Novel Betulin-1,2,4-Triazole Derivatives Promote In Vitro Dose-Dependent Anticancer Cytotoxicity

Abstract

Betulin is a birch bark-derived lupane-type pentacyclic triterpene with a wide spectrum of biological activities. Given their enhanced antiproliferative potential and enhanced pharmacological profile, betulin derivatives are continuously investigated in scientific studies. The objective of the current study was to in vitro assess the antiproliferative properties of novel synthesized 1,2,4-triazole derivatives of diacetyl betulin. The compounds were investigated using three cancer cell lines: A375 (melanoma), MCF-7 (breast cancer), HT-29 (colorectal cancer), and HaCaT (human keratinocytes). Bet-TZ1 had the lowest recorded IC₅₀ values (ranging from 22.41 to 46.92 μM after 48 h of exposure) than its precursor and other tested compounds in every scenario, with the highest cytotoxicity against the A375 cell line. Bet-TZ3 demonstrated comparable cytotoxicity to the previously mentioned compound, with an IC₅₀ of 34.34 μM against A375. Both compounds caused apoptosis in tested cells, by inducing specific nuclear morphological changes and by increasing the expression of caspase 9, indicating significant cytotoxicity, which was consistent with the literature and viability evaluation. Bet-TZ1 and Bet-TZ3 inhibit cancer cell migration, with the former having a stronger effect than the latter. The HET−CAM test indicated that all compounds have no irritative potential, suggesting that they can be used locally.

1. Introduction

The structural diversity and the high number of phytocompounds found in nature have always exceeded the representatives found in the synthetic libraries developed by chemists. As a consequence, several phytocompounds with therapeutic effects, such as morphine, codeine, and artemisinin, among many others, have been successfully used in therapy [1]. In particular, approximately 50% of all approved anticancer drugs since the 1940s originated from natural compounds; they act through a wide range of mechanisms involving a variety of molecular targets and signaling pathways [2]. Simultaneously, organic synthesis has produced an array of small molecules with cytotoxic properties that are currently used as systemic chemotherapy; unfortunately, this approach comes with severe side effects due to non-selective cytotoxicity, multidrug resistance, and high risk of cancer relapse [3]. Finding new therapeutic alternatives is therefore critical in cancer management in order to improve the therapeutic outcome and the patient’s life quality as well; a promising solution to such challenges is the continuous investigation of phytocompounds which may come with increased efficacy and milder side effects [4,5]. Despite many phytocompounds displaying clear therapeutic potential, their application is currently limited by their innate physico-chemical properties and toxicity [6].

Betulin (Bet; lup-20(29)-ene-3b,28-diol) is a lupane-derived pentacyclic triterpene isolated predominantly from the birch bark [7]. Bet has numerous documented biological activities including anticancer, anti-inflammatory, and anti-HIV [8]; these effects were attributed to the modulation of several signaling pathways such as NF-kB (Nuclear factor kappa-light-chain-enhancer of activated B cells), Nrf-2 (Nuclear factor erythroid 2-related factor 2), and COX-2 (cyclooxygenase-2) [9]. The anticancer effect of Bet, in particular, has been explained through cell viability and angiogenesis inhibition, cell migration suppression, and cell cycle arrest in the G₀/G₁ phase [10]. As the structure of Bet consists of four six-membered rings, an additional five-membered ring, one isopropenyl group at C₁₉, and two hydroxyl groups at C₃ and C₂₈ [11], the compound exhibits high lipophilicity which greatly reduces its bioavailability [12]. A frequently employed strategy in drug development combines the potential of phytocompounds with the advantages of chemical derivatization with the resulting semisynthetic compounds usually displaying enhanced selectivity and biological activity as well as improved pharmacokinetic properties [13]. For betulin, its complex structure allows for various modifications in different positions, such as C₃ [14], C₂₈ [15], C₃₀ [16], and ring A [17] (Figure 1) that may result in semisynthetic derivatives with optimized pharmacological profiles.

Currently, heterocyclic scaffolds are included in the structure of more than 85% of the approved drugs, with the majority being represented by nitrogen-containing heterocycles, such as triazoles [18]. Triazoles are five-membered heterocycles that can be divided given the position of the two nitrogen atoms into two isomers, 1,2,3-triazoles and 1,2,4-triazoles [19]. They have been extensively used in drug design as they increase the stability of molecules, and can act as linkers [20] and bioisosteres of amide bonds [21]. Additionally, both isomers are highly water soluble and, together with their derivatives, display a wide spectrum of biological properties including anticancer, antioxidative, and anti-inflammatory [22].

As an example, this approach was previously used to develop novel Bet-1,2,3-triazole derivatives with improved cytotoxicity against human ductal carcinoma (T47D), human adenocarcinoma (MCF-7), and glioblastoma (SNB-19) cell lines [23]. Considering the intrinsic limitations of betulin as a therapeutic agent, such as low bioavailability, as well as the advantages provided by triazoles in terms of pharmacological effects, the synthesis of Bet-triazoles derivatives should lead to a significant improvement in the pharmacologic potential of the unmodified compound.

The current study expands on the synthesis of diacetylbetulin derivatives containing a 5-substituted-1,2,4-TZ at C₃₀ (Bet-TZ1-4) followed by their cytotoxicity assessment in several cancer cells such as melanoma (A375), breast cancer (MCF-7), and colorectal cancer (HT-29) as well as in human keratinocytes (HaCaT). A preliminary toxicity assessment was conducted through HET−CAM assay regarding their irritant potential.

2. Results

2.1. Chemistry

Figure 2 depicts the synthetic route as well as the reaction conditions required to synthesize betulin-triazole derivatives (Bet-TZ1-4). By using slightly modified methods previously reported [24], high yields (above 50%) of triazole derivatives (TZ1-4) and brominated diacetyl-betulin (Br-Bet) were obtained. The subsequent alkylation of the SH group on the triazole ring (TZ1-4) with Br-Bet in dimethylformamide (DMF)/K₂CO₃ produced moderate yields (32–41%) of betulin-triazole derivatives (Bet-TZ1-4). Despite the purity of the precursors, TLC examination revealed that the reaction produced additional lipophilic side products that were easily separated by column chromatography using CHCl₃:ethyl acetate 1:1 as eluent for Bet-TZ2-4 or CHCl₃:ethyl acetate 2:1 for Bet-TZ1, due to the significant Rf value differences. During TLC (thin layer chromatography) analysis, there was also an additional spot of low intensity above the reference spot for each compound. This spot migrated with the main one, regardless of the eluents used. As a result, after separation by column chromatography, only fractions with a faint trace were retained, resulting in yield values below 50%. Following NMR (nuclear magnetic resonance) tests, it was discovered that the respective spot corresponds to a tautomer. As a result, if it was previously known that this tautomerism occurs, all the discarded fractions containing the tautomer would have been kept, producing compounds with higher yields. All synthesized compounds’ structures were confirmed using ¹H, ¹³C NMR, and FTIR spectroscopy. All spectral results are available in the Supplementary Materials section of the manuscript.

