Role of RNA in Molecular Diagnosis of MADD Patients
Abstract
:1. Introduction
2. Patients and Methods
2.1. Patients
2.2. Methods
2.2.1. Samples
2.2.2. DNA Sequencing
2.2.3. RNA Sequencing
2.2.4. Confirmatory Sanger Sequencing Analysis
3. Patients Presentation
3.1. Patient 1
3.2. Patient 2
3.3. Patient 3
3.4. Patient 4
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
MADD | Multiple acyl-CoA dehydrogenase deficiency |
NBS | Newborn screening |
ETF | Electron-transfer flavoprotein |
FAD | Flavin adenine dinucleotide |
NGS | Next Generation Sequencing |
References
- Goodman, S.I.; Binard, R.J.; Woontner, M.R.; Frerman, F.E. Glutaric acidemia type II: Gene structure and mutations of the electron transfer flavoprotein: Ubiquinone oxidoreductase (ETF:QO) gene. Mol. Genet. Metab. 2002, 77, 86–90. [Google Scholar] [CrossRef]
- Grunert, S.C. Clinical and genetical heterogeneity of late-onset multiple acyl-coenzyme A dehydrogenase deficiency. Orphanet. J. Rare Dis. 2014, 9, 117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Olsen, R.K.; Olpin, S.E.; Andresen, B.S.; Miedzybrodzka, Z.H.; Pourfarzam, M.; Merinero, B.; Frerman, F.E.; Beresford, M.W.; Dean, J.C.S.; Cornelius, N.; et al. ETFDH mutations as a major cause of riboflavin-responsive multiple acyl-CoA dehydrogenation deficiency. Brain 2007, 130, 2045–2054. [Google Scholar] [CrossRef]
- He, M.; Rutledge, S.L.; Kelly, D.R.; Palmer, C.A.; Murdoch, G.; Majumder, N.; Nicholls, R.D.; Pei, Z.; Watkins, P.A.; Vockley, J. A new genetic disorder in mitochondrial fatty acid beta-oxidation: ACAD9 deficiency. Am. J. Hum. Genet. 2007, 81, 87–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Missaglia, S.; Tavian, D.; Angelini, C. ETF dehydrogenase advances in molecular genetics and impact on treatment. Crit. Rev. Biochem. Mol. Biol. 2021, 7, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Olsen, R.K.; Andresen, B.S.; Christensen, E.; Bross, P.; Skovby, F.; Gregersen, N. Clear relationship between ETF/ETFDH genotype and phenotype in patients with multiple acyl-CoA dehydrogenation deficiency. Hum. Mutat. 2003, 22, 12–23. [Google Scholar] [CrossRef]
- Yamada, K.; Kobayashi, H.; Bo, R.; Takahashi, T.; Purevsuren, J.; Hasegawa, Y.; Taketani, T.; Fukuda, S.; Ohkubo, T.; Yokota, T.; et al. Clinical, biochemical and molecular investigation of adult-onset glutaric acidemia type II: Characteristics in comparison with pediatric cases. Brain Dev. 2016, 38, 293–301. [Google Scholar] [CrossRef]
- Ryder, B.; Tolomeo, M.; Nochi, Z.; Colella, M.; Barile, M.; Olsen, R.K.; Inbar-Feigenberg, M. A novel truncating FLAD1 variant, causing multiple acyl-CoA dehydrogenase deficiency (MADD) in an 8-year-old boy. JIMD Rep. 2019, 45, 37–44. [Google Scholar] [PubMed]
- Ip, W.C.; Hammond, J.W.; Wilcken, B. Neonatal multiple acyl-CoA dehydrogenase deficiency: Essentially absent fatty acid oxidation activity in proband but normal activity in parental cultured skin fibroblasts. J. Inherit. Metab. Dis. 1996, 19, 379–380. [Google Scholar] [CrossRef]
- Angle, B.; Burton, B.K. Risk of sudden death and acute life-threatening events in patients with glutaric acidemia type II. Mol. Genet. Metab. 2008, 93, 36–39. [Google Scholar] [CrossRef] [PubMed]
