Oral Administration of Probiotic Bifidobacterium breve Improves Facilitation of Hippocampal Memory Extinction via Restoration of Aberrant Higher Induction of Neuropsin in an MPTP-Induced Mouse Model of Parkinson’s Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and MPTP Treatment
2.2. Contextual Fear Conditioning Test
2.3. cAMP Assay
2.4. RNA Extraction and Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Assay
2.5. Golgi–Cox Staining
2.6. Western Blot Analysis
2.7. Administration of B. breve A1
2.8. Data Analysis
3. Results
3.1. Administration of B. breve A1 to PD Mice Improved Facilitation of Contextual Fear Extinction
3.2. Effect of B. breve A1 on the Hippocampal mRNA Expression Levels of Neuropsin, Synaptophysin (SYP), Postsynaptic Density Protein-95 (PSD95), Brain-Derived Neurotrophic Factor (BDNF), and Ionized Calcium-Binding Adapter Molecule 1 (Iba1)
3.3. B. breve A1 Restored Decreased Dendritic Spine Density in PD Mice
3.4. B. breve A1 Does Not Affect cAMP Levels in the Hippocampus
3.5. Effect of B. breve A1 on Neuropsin Protein Expression in the Hippocampus
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rodriguez-Oroz, M.C.; Jahanshahi, M.; Krack, P.; Litvan, I.; Macias, R.; Bezard, E.; Obeso, J.A. Initial clinical manifestations of Parkinson’s disease: Features and pathophysiological mechanisms. Lancet Neurol. 2009, 8, 1128–1139. [Google Scholar] [CrossRef] [Green Version]
- Chaudhuri, K.R.; Healy, D.G.; Schapira, A.H. Non-motor symptoms of Parkinson’s disease: Diagnosis and management. Lancet Neurol. 2006, 5, 235–245. [Google Scholar] [CrossRef]
- Hou, J.G.; Lai, E.C. Non-motor symptoms of Parkinson’s disease. Int. J. Gerontol. 2007, 1, 53–64. [Google Scholar] [CrossRef] [Green Version]
- Emre, M. Dementia associated with Parkinson’s disease. Lancet Neurol. 2003, 2, 229–237. [Google Scholar] [CrossRef]
- Gareau, M.G.; Sherman, P.M.; Walker, W.A. Probiotics and the gut microbiota in intestinal health and disease. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 503–514. [Google Scholar] [CrossRef] [Green Version]
- Ohashi, Y.; Ushida, K. Health-beneficial effects of probiotics: Its mode of action. Anim. Sci. J. 2009, 80, 361–371. [Google Scholar] [CrossRef]
- Savilahti, E. Probiotics in the treatment and prevention of allergies in children. Biosci. Microflora 2011, 30, 119–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kafshdooz, T.; Akbarzadeh, A.; Seghinsara, A.M.; Pourhassan, M.; Nasrabadi, H.T.; Milani, M. Role of probiotics in managing of Helicobacter pylori infection: A review. Drug Res. 2016, 67, 88–93. [Google Scholar] [CrossRef]
- Kondo, S.; Xiao, J.Z.; Satoh, T.; Odamaki, T.; Takahashi, S.; Sugahara, H.; Yaeshima, T.; Iwatsuki, K.; Kamei, A.; Abe, K. Antiobesity effects of Bifidobacterium breve strain B-3 supplementation in a mouse model with high-fat diet-induced obesity. Biosci. Biotechnol. Biochem. 2010, 74, 1656–1661. [Google Scholar] [CrossRef] [Green Version]
- Sivan, A.; Corrales, L.; Hubert, N.; Williams, J.B.; Aquino-Michaels, K.; Earley, Z.M.; Benyamin, F.W.; Lei, Y.M.; Jabri, B.; Alegre, M.L.; et al. Commensal Bifidobacterium promotes antitumor immunity and anti-PD-L1 efficacy. Science 2015, 350, 1084–1089. [Google Scholar] [CrossRef] [Green Version]
- Sampson, T.R.; Mazmanian, S.K. Review control of brain development, function, and behavior by the microbiome. Cell Host Microbe 2015, 17, 565–576. [Google Scholar] [CrossRef] [Green Version]
- Peterson, C.T. Dysfunction of the microbiota-gut-brain axis in neurodegenerative disease: The promise of therapeutic modulation with prebiotics, medicinal herbs, probiotics, and synbiotics. J. Evid. Based Integr. Med. 2020, 25, 1–19. [Google Scholar] [CrossRef]