The deacetylation of Bet was successful and its ¹H and ¹³C NMR spectra confirm the structure according to the existing literature [25]. Moreover, the bromination of diacetyl-Bet (Br-Bet) led to a mixture of allylic and vinylic bromine derivatives, as previously reported in the literature [26]. The ¹H NMR spectra of Bet-TZ1-4 show the peaks for the betulin scaffold in the 5.1–0.6 ppm region. The peaks for C(30)H₂, C(29)H₂, and H3 from the betulin backbone resonate at about 3.8 ppm, 4.9–5.0 ppm, and 4.3–4.4 ppm, respectively. Their integral ratio is 2:2:1, suggesting that only the allylic bromine derivative reacted with the triazole derivatives.

When analyzing the aromatic region corresponding to the ¹H NMR spectra for Bet-TZ1-4, where the protons of the triazole derivatives resonate, we observed that the peaks were doubled, but if integrated, the integral values were in appropriate ratios compared to the protons from Bet. We attributed this behavior to the existence of a slow exchange tautomeric equilibrium that can occur in 3,5-disubstituted 1,2,4-triazoles [27,28]. Out of the three tautomeric forms possible, two tautomers with long enough stability to be individually detected by NMR spectroscopy were observed (

Table 1. Percentage of triazole tautomers, as calculated from the ¹H NMR integral values for the H36 peaks (Bet-TZ1) or the NH peaks (Bet-TZ2-4).

Compound	Bet-TZ1	Bet-TZ2	Bet-TZ3	Bet-TZ4
Tautomer percentage	25%	19%	41%	26%
	75%	81%	59%	74%

).

In order to prove beyond any doubt that the doubling of the triazole derivative peaks is due to the existence of a tautomeric equilibrium, to each solution of Bet-TZ1-4 in DMSO-d₆, for which the initial experiments were recorded, we added a drop of trifluoroacetic acid (TFA) and then recorded all the NMR spectra again. Adding TFA speeded up the tautomeric equilibrium leading to a fast exchange system and the NMR spectra show only one set of peaks for the triazole derivatives in appropriate integral ratios compared to the protons from Bet.

The ¹³C NMR spectra of Bet-TZ1-4 show broad peaks for C19 (44–45 ppm), C20 (149–150 ppm), C29 (110–112 ppm), and C30 (35–36 ppm) of the Bet residue. The H, C-HMBC spectra of Bet-TZ2-4 show long range correlation peaks, over three bonds, between the triazole’s C35 and H30 from betulin (Figures S10, S16, S22 and S28), proving that the reactions took place. The complete assignment of the peaks is given in the experimental section and all the 1D and 2D NMR spectra are available in the Supporting Information. In the case of Bet-TZ2, where the two tautomeric forms are almost in a 1:1 ratio, we can observe peaks (broad) for C36 and C35 from each isomer (Figure 3) and doubled peaks for the carbons of the p-chlorophenyl residue for C20 and C29. After adding TFA, we can observe that the peaks are no longer doubled and are noticeably narrower.

2.2. Evaluation of Diacetylbetulin Derivatives Cytotoxic Effect

The viability of HaCaT, A375, MCF-7, and HT-29 cells, after a 48-h treatment period with the novel synthesized compounds (10, 25, 50, 75, and 100 μM), was assessed using the Alamar blue assay. Incubation of HaCaT cells with the tested compounds revealed significant inhibition of cell viability at 48 h after Bet-TZ1 was used in the highest concentrations (100 and 75 μM). This inhibitory effect at 48 h was stronger compared to the effect of 5-FU (positive control) and to the parent compound (Bet) at the corresponding concentrations, as follows: 9.44 ± 6.90% (Bet-TZ1 100 μM) and 14.76 ± 9.84% (Bet-TZ1 75 μM) vs. 21.57 ± 14.62% (5-FU 100 μM), 27.25 ± 14.90% (5-FU 75 μM), (42.00 ± 7.79% Bet 100 μM) (46.26 ± 7.64% Bet 75 μM) (Figure 4A). A 48-h incubation of A375 cells with 100, 75, and 50 μM Bet-TZ1 and Bet-TZ3 promoted a significant reduction of cell viability in a concentration-dependent manner vs. Bet, as follows: 1.22 ± 1.09%, 3.83 ± 2.68%, 19.78 ± 7.36% (Bet-TZ1), 22.78 ± 18.44%, 29.65 ± 8.98%, 35.58 ± 6.92% (Bet-TZ3) vs. 17.04 ± 1.71%, 30.83 ± 9.01%, 45.64 ± 10.63% (Bet) (Figure 4B). Bet-TZ1 also produced a cytotoxic effect on MCF-7 cells at 100, 75, and 50 μM (1.73 ± 5.48%, 16.47 ± 8.93%, 27.85 ± 5.74%) compared to Bet alone (42.78 ± 6.47%, 47.54 ± 7.00%, 48.92 ± 5.05%) (Figure 4C). The other tested compounds did not influence the cell viability of HaCaT, A375, MCF-7, and HT-29 in a statistically significant manner.

Table 2. The calculated IC₅₀ values (μM) of 5-FU, Bet, Bet-TZ1, and Bet-TZ3 on HaCaT, A375, MCF-7, and HT-29 cell lines; the compounds deemed ineffective have IC₅₀ values above 100 μM.

	5-FU	Bet	Bet-TZ1	Bet-TZ3
	48 h	48 h	48 h	48 h
HaCaT	15.25	60.75	42.52	>100
A375	1.06	46.19	22.41	34.34
MCF-7	38.01	37.29	33.52	>100
HT-29	29.80	55.67	46.92	>100

presents the calculated IC₅₀ values (μM) after 48-h treatment with 5-FU, Bet, Bet-TZ1, and Bet-TZ₃ on HaCaT, A375, MCF-7, and HT-29 cell lines.

2.3. Diacetylbetulin Derivatives Effect on Cell Morphology

In HaCaT cells, no significant morphological changes were recorded in terms of confluence and aspect between the control group and the Bet, Bet-TZ2, Bet-TZ3_, and Bet-TZ4-treated cells. However, Bet-TZ1 treatment decreased the number of cells, rendering them rounder and detached, in a similar manner to the 5-FU positive control (Figure 5). In A375 cells, treatment with both Bet-TZ1 and Bet-TZ3, respectively, at their IC₅₀ induced morphological changes (rounder and detached cells) and a decreased number of cells, in agreement with the results of cell viability testing (Figure 5).

Treatment with Bet-TZ1 (IC₅₀) induced similar changes in MCF-7 and HT-29 cells, in terms of number and cell morphology, changes comparable to those caused by 5-FU used as a positive control (Figure 6).

The cells’ cytoskeleton and nuclei undergo characteristic morphological changes during apoptosis. To determine whether the cytotoxic effects recorded in HaCaT, A375, MCF-7, and HT-29 cells after a 48-h treatment with Bet-TZ1 (IC₅₀) and Bet-TZ3 (IC_50—A375 and 100 μM—MCF-7 and HT-29), respectively, occurred as a result of apoptotic cell death induction, cells’ nuclei were stained with Hoechst solution, while the cytoskeleton was labeled with beta-tubulin antibody and Alexa fluor 488. Treatment with both Bet-TZ1 and Bet-TZ3, respectively, induced morphological changes in A375 cells that are consistent with apoptosis. Specific observed hallmarks included small and bright nuclei indicative of nuclear condensation, nuclear fragmentation, and small, round-shaped cells whose membrane start to disorganize, thus leading to the formation of apoptotic bodies (Figure 7). In contrast, the necrotic cell death induced by staurosporine used as a positive control was mainly accompanied by morphological changes of the cell shape that occur due to cell membrane disruption (Figure 7).