- Angelini, C.; Tavian, D.; Missaglia, S. Heterogeneous Phenotypes in Lipid Storage Myopathy Due to ETFDH Gene Mutations. JIMD Rep. 2019, 38, 33–40. [Google Scholar]
- McHugh, D.M.; Cameron, C.A.; Abdenur, J.E.; Abdulrahman, M.; Adair, O.; Al Nuaimi, S.A.; Åhlman, H.; Allen, J.J.; Antonozzi, I.; Archer, S.; et al. Clinical validation of cutoff target ranges in newborn screening of metabolic disorders by tandem mass spectrometry: A worldwide collaborative project. Genet. Med. 2011, 13, 230–254. [Google Scholar] [CrossRef]
- Sahai, I.; Garganta, C.L.; Bailey, J.; James, P.; Levy, H.L.; Martin, M.; Neilan, E.; Phornphutkul, C.; Sweetser, D.A.; Zytkovicz, T.H.; et al. Newborn screening for Glutaric Aciduria-II: The New England experience. JIMD Rep. 2014, 13, 1–14. [Google Scholar]
- Ding, M.; Liu, R.; Qiubo, L.; Zhang, Y.; Kong, Q. Neonatal-onset multiple acyl-CoA dehydrogenase deficiency (MADD) in the ETFDH gene: A case report and a literature review. Medicine 2020, 99, e21944. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wu, J.C.; Yu, X.E.; Han, Y.Z.; Yang, R.M. Long-term outcomes of a patient with late-onset multiple acyl-CoA dehydrogenase deficiency caused by novel mutations in ETFDH: A case report. Medicine 2018, 97, e13153. [Google Scholar] [CrossRef] [PubMed]
- Frerman, F.E.; Goodman, S.I. Chapter 103: Defects of electron transfer flavoprotein and electron transfer flavoprotein-ubiquinone oxidoreductase: Glutaric academia type II. In The Online Metabolic and Molecular Bases of Inherited Disease; Valle, D., Beaudet, A.L., Vogelstein, B., Eds.; McGraw-Hill: New York, NY, USA, 2004. [Google Scholar]
- Van Rijt, W.J.; Ferdinandusse, S.; Giannopoulos, P.; Ruiter, J.P.; de Boer, L.; Bosch, A.M.; Huidekoper, H.H.; Rubio-Gozalbo, M.E.; Visser, G.; Williams, M.; et al. Prediction of disease severity in multiple acyl-CoA dehydrogenase deficiency: A retrospective and laboratory cohort study. J. Inherit. Metab. Dis. 2019, 42, 878–889. [Google Scholar] [CrossRef] [PubMed]
- Wen, B.; Dai, T.; Li, W.; Zhao, Y.; Liu, S.; Zhang, C.; Li, H.; Wu, J.; Li, D.; Yan, C. Riboflavin-responsive lipid-storage myopathy caused by ETFDH gene mutations. J. Neurol. Neurosurg. Psychiatry 2010, 81, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J.; Ko, J.M.; Song, J.; Lee, K.A. Clinical Features of Multiple Acyl-CoA Dehydrogenase Deficiency With ETFDH Variants in the First Korean Cases. Ann. Lab. Med. 2018, 38, 616–618. [Google Scholar] [CrossRef] [PubMed]
- Navarrete, R.; Leal, F.; Vega, A.I.; Morais-López, A.; Garcia-Silva, M.T.; Martín-Hernández, E.; Quijada-Fraile, P.; Bergua, A.; Vives, I.; García-Jiménez, I.; et al. Value of genetic analysis for confirming inborn errors of metabolism detected through the Spanish neonatal screening program. Eur. J. Hum. Genet. 2019, 27, 556–562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henriques, B.J.; Lucas, T.G.; Martins, E.; Gaspar, A.; Bandeira, A.; Nogueira, C.; Brandão, O.; Rocha, H.; Vilarinho, L.; Gomes, C.M.; et al. Molecular and Clinical Investigations on Portuguese Patients with Multiple acyl-CoA Dehydrogenase Deficiency. Curr. Mol. Med. 2019, 19, 487–493. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Henikoff, S.; Ng, P.C. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat. Protoc. 2009, 4, 1073–1081. [Google Scholar] [CrossRef]