- Castelli, V.; d’Angelo, M.; Quintiliani, M.; Benedetti, E.; Cifone, M.G.; Cimini, A. The emerging role of probiotics in neurodegenerative diseases: New hope of Parkinson’s disease? Neural Regen. Res. 2021, 16, 628–634. [Google Scholar]
- Kobayashi, Y.; Sugahara, H.; Shimada, K.; Mitsuyama, E.; Kuhara, T.; Yasuoka, A.; Kondo, T.; Abe, K.; Xiao, J.Z. Therapeutic potential of Bifidobacterium breve strain A1 for preventing cognitive impairment in Alzheimer’s disease. Sci. Rep. 2017, 7, 13510. [Google Scholar] [CrossRef]
- Castelli, V.; d’Angelo, M.; Lombardi, F.; Alfonsetti, M.; Antonosante, A.; Catanesi, M.; Benedetti, E.; Palumbo, P.; Cifone, M.G.; Giordano, A.; et al. Effects of the probiotic formulation SLAB51 in in vitro and in vivo Parkinson’s disease models. Aging 2020, 12, 4641–4659. [Google Scholar] [CrossRef]
- Liu, Y.W.; Liu, W.H.; Wu, C.C.; Juan, Y.C.; Wu, Y.C.; Tsai, H.P.; Wang, S.; Tsai, Y.C. Psychotropic effects of Lactobacillus plantarum PS128 in early life-stressed and naïve adult mice. Brain Res. 2016, 1631, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Distrutti, E.; O’Reilly, J.A.; McDonald, C.; Cipriani, S.; Renga, B.; Lynch, M.A.; Fiorucci, S. Modulation of intestinal microbiota by the probiotic VSL#3 resets brain gene expression and ameliorates the age-related deficit in LTP. PLoS ONE 2014, 9, e106503. [Google Scholar]
- Ishii, T.; Kinoshita, K.; Muroi, Y. Serotonin 5-HT4 receptor agonists improve facilitation of contextual fear extinction in an MPTP-induced mouse model of Parkinson’s disease. Int. J. Mol. Sci. 2019, 20, 5340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kinoshita, K.; Tada, Y.; Muroi, Y.; Unno, T.; Ishii, T. Selective loss of dopaminergic neurons in the substantia nigra pars compacta after systemic administration of MPTP facilitates extinction learning. Life Sci. 2015, 137, 28–36. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, K.; Muroi, Y.; Unno, T.; Ishii, T. Rolipram improves facilitation of contextual fear extinction in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced mouse model of Parkinson’s disease. J. Pharmocol. Sci. 2017, 134, 55–58. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Shiosaka, S.; Ishikawa, Y. Neuropsin—A possible modulator of synaptic plasticity. J. Chem. Neuroanat. 2011, 42, 24–29. [Google Scholar] [CrossRef]
- Masliah, E.; Mallory, M.; Alford, M.; DeTeresa, R.; Hansen, L.A.; McKeel, D.W., Jr.; Morris, J.C. Altered expression of synaptic proteins occurs early during progression of Alzheimer’s disease. Neurology 2011, 56, 127–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dorostkar, M.M.; Zou, C.; Blazquez-Llorca, L.; Herms, J. Analyzing dendritic spine pathology in Alzheimer’s disease: Problems and opportunities. Acta Neuropathol. 2015, 130, 1–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- VanGuilder, H.D.; Farley, J.A.; Yan, H.; Van Kirk, C.A.; Mitschelen, M.; Sonntag, W.E.; Freeman, W.M. Hippocampal dysregulation of synaptic plasticity-associated proteins with age-related cognitive decline. Neurobiol. Dis. 2011, 43, 201–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Konal, A.; Thakur, M.K. Neuropsin expression correlates with dendritic marker MAP2c level in different brain regions of aging mice. Mol. Neurobiol. 2015, 51, 1130–1138. [Google Scholar]
- Tamura, H.; Ishikawa, Y.; Hino, N.; Maeda, M.; Yoshida, S.; Kaku, S.; Shiosaka, S. Neuropsin is essential for early processes of memory acquisition and Schaffer collateral long-term potentiation in adult mouse hippocampus in vivo. J. Physiol. 2006, 570, 541–551. [Google Scholar] [CrossRef]