Similar morphological changes, consistent with apoptosis, occurred in HaCaT, MCF-7, and HT-29 cell lines, after treatment with Bet-TZ1 (IC₅₀) (Figure 8).

2.4. Real-Time PCR Quantification of Apoptotic Markers

To further establish the proapoptotic effect of Bet-TZ1 and Bet-TZ3, RT-PCR (reverse transcription polymerase chain reaction) was employed to quantify caspase 9 expression in all three Bet-TZ1-treated cell lines, and the A375 cell line treated with Bet-TZ3, at a sub-cytotoxic concentration (10 μM). Betulin increased caspase 9 expression in all treated cells, according to the results (Figure 9). Bet-TZ1 and Bet-TZ3 both promote caspase 9 expression in the A375 cell line, outperforming their parent compound, with Bet-TZ1 being the most active. This scenario also occurs in the MCF-7 and HT-29 cell lines, where Bet-TZ1 increases caspase 9 expression compared to both control and Bet.

2.5. Scratch Assay

The antimigratory potential on HaCaT, A375, HT-29, and MCF-7 was assessed after 48-h treatment with Bet-TZ1 at 10 μΜ (Figure 10, Figure 11, Figure 12 and Figure 13) and on HaCaT and A375 after 48-h treatment with Bet-TZ3 at 10 μΜ (Figure 10 and Figure 11).

Both Bet-TZ1 and Bet-TZ3 exhibited lower scratch closure rates for HaCaT and A375 cells (57.03% and 78.54%—HaCaT; 28.74% and 61.83%—A375) vs. control (100%), while Bet-TZ1 expressed lower scratch closure rates compared to Bet-TZ3 on both HaCaT and A375 cells (Figure 12). Bet-TZ1 decreased the scratch closure area also on MCF-7 and HT-29 cells, as follows: 85.13% and 64.91% vs. control (100%) (Figure 12).

2.6. HET−CAM Test

The HET−CAM test was used to assess the irritative potential of Bet and Bet-TZ1-4. By monitoring the effects induced 24 h after the application of 300 µL of each sample one can notice that Bet and Bet-TZ2-4 did not produce any interference with the circulation process; by contrast, Bet-TZ1 triggered some localized spotted hemorrhages, without influencing the embryo’s viability (Figure 14).

The irritation potential of each compound was investigated by using the Luepke scale [29] which assigns scores ranging from 0 to 21 based on the degree of severity of the reaction of the chorioallantoic membrane. Non-irritant compounds are classified within the range of 0 to 0.9; slight irritation is indicated by scores between 1 and 4.9; moderate irritation is depicted by scores ranging from 5 to 8.9 and strongly irritant compounds are assigned scores between 9 and 21. According to the findings in

Table 3. The irritation factor for Bet and Bet-TZ1-4.

Samples	IF	Effect
H2O	0	No irritation
SDS	16.29 ± 0.23	Severe irritation
Bet	0	No irritation
Bet-TZ1	0	No irritation
Bet-TZ2	0	No irritation
Bet-TZ3	0	No irritation
Bet-TZ4	0	No irritation

, the compounds under investigation did not exhibit any signs of irritation, indicating that they are appropriate for both mucosal and cutaneous applications.

3. Discussion

Bet is the main triterpene isolated from the outer bark of Betula species, which possesses tremendous therapeutic potential [30]. Chemical modulation of key positions in betulin’s molecule allowed the synthesis of various derivatives with improved pharmacological profile. The 1,2,4-triazole and its derivatives are common heterocycles found in the structure of various drugs due to their innate physicochemical properties such as dipole character, rigidity, and the capacity to form hydrogen bonds, which provide them with a suitable pharmacological profile [31,32]. The use of 1,2,4-triazoles as linkers [33] or pharmacophores [34,35,36] in the structure of various triterpenes has been previously reported in the literature; however, to the best of our knowledge, this study represents the first report regarding the introduction of 5-substituted-1,2,4-triazole-3-thiols to the C₃₀ position of Bet. An interesting property of azoles is the annular tautomerism where the proton linked to a heteroatom can migrate to other heteroatoms within the heterocycle [37]; thus, the 1,2,4-triazoles can be found in three tautomeric forms, namely, 1H-, 2H-, and 4H-1,2,4-triazoles. Although, in general, the 1H tautomer was considered the only stable tautomer in solution, some derivatives, such as 3(5)-chloro-1,2,4-triazole and 3(5)-bromo-1,2,4-triazole, were identified as 4H tautomers in solution, contradicting the previous knowledge on the topic [38]. Currently, the effect of different tautomers on the biological effect is not clearly understood. The impact of one sole tautomer on the therapeutic properties of that compound is always dependent on the duration of the tautomeric equilibrium in relation to a given biological process. On one hand, the rapid interconversion of tautomers in relation to a certain biological process can lead to both forms being consumed. On the other hand, slow interconversion in a similar setting could end up in one tautomer being favored as the only active species [39]. Therefore they might induce a different impact on the biological effect, as some tautomers can be rapidly interchanged into the most favorable form to interact with the target while slow interconversion of others could result in the existence of a single active tautomer [40]. We established that all Bet-TZ1-4 compounds exist in DMSO solutions in two stable forms in various percentages, as detected through ¹H NMR spectroscopy, with one major component (59% to 81%) that we hypothesize is responsible for the anticancer effect. However, because we have not identified a specific protein target for our compounds, we cannot determine which tautomer is responsible for the biological effect. To visualize the exact tautomer form in the binding site, a highly precise crystallographic analysis of the target–ligand complex would be required.

The Bet-TZ1-4 cytotoxicity was assessed against HaCaT (human keratinocytes), A375 (melanoma), MCF-7 (breast cancer), and HT-29 (colorectal cancer) cell lines using the Alamar blue assay. The results in HaCaT cells showed that Bet-TZ2-4 semisynthetic derivatives significantly inhibit cell viability even at the highest tested concentration (100 µM); however, when used in high concentrations (75 and 100 µM), Bet-TZ1 significantly inhibited cell viability, compared to 5-FU used as a reference. These results indicate that Bet-TZ2-4 does not cytotoxically affect non-malignant cells and can be administered in elevated doses without significant side effects; in contrast, Bet-TZ1 exhibits clear cytotoxic effects against non-malignant keratinocytes. The selectivity index (SI) for Bet-TZ1, calculated as the IC₅₀ HaCaT/IC₅₀ cancer cell line, was less than 2 in all three cases (SI_A375 1.90, SI_MCF-7 1.27, and SI_HT−29 0.91), indicating non-selective cytotoxic activity. However, the use of only the selectivity index to assess the anticancer potential of a drug candidate has been shown to be a poor and insufficient predictor [41].

