S.; Morimura, K.; Wanibuchi, H.; Nishisaka, N.; Ikemoto, S.; Nakatani, T.; Wada, S.; Kishimoto, T.; Fukushima, S. Significance of cyclin d1 overexpression in transitional cell carcinomas of the urinary bladder and its correlation with histopathologic features. Cancer 1997, 79, 780–789. [Google Scholar] [CrossRef]
- Bringuier, P.P.; Tamimi, Y.; Schuuring, E.; Schalken, J. Expression of cyclin d1 and ems1 in bladder tumours; relationship with chromosome 11q13 amplification. Oncogene 1996, 12, 1747–1753. [Google Scholar]
- Kantor, A.F.; Hartge, P.; Hoover, R.N.; Narayana, A.S.; Sullivan, J.W.; Fraumeni, J.F., Jr. Urinary tract infection and risk of bladder cancer. Am. J. Epidemiol. 1984, 119, 510–515. [Google Scholar] [CrossRef]
- Shi, Y.; Cui, L.; Dai, G.; Chen, J.; Pan, H.; Song, L.; Cheng, S.; Wang, X. Elevated prostaglandin e2 level via cpla2--cox-2--mpges-1 pathway involved in bladder carcinogenesis induced by terephthalic acid-calculi in wistar rats. Prostaglandins Leukot. Essent. Fat. Acids 2006, 74, 309–315. [Google Scholar] [CrossRef]
- Kitayama, W.; Denda, A.; Okajima, E.; Tsujiuchi, T.; Konishi, Y. Increased expression of cyclooxygenase-2 protein in rat urinary bladder tumors induced by n-butyl-n-(4-hydroxybutyl) nitrosamine. Carcinogenesis 1999, 20, 2305–2310. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Izumi, K.; Miyamoto, H. The role of the androgen receptor in the development and progression of bladder cancer. Jpn. J. Clin. Oncol. 2012, 42, 569–577. [Google Scholar] [CrossRef] [Green Version]
- Chang, C.S.; Kokontis, J.; Liao, S.T. Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 1988, 240, 324–326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, L.; Shi, Y.; Qian, J.; Dai, G.; Wang, Y.; Xia, Y.; Chen, J.; Song, L.; Wang, S.; Wang, X. Deregulation of the p16-cyclin d1/cyclin-dependent kinase 4-retinoblastoma pathway involved in the rat bladder carcinogenesis induced by terephthalic acid-calculi. Urol. Res. 2006, 34, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.C.; Yamamoto, S.; Wanibuchi, H.; Wada, S.; Sugimura, K.; Kishimoto, T.; Fukushima, S. Cyclin d1 overexpression in rat two-stage bladder carcinogenesis and its relationship with oncogenes, tumor suppressor genes, and cell proliferation. Cancer Res. 1997, 57, 4765–4776. [Google Scholar] [PubMed]
- Wang, D.; Buchanan, F.G.; Wang, H.; Dey, S.K.; DuBois, R.N. Prostaglandin e2 enhances intestinal adenoma growth via activation of the ras-mitogen-activated protein kinase cascade. Cancer Res. 2005, 65, 1822–1829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pai, R.; Szabo, I.L.; Soreghan, B.A.; Atay, S.; Kawanaka, H.; Tarnawski, A.S. Pge(2) stimulates vegf expression in endothelial cells via erk2/jnk1 signaling pathways. Biochem. Biophys. Res. Commun. 2001, 286, 923–928. [Google Scholar] [CrossRef] [PubMed]
- Shirahama, T. Cyclooxygenase-2 expression is up-regulated in transitional cell carcinoma and its preneoplastic lesions in the human urinary bladder. Clin. Cancer Res. 2000, 6, 2424–2430. [Google Scholar] [PubMed]
- Mohammed, S.I.; Knapp, D.W.; Bostwick, D.G.; Foster, R.S.; Khan, K.N.; Masferrer, J.L.; Woerner, B.M.; Snyder, P.W.; Koki, A.T. Expression of cyclooxygenase-2 (cox-2) in human invasive transitional cell carcinoma (tcc) of the urinary bladder. Cancer Res. 1999, 59, 5647–5650. [Google Scholar]
- Khan, M.A.; Thompson, C.S.; Mumtaz, F.H.; Jeremy, J.Y.; Morgan, R.J.; Mikhailidis, D.P. Role of prostaglandins in the urinary bladder: An update. Prostaglandins Leukot. Essent. Fat. Acids 1998, 59, 415–422. [Google Scholar] [CrossRef]
- Shishodia, S.; Aggarwal, B.B. Nuclear factor-kappab activation: A question of life or death. J. Biochem. Mol. Biol. 2002, 35, 28–40. [Google Scholar]
- Garg, A.; Aggarwal, B.B. Nuclear transcription factor-kappab as a target for cancer drug development. Leukemia 2002, 16, 1053–1068. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.A.; Tay, D.; de Blanco, E.C. Nf-kappab inhibitory activity of compounds isolated from cantharellus cibarius. Phytother. Res. 2008, 22, 1104–1106. [Google Scholar] [CrossRef] [PubMed]