- Bessieres, B.; Travaglia, A.; Mowery, T.M.; Zhang, X.; Alberini, C.M. Early life experiences selectively mature learning and memory abilities. Nat. Commun. 2020, 11, 628. [Google Scholar] [CrossRef]
- Hong, S.; Dissing-Olesen, L.; Stevens, B. New insights on the role of microglia in synaptic pruning in health and disease. Curr. Opin. Neurobiol. 2016, 36, 128–134. [Google Scholar] [CrossRef] [Green Version]
- Bonaz, B.; Bazin, T.; Pellissier, S. The vagus nerve at the interface of the microbiota-gut-brain axis. Front. Neurosci. 2018, 12, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quigley, E.M.M. Microbiota-brain-gut axis and neurodegenerative diseases. Curr. Neurol. Neurosci. Rep. 2017, 17, 94. [Google Scholar] [CrossRef] [PubMed]
- Han, W.; Tellez, L.A.; Perkins, M.H.; Perez, I.O.; Qu, T.; Ferreira, J.; Ferreira, T.L.; Quinn, D.; Liu, Z.W.; Gao, X.B.; et al. A neural circuit for gut-induced reward. Cell 2018, 175, 665–678. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mitsui, S.; Tsuruoka, N.; Yamashiro, K.; Nakazato, H.; Yamaguchi, N. A novel form of human neuropsin, a brain-related serin protease, is generated by alternative splicing and is expressed preferentially in human adult brain. Eur. J. Biochem. 1999, 260, 627–634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tamura, H.; Kawata, M.; Hamaguchi, S.; Ishikawa, Y.; Shiosaka, S. Processing of neuregulin-1 by neuropsin regulates GABAergic neuron to control neural plasticity of the mouse hippocampus. J. Neurosci. 2012, 32, 12657–12672. [Google Scholar] [CrossRef] [Green Version]
- Chang, S.; Bok, P.; Sun, C.P.; Edwards, A.; Huang, G.J. Neuropsin inactivation has protective effects against depression-like behaviours and memory impairment induced by chronic stress. PLoS Genet. 2016, 12, e1006356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shimizu-Okabe, C.; Yousef, G.M.; Diamandis, E.P.; Yoshida, S.; Shiosaka, S.; Fahnestock, M. Expression of the kallikrein gene family in normal and Alzheimer’s disease brain. Neuroreport 2001, 12, 2747–2751. [Google Scholar] [CrossRef] [Green Version]
- Malenka, R.C.; Bear, M.F. LTP and LTD: An embarrassment of riches. Neuron 2004, 44, 5–21. [Google Scholar] [CrossRef] [Green Version]
Transcript | Primers | |
---|---|---|
β-actin | Sense Antisense | ATTGCTGACAGGATGCAGAAG TAGAAGCACTTGCGGTGCACG |
Neuropsin | Sense Antisense | CTCAACTGTGCGGSSGTGAA ACTCCAGGTTTCTCGGGTTT |
PSD95 | Sense Antisense | TGTAATCCTGAAGCCCTGTC GGTTTCCGATGAAGTCCC |
SYP | Sense Antisense | TGGAGTGTGCCAACAAGAC AGCCACGGTGACAAAGAA |
BDNF | Sense Antisense | GCGGCAGATAAAAAGACTGC CTTATGAATCGCCAGCCAAT |
Iba-1 | Sense Antisense | GAAGCGAATGCTGGAGAAAC GACCAGTTGGCCTCTTGTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ishii, T.; Furuoka, H.; Kaya, M.; Kuhara, T. Oral Administration of Probiotic Bifidobacterium breve Improves Facilitation of Hippocampal Memory Extinction via Restoration of Aberrant Higher Induction of Neuropsin in an MPTP-Induced Mouse Model of Parkinson’s Disease. Biomedicines 2021, 9, 167. https://doi.org/10.3390/biomedicines9020167
Ishii T, Furuoka H, Kaya M, Kuhara T. Oral Administration of Probiotic Bifidobacterium breve Improves Facilitation of Hippocampal Memory Extinction via Restoration of Aberrant Higher Induction of Neuropsin in an MPTP-Induced Mouse Model of Parkinson’s Disease. Biomedicines. 2021; 9(2):167. https://doi.org/10.3390/biomedicines9020167
Chicago/Turabian StyleIshii, Toshiaki, Hidefumi Furuoka, Motohiro Kaya, and Tetsuya Kuhara. 2021. "Oral Administration of Probiotic Bifidobacterium breve Improves Facilitation of Hippocampal Memory Extinction via Restoration of Aberrant Higher Induction of Neuropsin in an MPTP-Induced Mouse Model of Parkinson’s Disease" Biomedicines 9, no. 2: 167. https://doi.org/10.3390/biomedicines9020167