Shy et al. reported the synthesis of similar betulin derivatives only by using 1,2,3-triazole as a C30-substituent while maintaining the free C3-hydroxyl group; experimental results showed that all triazole derivatives exerted superior cytotoxic effects compared to the parent compound but the presence of large lipophilic aromatic side chains favored their bioactivity [42].

The cytotoxicity of Bet-TZ1-4 against the melanoma cell line was similar or slightly enhanced compared to Bet. In particular, the effect of higher doses of Bet-TZ1 (75 and 100 µM) against A375 was superior to Bet and even 5-FU; a dose-dependent cytotoxic effect was also recorded for Bet-TZ3 after 48 h of exposure. In breast and colorectal cancer cells, the lowest dose of Bet-TZ1 and Bet-TZ3 (10 µM) and all samples of Bet-TZ2 and Bet-TZ4 showed inferior cytotoxicity compared with 5-FU and Bet alone; doses above 25 µM of Bet-TZ1 and Bet-TZ3 exhibited significantly stronger cytotoxic activity compared to Bet and 5-FU. In A375 cells, the IC₅₀ values of Bet-TZ1 and Bet-TZ3 were 22.41 μΜ and 34.34 μΜ, compared to Bet alone (46.19 μΜ) and to 5-FU (1.06 μΜ). Intriguingly, despite a higher IC₅₀ value on A375 cells, when compared to Bet-TZ1, Bet-TZ3 can be viewed as a more effective agent due to the lack of cytotoxic effect on non-malignant HaCaT cells that reveals a selective cytotoxic effect against melanoma cells. In MCF-7 and HT-29 cells, Bet-TZ3 was not active (IC₅₀ > 100 μΜ) whereas Bet-TZ1 had an IC₅₀ of 33.52 μΜ and 46.92 μΜ, outperforming the parent-compound Bet (37.29 μΜ and 55.67 μΜ). Comparatively, the most active compounds were Bet-TZ1, in particular in higher concentrations, against all tested cell lines, and Bet-TZ3 when used in A375 cells. While the unsubstituted triazole derivative was cytotoxic to both malignant and non-malignant cells, a substituted phenyl attached to the 5th position of the triazole ring reduced toxicity to non-malignant cells. Bet-TZ3, a p-chloro-phenyl triazole derivative of Bet, was more selective, being cytotoxic primarily to the A375 melanoma cell line. This case was previously encountered in a series of substituted 1,2,3-triazole derivatives of betulinic acid (linked to the triterpene in the same 28th position), with the p-fluoro-phenyl derivative being the most active compound [42]. It appears that p-halogeno-triazole groups linked at the allylic position of a lupane-type triterpene are beneficial for inducing in vitro cancer cell cytotoxicity. However, this hypothesis requires a larger compound series to be synthesized and tested in order to be validated. Considering these results, only these two compounds in concentrations equivalent to their IC₅₀ values were further evaluated in terms of potential effect on cell morphology.

The induction of apoptosis is a well known cellular mechanism for Bet and other triterpenes [43], as well as their semisynthetic derivatives [44]. In the current study, a morphology assessment also showed that the newly synthesized betulin derivatives triggered apoptotic processes, identified as nuclei condensation and fragmentation which led to the formation of characteristic apoptotic bodies [45]. Apoptosis was also identified as the underlying mechanism for similar betulinic acid-triazole derivatives [34]; the authors established that large triazole substituents in the C30 position favorably influence the compound’s cytotoxicity becoming an important element of the pharmacophore with the C3 substituent affecting its bioavailability. For betulinic acid derivatives, having two hydrophilic groups in C28 and C3 positions seemed to hinder cell membrane penetration, with acetylation of at least one such group being able to overcome this challenge. In this case, both hydroxylic groups in the C20 and C3 positions bear the lipophilic acetate moiety that apparently facilitates cell entrance. Our previous experiments on betulinic acid derivatives bearing 1,2,4-triazole scaffolds in the C30 position, together with acetylated C3-hydroxyl, supported such conclusions both in terms of the mechanism of action and the structure–activity relationships [46,47].

Betulin was also previously shown to trigger apoptosis in cancer cells via the intrinsic signaling pathway. However, unlike betulinic acid, Bet does not primarily affect the pro/anti-apoptotic protein (BAX, Bcl-2) normal ratio [48,49], but rather induces an upregulated/increased caspase activity [50,51]. Caspases 3 and 9 are key players in the onset of the intrinsic apoptotic pathway [52], and as stated above, are correlated with Bet pro-apoptotic activity. However, given the fact that MCF-7 is a caspase 3-deficient cell line [53], we proceeded to quantify the expression of caspase 9 in cell lines treated with Bet-TZ1 and Bet-TZ3, where a significant cytotoxic activity was recorded. As expected, Bet did increase the expression of caspase 9, but so did both Bet derivatives in each tested setting. There are currently no triazole-betulin derivatives tested for anti-apoptotic activity similar to the ones described in this study. However, previous studies reported that the synthesis of other types of betulin derivatives with various functional groups in positions 3, 28, or 30 has resulted in pro-apoptotic agents with increased caspase activity [54,55,56]. According to these findings, the increased expression of various caspases and the associated pro-apoptotic features appear to be more related to the triterpenic structural core than to the various functional groups present in their structure. As a result, future research focusing on additional Bet derivatizations may shed light on the big picture of betulin derivatives-induced apoptosis in cancer cells.

It has been shown that the migration of cancer cells is an important marker for tumor cell invasion and metastasis while inhibiting cell migration represents a strong and desirable quality for a potent anticancer agent [57]. The antimigratory effect of the leading compounds, Bet-TZ1 and Bet-TZ3, was assessed in non-cancer and cancer cell lines; results revealed that although both compounds inhibit the migration of tested cells, the effect of Bet-TZ1, containing the unsubstituted 1,2,4-triazole, was superior to Bet-TZ3. The ability of the triterpene scaffold to prevent cancer cell migration was previously revealed for numerous betulin and betulinic acid derivatives displaying various chemical modulations in several cancer cell lines where the cytotoxic activity was clearly distinct from the anti-invasive capacity [58,59].

The HET–CAM assay represents a one of a kind model in biomedical testing since the chorioallantoic membrane provides a rich vascular network that enables a wide variety of non-invasive biological studies [60]. It is considered a better and more valid alternative to more invasive tests used to assess the local irritative potential of different substances, providing information regarding vascular events such as coagulation, hyperemia, and hemorrhage [61]. In our study, Bet, as well as its Bet-TZ1-4 derivatives did not induce irritative phenomena thus predicting their safe use on skin and mucosae. These findings are in agreement with other studies supporting the non-irritative and wound-healing effect of triterpenes [62]; one such example is a randomized phase 3 trial developed by Frew et al. [63] in which a gel containing Bet accelerated the healing of superficial partial thickness burns.

These findings collectively show that Bet can be an ideal starting point for developing potent cytotoxic compounds for cancer cells. This is an important step because, unlike its acid counterpart (BA), Bet is more readily obtained and considerably less expensive. Future research could focus on expanding the synthesized series in order to assess precise structure–activity relationships and possibly pinpoint specific targets for the active compounds.