- Kobori, M.; Yoshida, M.; Ohnishi-Kameyama, M.; Shinmoto, H. Ergosterol peroxide from an edible mushroom suppresses inflammatory responses in raw264.7 macrophages and growth of ht29 colon adenocarcinoma cells. Br. J. Pharmacol. 2007, 150, 209–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imada, S.; Akaza, H.; Ami, Y.; Koiso, K.; Ideyama, Y.; Takenaka, T. Promoting effects and mechanisms of action of androgen in bladder carcinogenesis in male rats. Eur. Urol. 1997, 31, 360–364. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, H.; Yang, Z.; Chen, Y.T.; Ishiguro, H.; Uemura, H.; Kubota, Y.; Nagashima, Y.; Chang, Y.J.; Hu, Y.C.; Tsai, M.Y.; et al. Promotion of bladder cancer development and progression by androgen receptor signals. J. Natl. Cancer Inst. 2007, 99, 558–568. [Google Scholar] [CrossRef] [PubMed]
- Thigpen, A.E.; Silver, R.I.; Guileyardo, J.M.; Casey, M.L.; McConnell, J.D.; Russell, D.W. Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression. J. Clin. Investig. 1993, 92, 903–910. [Google Scholar] [CrossRef] [PubMed]
- Normington, K.; Russell, D.W. Tissue distribution and kinetic characteristics of rat steroid 5 alpha-reductase isozymes. Evidence for distinct physiological functions. J. Biol. Chem. 1992, 267, 19548–19554. [Google Scholar]
- Hata, S.; Ise, K.; Azmahani, A.; Konosu-Fukaya, S.; McNamara, K.M.; Fujishima, F.; Shimada, K.; Mitsuzuka, K.; Arai, Y.; Sasano, H.; et al. Expression of ar, 5alphar1 and 5alphar2 in bladder urothelial carcinoma and relationship to clinicopathological factors. Life Sci. 2017, 190, 15–20. [Google Scholar] [CrossRef]
- Shin, K.Y.; Kong, G.; Kim, W.S.; Lee, T.Y.; Woo, Y.N.; Lee, J.D. Overexpression of cyclin d1 correlates with early recurrence in superficial bladder cancers. Br. J. Cancer 1997, 75, 1788–1792. [Google Scholar] [CrossRef] [Green Version]
- Gakis, G. The role of inflammation in bladder cancer. Adv. Exp. Med. Biol. 2014, 816, 183–196. [Google Scholar]
- Izumi, K.; Ito, Y.; Miyamoto, H.; Miyoshi, Y.; Ota, J.; Moriyama, M.; Murai, T.; Hayashi, H.; Inayama, Y.; Ohashi, K.; et al. Expression of androgen receptor in non-muscle-invasive bladder cancer predicts the preventive effect of androgen deprivation therapy on tumor recurrence. Oncotarget 2016, 7, 14153–14160. [Google Scholar] [CrossRef] [Green Version]
- Izumi, K.; Taguri, M.; Miyamoto, H.; Hara, Y.; Kishida, T.; Chiba, K.; Murai, T.; Hirai, K.; Suzuki, K.; Fujinami, K.; et al. Androgen deprivation therapy prevents bladder cancer recurrence. Oncotarget 2014, 5, 12665–12674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward | Reverse |
---|---|---|
Cyclin D1 | CCAGCCGCAATGCTGTAG | TTGGGACGCCTCAGCTAAG |
COX-1 | AAGGAGATGGCCGCTGAGTT | AGGAGCCCCCATCTCTATCA |
COX-2 | GCTGATGACTGCCCAACTC | GATCCGGGATGAACTCTCTC |
5α-R1 | GCTGTACGAGTACATTCGTC | CCCTGATCAGAACCGGGAA |
5α-R2 | GGGAGCTCTAACCCAATTTC | CCTCTTCAGATCATACCGTG |
AR | CCCTCCCATGGCACATTTTG | TTGGTTGGCACACAGCACAG |
18S rRNA | GTCTGTGATGCCCTTAGATG | AGCTTATGACCCGCACTTAC |
Group | Number of Con A-Dependent Aggregates | Inhibition Rate (%) |
---|---|---|
Control | 1 ± 1 | - |
Carcinogenesis | 11 ± 3 * | - |
Ergosterol | 2 ± 1 # | 90 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ikarashi, N.; Hoshino, M.; Ono, T.; Toda, T.; Yazawa, Y.; Sugiyama, K. A Mechanism by which Ergosterol Inhibits the Promotion of Bladder Carcinogenesis in Rats. Biomedicines 2020, 8, 180. https://doi.org/10.3390/biomedicines8070180
Ikarashi N, Hoshino M, Ono T, Toda T, Yazawa Y, Sugiyama K. A Mechanism by which Ergosterol Inhibits the Promotion of Bladder Carcinogenesis in Rats. Biomedicines. 2020; 8(7):180. https://doi.org/10.3390/biomedicines8070180
Chicago/Turabian StyleIkarashi, Nobutomo, Motohiro Hoshino, Tetsuya Ono, Takahiro Toda, Yasuharu Yazawa, and Kiyoshi Sugiyama. 2020. "A Mechanism by which Ergosterol Inhibits the Promotion of Bladder Carcinogenesis in Rats" Biomedicines 8, no. 7: 180. https://doi.org/10.3390/biomedicines8070180