- Adzhubei, I.; Jordan, D.M.; Sunyaev, S.R. Predicting functional effect of human missense mutations using PolyPhen-2. Curr. Protoc. Hum. Genet. 2013, 7, 7–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwarz, J.M.; Rödelsperger, C.; Schuelke, M.; Seelow, D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 2010, 7, 575–576. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.K.; Cooper, T.A. Pre-mRNA splicing in disease and therapeutics. Trends Mol. Med. 2012, 18, 472–482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baralle, D.; Buratti, E. RNA splicing in human disease and in the clinic. Clin. Sci. 2017, 131, 355–368. [Google Scholar] [CrossRef]
- Muntoni, F.; Wood, M.J. Targeting RNA to treat neuromuscular disease. Nat. Rev. Drug Discov. 2011, 10, 621–637. [Google Scholar] [CrossRef] [PubMed]
- Havens, M.A.; Duelli, D.M.; Hastings, M.L. Targeting RNA splicing for disease therapy. Wiley Interdiscip. Rev. RNA 2013, 4, 247–266. [Google Scholar] [CrossRef]
- Kole, R.; Krainer, A.R.; Altman, S. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides. Nat. Rev. Drug Discov. 2012, 11, 125–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primers cDNA | Sequence | Annealing Temperature |
---|---|---|
F1 | TGTTGTGTCCGACCGAGA | 60 °C |
R1 | TGGCTCCGTATGCAATCC | |
F2 | AACGCCGTGAAGCAAGAG | 60 °C |
R2 | CCACTTTTCATTGCTGTGTGA | |
F3 | TCCTAGCATTCGGCCAAC | 60 °C |
R3 | CCCGTAATTTCTTTATGGGACA | |
Primers Intron1 | Sequence | Annealing Temperature |
i1F1 | TTCTCCCTAATTTGAAATGGTAT | 60 °C |
i1R1 | GGCAGGTACCCTAGCATCAA | |
i1F2 | CTGCCAAGGAGTTGAGAAAA | 60 °C |
i1R2 | GCAATCTCAGCTCACCACAA |
Metabolite Marker | Metabolite Concentrations (μM) | ||||
---|---|---|---|---|---|
Reference Values | Patient 1 | Patient 2 | Patient 3 | Patient 4 | |
Free carnitine (C0) | >9.13 | 35.98 | 43.14 | 36.20 | 21.91 |
Glutarylcarnitine (C5DC) | <0.20 | 0.39 | 0.17 | 0.10 | 1.75 |
Butyrylcarnitine (C4) | <0.97 | 1.10 | 1.16 | 0.90 | 3.11 |
Hexanoylcarnitine (C6) | <0.20 | 1.96 | 0.48 | 0.90 | 1.28 |
Octanoylcarnitine (C8) | <0.30 | 3.96 | 1.13 | 2.51 | 6.40 |
Decanoylcarnitine (C10) | <0.44 | 4.31 | 1.75 | 3.73 | 2.96 |
Dodecanoylcarnitine (C12) | <0.51 | 3.29 | 2.32 | 4.36 | 2.23 |
Dodecenoylcarnitine (C12:1) | <0.46 | 1.14 | 0.64 | 0.88 | 0.62 |
Tetradecanoylcarnitine (C14) | <0.59 | 3.52 | 2.48 | 2.71 | 3.12 |
Tetradecenoylcarnitine (C14:1) | <0.46 | 2.98 | 2.47 | 3.46 | 1.78 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nogueira, C.; Silva, L.; Marcão, A.; Sousa, C.; Fonseca, H.; Rocha, H.; Campos, T.; Teles, E.L.; Rodrigues, E.; Janeiro, P.; et al. Role of RNA in Molecular Diagnosis of MADD Patients. Biomedicines 2021, 9, 507. https://doi.org/10.3390/biomedicines9050507
Nogueira C, Silva L, Marcão A, Sousa C, Fonseca H, Rocha H, Campos T, Teles EL, Rodrigues E, Janeiro P, et al. Role of RNA in Molecular Diagnosis of MADD Patients. Biomedicines. 2021; 9(5):507. https://doi.org/10.3390/biomedicines9050507
Chicago/Turabian StyleNogueira, Célia, Lisbeth Silva, Ana Marcão, Carmen Sousa, Helena Fonseca, Hugo Rocha, Teresa Campos, Elisa Leão Teles, Esmeralda Rodrigues, Patrícia Janeiro, and et al. 2021. "Role of RNA in Molecular Diagnosis of MADD Patients" Biomedicines 9, no. 5: 507. https://doi.org/10.3390/biomedicines9050507