4. Materials and Methods

4.1. Chemistry

The reagents utilized for the chemical synthesis were commercially acquired from Merk (Darmstadt, Germany) and were subsequently used without any supplementary purification.

4.1.1. Instruments

The 1D (¹H and ¹³C) and 2D NMR (H,H-COSY, H,C-HSQC, and H,C-HMBC) experiments were performed utilizing a Bruker Avance NEO Spectrometer 400 MHz (Bruker, Karlsruhe, Germany) that was equipped with a QNP direct detection probe (5 mm) and z-gradients. The spectra were recorded under standard conditions in either hexadeuterodimethyl sulfoxide (DMSO-d₆) or deuterochloroform (CDCl₃) and were referenced to the residual peak of the solvent (¹H: 2.51 ppm for DMSO-d₆ or 7.26 ppm for CDCl₃; ¹³C: 39.5 ppm for DMSO-d₆ or 77.0 for CDCl₃). For Bet-TZ1-4 derivatives, we first recorded the 1D and 2D NMR spectra in DMSO-d₆. Then, in each NMR tube containing the solutions of Bet-TZ1-4, a drop of trifluoroacetic acid (TFA) was added; the solutions were vortexed for 5 min at 500 rpm and then the 1D and 2D NMR experiments were recorded again. All the NMR experiments were recorded using standard parameter sets, as provided by Bruker. A Biobase melting point instrument (Biobase Group, Jinan, China) was utilized to record the melting points. Thin-layer chromatography was performed using 60 F254 silica gel-coated plates (Merck KGaA, Darmstadt, Germany). Fourier-transform infrared spectroscopy (FTIR) experiments were conducted with KBr pellets using a Shimadzu IR Affinity-1S apparatus (400–4000 cm⁻¹ range and a 4 cm⁻¹ resolution). Methanolic solutions were utilized to record LC/MS spectra in the negative ion mode, using an Agilent (Santa Clara, CA, USA) 6120 Quadrupole LC/MS system that was outfitted with an ESI ionization source, UV detector, and a SB−C18 Zorbax Rapid Resolution column. The samples were analyzed under the following conditions: 25 °C, 0.4 mL/min, and l = 250 nm. The mobile phase was composed of a 1 mM isocratic mixture comprising 15% ammonium formate and 85% methanol.

4.1.2. Synthesis Procedure for Br-Bet

The process of Bet acetylation was carried out using a modified version of a previously described method [64,65]. This involved the reaction of Bet (1 equivalent) with acetic anhydride (4 equivalents) in pyridine and dimethylaminopyridine (DMAP) (0.1 equivalent) at room temperature for a duration of 12 h. The reaction mixture underwent dilution with water and was subjected to triple extraction with CHCl₃. The organic phase was dehydrated using anhydrous MgSO₄, followed by solvent elimination through rotary evaporation. The freshly obtained 3-O, 28-O-diacetyl-betulin was subsequently used without undergoing supplementary purification. Subsequently, a solution of 2.5 g of acetylated Bet, approximately equivalent to 5 mmol, was prepared in 50 mL of CCl₄. Following this, 1.78 g of recently recrystallized NBS, equivalent to 10 mmol, was introduced into the solution. The reaction continued at room temperature for a duration of 48 h. Subsequently, the solution was subjected to filtration, followed by solvent evaporation. The resulting product was chromatographed over silica, utilizing a mixture of CHCl₃ and ethyl acetate in a volume ratio of 40:1.

3,28-O-diacetyl-betulin, white powder, m.p. 216–218 ℃, yield 82%; ¹H NMR (CDCl₃, 400.13 MHz, δ, ppm): 4.68 (s, 1H, H29a), 4.58 (s, 1H, H29b), 4.46 (dd, J = 6.0 Hz, J = 10 Hz, 1H, H3), 4.24 (d, J = 10.9 Hz, 1H, H28a), 3.84 (d, J = 11.0 Hz, H28b), 2.44 (m, 1H, H19), 2.07 (s, 3H, H34), 2.04 (s, 3H, H32), 1.98.1.90 (m, 1H, H15a), 1.84 (d, J = 13.0 Hz, 1H, H21a), 1.76 (dd, J = 12.4 Hz, J = 8.4 Hz, 1H, H7a), 1.68–1.59 (m, 10H, H1a, H2a, H12a, H13, H18, H22, H30), 1.50–1.49 (m, 1H, H6a), 1.41–1.39 (m, 5H, H9, H11a, H15b, H16), 1.30–1.18 (m, 3H, H6b, H11b, H21b), 1.11–1.02 (m, 6H, H2b, H7b, H12b, H27), 0.96–0.93 (m, 4H, H1b, H26), 0.84–0.83 (m, H23–25), 0.78 (d, J = 9.0 Hz, 1H, H5). ¹³C NMR (CDCl₃, 100.6 MHz, δ, ppm): 171.6 (C33), 171.0 (C31), 150.1 (C20), 109.9 (C29), 80.9 (C3), 62.8 (C28), 55.4 (C5), 50.3 (C9), 48.8 (C18), 47.7 (C19), 46.3 (C17), 42.7 (C14), 44.9 (C8), 38.4 (C1), 37.8 (C4), 37.5 (C13), 37.1 (C10), 34.5 (C7), 34.1 (C16), 29.7 (C21), 29.6 (C15), 27.9 (C23), 27.0 (C12), 25.1 (C2), 23.7 (C22), 21.3 (C32), 21.0 (C34), 20.8 (C11), 19.1 (C30), 18.2 (C6), 16.5 (C24), 16.1 (C27), 16.0 (C25), 14.7 (C26).

3,28-O-diacetyl-30-bromo-betulin (Br-Bet), white powder, m.p. 187–190 ℃, yield 65%; ¹H NMR (CDCl₃, 400.13 MHz, δ, ppm): 5.13 (s, 1H, H29a), 5.02 (s, 1H, H29b), 4.45 (m, 1H, H3), 4.25 (m, 1H, H28a), 3.97 (s, 2H, H30), 3.84 (m, H28b), 2.44 (m, 1H, H19), 2.07 (s, 3H, H34), 2.03 (s, 3H, H32), 1.84–0.76 (m, betulinic protons). ¹³C NMR (CDCl3, 100.6 MHz, δ, ppm)171.5 (C33), 171.0 (C31), 150.8 (C20), 113.3 (C29), 80.9 (C3), 62.5–14.6 (betulinic carbons). ESI-MS Rt = 4.74 min, m/z = 604 [M-H⁺]⁻.

4.1.3. Synthesis Procedure for TZ1

The procedure to synthesize 1,2,4-triazole-3-thiol (TZ1) was established based on the available methods in the literature [66,67] and was previously reported by our group along with the corresponding spectral data [46]. First, 0.5 moles of formic acid (90%, 20 mL) was stirred with 0.1 moles thiosemicarbazide for 30 min, when 1-formyl-3-thiosemicarbazide began to crystalize. Cold water was added and the emulsion was filtered and kept in an ice bath for the crystallization of 1H-1,2,4-triazole-3-thiol to occur. The crystals were filtered, dried, and utilized immediately without additional purification. For the following stage, 30 mmoles of NaOH, 20 mL H₂O, and 28.1 mmoles of 1-formyl-3-thiosemicarbazide were added into a 50 mL round-bottom flask and were refluxed for 1 h. After completion, the reaction was cooled and the final product was precipitated (concentrated HCl) and filtered.

4.1.4. Synthesis Procedure for TZ2-4

The procedure for synthesizing 5-substituted-1,2,4-triazole-3-thiol was carried out in accordance with established methodologies as previously reported [24]. A solution containing 20 mmol of thiosemicarbazide was prepared by dissolving it in 50 mL of DMF while being stirred magnetically. Then, 22 mmol of pyridine and 20 mmol of aroyl chloride were added to the solution. The process of magnetic stirring was sustained at room temperature for a duration of 30 min, following which the temperature was elevated to 50 °C and sustained for an approximate duration of 1 h. The endpoint of the reaction was verified by means of TLC. The aroyl-thiosemicarbazides that were obtained were subjected to precipitation using aqueous hydrochloric acid, followed by filtration and subsequent drying. Furthermore, the 5-substituted-1H-1,2,4-triazole-3-thiols (TZ2-4) were synthesized through the cyclization of 10 mmol of aroyl-thiosemicarbazide in ethanolic NaOH at reflux. The reaction was monitored using TLC until completion. The 5-substituted-1H-1,2,4-triazole-3-thiols were obtained through precipitation with HCl 4% and the further filtration of the resulting precipitate. Spectral data for TZ2 and TZ4 were previously reported [47]. Spectral data for TZ3 are listed below.

5-(4-chlorophenyl)-1H-1,2,4-triazole-3-thiol (TZ3); white powder, m.p. 296−298 °C (uncorrected), yield 65%; ¹H NMR (400.13 MHz, DMSO-d6, d, ppm): 13.93 (s, 1H), 13.75 (s, 1H), 7.93 (d, J = 8.6 Hz, 2H), 7.61 (d, J = 8.6 Hz, 2H). ¹³C NMR (100.6 MHz, DMSO-d6, d, ppm): 167.1, 149.3, 135.2, 129.2, 127.4, 124.3. ESI−MS Rt = 0.5 min, m/z = 210 [M-H⁺]⁻.

4.1.5. Synthesis Procedure for Bet-TZ1-4

A quantity of 0.2 mmoles of 3,28-O-diacetyl-30-bromo-betulin (BetBr) and 0.3 mmoles of anhydrous K₂CO₃ were added in 5 mL of DMF and were stirred for 10 min at 25 °C. In the next stage, 0.2 mmoles of triazole derivative (TZ1-4) was added and the mixture was stirred for an additional 72 h at room temperature. In the following stage, the mixture was diluted with 50 mL H₂O and then extracted with CHCl₃ (4 × 15 mL). Anhydrous MgSO₄ was used to dry the organic phase and after solvent removal, the obtained product was chromatographed using a 2:1 ratio of CHCl₃ to ethyl acetate.

3,28-O-diacetyl-30-(1H-1,2,4-triazole-3-yl-sulfanyl)-betulin (Bet-TZ1), white powder, m.p. 113–119 °C (uncorrected), yield 38%; ¹H NMR (DMSO-d₆ + TFA, 400.13 MHz, δ, ppm): 8.49 (, s, 1H, H36), 4.95 (s, 1H, H29a), 4.91 (s, 1H, H29b), 4.36 (dd, J = 4.6 Hz, J = 10 Hz, 1H, H3), 4.23 (d, J = 10.8 Hz, 1H, H28a), 3.80 (s, 2H, H30) 3.72 (d, J = 10.9 Hz, H28b), 2.47 (m, 1H, H19),2.03 (m, 1H, H2a) 2.02 (s, 3H, H34), 1.99 (s, 3H, H32), 1.74–0.94 (betulinic protons), 0.80–0.78 (m, 10H, H5, H23–25). ¹³C NMR (DMSO-d₆+ TFA, 400.13 MHz, δ, ppm): 170.9 (C33), 170.3 (C31), 156.4 (C35), 149.7 (C20), 146.3 (C36), 111.6 (C29), 80.1 (C3), 61.4 (C28), 54.7 (C5), 49.6 (C9), 49.2 (C18), 46.1 (C17), 44.6 (C19), 42.3 (C14), 40.5 (C8), 37.9 (C1), 37.5 (C4), 37.1 (C13), 36.7 (C10), 36.5 (C30), 33.9 (C7), 33.7 (C16), 30.9 (C21), 29.3 (C15), 27.6 (C23), 26.7 (C12), 26.2 (C2), 23.5 (C22), 21.1 (C32), 20.8 (C34), 20.6 (C11), 17.8 (C6), 16.5 (C24), 15.9 (C27), 15.7 (C25), 14.6 (C26). FTIR [KBr] (cm⁻¹) relevant peaks: 3117 (N-H stretch); 2945, 2872 (C-H stretch); 1735, 1244, 1030 (ester C=O, C-C-O, O-C-C stretch); ESI-MS Rt = 2.85 min, m/z = 625 [M-H⁺]⁻.

3,28-O-diacetyl-30-{5-[4-(dimethylamino)phenyl]-1H-1,2,4-triazole-3-yl-sulfanyl}-betulin (Bet-TZ2); white powder, m.p. 113–119 °C (uncorrected), yield 41%; ¹H NMR (DMSO-d₆ + TFA, 400.13 MHz, δ, ppm): 7.85 (d, J = 8.8 HZ, 2H, H38), 7.00 (d, J = 8.8 Hz, 2H, H39), 5.00 (s, 1H, H29a) 4.90 (s, 1H, H29b), 4.31 (dd, J = 4.8 Hz, J = 11.3 Hz, 1H, H3), 4.22 (d, J = 10.9 Hz, 1H, H28a), 3.90 (d, J = 14.4 Hz, 1H, H30a, AB spin system), 3.81 (d, J = 14.4 Hz, 1H, H30b, AB spin system), 3.73 (d, J = 10.9 Hz, H28b), 3.02 (s, 6H, H41), 2.47 (m, 1H, H19), 2.06 (m, 1H, H2a) 2.00 (s, 3H, H34), 1.97 (s, 3H, H32), 1.70–0.90 (betulinic protons), 0.75–0.72 (m, 10H, H5, H23–25). ¹³C NMR (DMSO-d₆+ TFA, 400.13 MHz, δ, ppm): 171.0 (C33), 170.5 (C31), 160.6 (C40), 156.3 (C35), 155.8 (C35), 150.4 (C40) 149.6 (C20), 127.7 (C38), 116.1 (C37), 113.7 (C39), 111.5 (C29), 80.2 (C3), 61.7 (C28), 54.9 (C5), 49.7 (C9), 49.1 (C18), 46.2 (C17), 44.3 (C19), 42.4 (C14), 41.0 (C41), 40.6 (C8), 37.8 (C1), 37.5 (C4), 37.2 (C13), 36.7 (C10, C30), 34.0 (C7), 33.7 (C16), 31.0 (C21), 29.4 (C15), 27.8 (C23), 26.8 (C12), 26.4 (C2), 23.6 (C22), 21.1 (C32), 20.9 (C34), 20.7 (C11), 17.9 (C6), 16.6 (C24), 16.0 (C27), 15.8 (C25), 14.7 (C26). FTIR [KBr] (cm⁻¹) relevant peaks: 3232 (N-H stretch); 2945, 2873 (C-H stretch); 1735, 1244, 1029 (ester C=O, C-C-O, O-C-C stretch); ESI-MS Rt = 2.25 min, m/z = 744 [M-H⁺]⁻.

3,28-O-diacetyl-30-[5-(4-chlorophenyl)-1H-1,2,4-triazole-3-yl-sulfanyl]-betulin (Bet-TZ3); white powder, m.p. 128–135 °C (uncorrected), yield 32%; ¹H NMR (DMSO-d₆ + TFA, 400.13 MHz, δ, ppm): 7.97–7.95 (m, 2H, H38), 7.48 (d, J = 6.6 Hz, 2H, H39), 5.03 (s, 1H, H29a) 4.91 (s, 1H, H29b), 4.36 (dd, J = 4.5 Hz, J = 11.3 Hz, 1H, H3), 4.22 (d, J = 10.8 Hz, 1H, H28a), 3.93 (d, J = 14.5 Hz, 1H, H30a, AB spin system), 3.80 (d, J = 14.5 Hz, 1H, H30b, AB spin system) 3.73 (d, J = 10.9 Hz, H28b), 2.57 (m, 1H, H19), 2.06 (m, 1H, H2a) 2.00 (s, 3H, H34), 1.98 (s, 3H, H32), 1.72–0.91 (betulinic protons), 0.76–0.68 (m, 10H, H5, H23–25). ¹³C NMR (DMSO-d₆+ TFA, 400.13 MHz, δ, ppm): 170.9 (C33), 170.3 (C31), 157.7 (C36), 156.0 (C35), 149.6 (C20), 130.0 (C40), 129.0 (C39), 128.5 (C37), 126.0 (C38), 114.5 (C29), 80.6 (C3), 61.6 (C28), 54.7 (C5), 49.6 (C9), 49.0 (C18), 46.1 (C17), 44.5 (C19), 42.3 (C14), 40.5 (C8), 37.9 (C1), 37.4 (C4), 37.1 (C13), 36.6 (C10, C30), 33.9 (C7), 33.7 (C16), 30.7 (C21), 29.4 (C15), 27.7 (C23), 26.7 (C12), 26.1 (C2), 23.4 (C22), 21.0 (C32), 20.8 (C34), 20.6 (C11), 17.8 (C6), 16.4 (C24), 15.9 (C27), 15.7 (C25), 14.6 (C26). FTIR [KBr] (cm⁻¹) relevant peaks: 3230 (N-H stretch); 2945, 2872 (C-H stretch); 1735, 1246, 1029 (ester C=O, C-C-O, O-C-C stretch); ESI-MS Rt = 3.05 min, m/z = 735 [M-H⁺]⁻.

3,28-O-diacetyl-30-[5-(4-methoxyphenyl)-1H-1,2,4-triazole-3-yl-sulfanyl]-betulin (Bet-TZ4); white powder, m.p. 132–138 °C (uncorrected), yield 35%; ¹H NMR (DMSO-d₆ + TFA, 400.13 MHz, δ, ppm): 7.88 (d, J = 8.8 HZ, 2H, H38), 7.04 (d, J = 8.8 Hz, 2H, H39), 5.00 (s, 1H, H29a) 4.90 (s, 1H, H29b), 4.36 (dd, J = 4.8 Hz, J = 11.1 Hz, 1H, H3), 4.22 (d, J = 10.9 Hz, 1H, H28a), 3.89 (d, J = 14.5 Hz, 1H, H30a, AB spin system), 3.81–3.79 (m, 4H, H30b, H41) 3.72 (d, J = 11.0 Hz, H28b), 2.47 (m, 1H, H19), 2.06 (m, 1H, H2a) 2.00 (s, 3H, H34), 1.97 (s, 3H, H32), 1.71–0.90 (betulinic protons), 0.76–0.69 (m, 10H, H5, H23–25). ¹³C NMR (DMSO-d₆+ TFA, 400.13 MHz, δ, ppm): 170.7 (C33), 170.1 (C31), 160.6 (C40), 156.9 (C36), 156.4 (C35), 149.6 (C20), 127.5 (C38), 120.6 (C37), 114.3 (C39), 111.2 (C29), 79.9 (C3), 61.5 (C28), 55.3 (C41), 54.6 (C5), 49.5 (C9), 48.9 (C18), 46.0 (C17), 44.3 (C19), 42.2 (C14), 40.4 (C8), 37.6 (C1), 37.3 (C4), 37.0 (C13), 36.5 (C10), 36.4 C30), 33.8 (C7), 33.6 (C16), 30.7 (C21), 29.2 (C15), 27.6 (C23), 26.6 (C12), 26.0 (C2), 23.3 (C22), 20.9 (C32), 20.7 (C34), 20.5 (C11), 17.7 (C6), 16.4 (C24), 15.7 (C27), 15.6 (C25), 14.5 (C26). FTIR [KBr] (cm⁻¹) relevant peaks: 3230 (N-H stretch); 2945, 2872 (C-H stretch); 1735, 1247, 1030 (ester C=O, C-C-O, O-C-C stretch); ESI-MS Rt = 2.14 min, m/z = 731 [M-H⁺]⁻.

4.2. Biological Assessment

4.2.1. Cell Culture

The selected cell lines for the study, namely, HaCat (immortalized human keratinocytes) were acquired from CLS Cell Lines Service GmbH (Eppelheim, Germany), whereas A375 (human malignant melanoma cells), HT-29 (human colorectal adenocarcinoma), and MCF7 (human breast adenocarcinoma) were purchased from American Type Culture Collection (ATCC, Lomianki, Poland). The aforementioned cells were obtained as frozen items and were subsequently stored in liquid nitrogen. Dulbecco’s Modified Eagle Medium (DMEM) High Glucose added with 1% Penicillin/Streptomycin mixture (100 IU/mL) and with 10% fetal bovine serum (FBS) was used to culture HaCaT and A375 cells, while HT-29 cells were cultured using McCoy’s 5A Medium, supplemented with the same 10% FBS and 1% antibiotic mixture. The MCF7 cells were propagated in Eagle’s Minimum Essential Medium (EMEM), supplemented with 10% FBS, 1% antibiotic mixture, and 0.01 mg/mL human recombinant insulin. All cells were maintained in a humified incubator with 5% CO₂ at 37 °C. After reaching 80–90% confluence, cells were stimulated with the tested compounds (10, 25, 50, 75, and 100 μΜ) for 24 h and 48 h, respectively. The cell number was determined with Trypan Blue using a cell counting device (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

4.2.2. Cell Viability Assessment

The Alamar blue colorimetric determination was used to assess the cell viability of HaCaT, A375, MCF7, and HT-29 cells, after stimulation with increasing concentrations (10, 25, 50, 75, and 100 μΜ) of four diacetylbetulin derivatives, betulin, and 5-fluorouracil as a positive control, at the same concentrations for 48 h. The cells (1 × 10⁴) were seeded into 96-well plates and incubated (37 °C and 5% CO₂) until an 80–85% confluence was reached. The used medium was discarded using an aspiration station and swapped with fresh medium specific for each cell line, containing the compounds. The tested concentrations (10, 25, 50, 75, and 100 μM) were prepared from 20 mM compound stock solutions so that the final concentration of DMSO did not exceed 0.5%. After 48 h, 0.01% Alamar blue was used to counterstain all cells, after which the cells incubated for an additional 3 h. The absorbance measurements were carried out at 2 wavelengths (570 nm, and 600 nm) using a xMark™ Microplate Spectrophotometer, Bio-Rad (Hercules, CA, USA). The experiments were performed in triplicate.

4.2.3. Immunofluorescence Assay—Morphological Assessment of Apoptotic Cells

The assessment of nuclear localization and any signs of apoptosis (shrinkage, fragmentation) and cytoplasmatic alterations were determined using Hoechst staining, while the cytoplasmatic localization was assessed using beta-tubulin staining. HaCaT, A375, MCF-7, and HT-29 cells were seeded onto 12-well plates at 2 × 10⁵ cells/well initial density. After reaching 80–90% confluence, the cells were stimulated with Bet-TZ1 using its 48-h-treatment IC₅₀ values obtained for each cell line and with Bet-TZ3 at its 48-h-treatment IC₅₀ value for the A375 cell line. Separately, some wells were stimulated with 5-fluorouracil using the concentration corresponding to its IC₅₀ values for each cell line at 48 h. After 48 h, the old medium was removed and the cells were fixed with methanol for 15 min, permeabilized with Triton X 0.01% in phosphate buffer saline (PBS) for an additional 15 min, and finally blocked with Bovine serum albumin 3% (BSA) for 30 min at room temperature. Afterward, the cells were stained with beta-tubulin monoclonal antibody at a dilution of 1:2000 in BSA 3% for 1 h (room temperature) and subsequently incubated with Alexa Fluor 488 goat-anti mouse secondary antibody at a 1:5000 dilution in BSA 3% for 30 min in the dark. Finally, the Hoechst 33258 solution was added for 5 min. The nuclear and cytoplasmatic alterations were observed and recorded using the integrated DP74 digital camera of the inverted microscope, Olympus IX73 (Olympus, Tokyo, Japan).

4.2.4. Real-Time PCR Quantification of Apoptotic Markers

The total RNA was extracted using the peqGold RNAPureTM Package (Peqlab Biotechnology GmbH, Erlangen, Germany) following the manufacturer’s instructions, and the total concentration of RNA was measured using a DS-11 spectrophotometer (DeNovix, Wilmington, DE, USA). Reverse transcription was achieved using the Maxima^® First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The Tadvanced Biometra Product line (Analytik Jena AG, Göttingen, Germany) was used for sample incubation using the following thermal cycle: 10 min at 25 °C, 15 min at 50 °C, and 5 min at 85 °C. The Quant Studio 5 real-time PCR system (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used for quantitative real-time PCR determinations. The experiment was conducted using 20 µL aliquots containing Power SYBR-Green PCR Master Mix (Thermo Fisher Scientific, Inc., Waltham, MA, USA), pure water, the sense and antisense primer, and the sample cDNA. The primer pairs used for this method included 18 S (Thermo Fisher Scientific, Inc., Waltham, MA, USA), used as housekeeping gene (sense: 5′GTAACCCGTTGAACCCCATT 3′; antisense: 5′CCATCCAATCGGTAGTAGCG3′), and Caspase-9 (sense: 5′ATGGACGAAGCGGATCGGCGGCTCC3′; antisense: 5′GCACCACTGGGGGTAAGGTTTTCTAG3′) (Eurogentec, Seraing, Belgium). Normalized, results were calculated using the comparative threshold cycle method (2^−ΔΔCt).

4.2.5. Scratch Assay

The regressive effect on the invasion capacity of Bet-TZ1 (on A375, MCF7, and HT-29 cancer cells) and Bet-TZ3 (on A375 cells) and their wound healing potential on HaCaT cells was determined using the scratch test. The cells were seeded onto 12-well plates at an initial density of 2 × 10⁵ cells/well. After reaching 80–85% confluence, the old medium was removed and each well was washed with warm PBS, then treated with 5 μg/mL mitomycin C for 2 h at 37 °C. Mitomycin C is an antibiotic that inhibits DNA synthesis and cell proliferation used to determine the true anti-migratory effect of a substance. After mitomycin C treatment, the cells were again washed with PBS, scratched onto the diameter of the well with a sterile pipette tip, and then stimulated with 10 μM Bet-TZ1 and Bet-TZ3. To establish the scratch closure rate (%), the wells were photographed at 0, 24, and 48 h using the Olympus IX73 inverted microscope (Olympus, Tokyo, Japan). The Sense Dimension software (version 1.8) was utilized for analyzing cell migration for each cell line.

4.2.6. Statistical Analysis

The statistical analysis was achieved by employing a t-test and one-way ANOVA followed by Dunnett’s post hoc test using GraphPad Prism version 6.0.0 (GraphPad Software, San Diego, CA, USA). The IC₅₀ values were calculated using the same software, according to the correlation between the log[concentration] and cell viability. The statistically significant threshold (p < 0.05) between groups was * p < 0.05, ** p < 0.01, and *** p < 0.001.

4.3. HET−CAM Assay

We used the HET−CAM in vivo protocol to evaluate the safety profile of a particular substance against a living tissue. The standard protocol involved the usage of a developing chorioallantoic membrane within an embryonated chicken (Gallus domesticus) egg. This method complied with the Interagency Coordinating Committee on the Validation of Alternative Methods recommendations [68], which were customized to suit the specific circumstances of the study. Based on an adapted approach to the established methodology [69], the eggs were subjected to incubation conditions of 37 °C and 50% relative humidity. On the third day of incubation, 5–6 mL of albumen was extracted, subsequently leading to the creation of an opening at the top of the eggs. In the context of the developing chorioallantoic membrane of the chick embryo, a volume of 300 μL of SLS (positive control), Bet, and Bet-TZ1-4 were administered at a concentration of 100 µM. The alterations in CAM were observed through the use of stereomicroscopy, specifically, the Discovery 8 Stereomicroscope by Zeiss (Jena, Germany). The images were captured using the Zeiss Axio CAM 105 color camera, both before and 5 min after the application of the tested substances. During the five-minute duration, the impact on three specific parameters was observed (hemorrhage, lysis, and vascular plexus coagulability). Each determination was performed in triplicate. The obtained results were quantified as irritation factor (IF) values, which were determined using the provided formula. These values were then compared to a negative (distilled water) and a positive control (SLS 0.5%) with an IF of 16.29. The Luepke scale was used to interpret the IF values, where a range of 0–0.9 indicates non-irritation, 1–4.9 indicates weak irritation, 5–8.9 indicates moderate irritation, and 9–21 indicates strong irritation [70].

$$IF=5\ast \frac{301-Sec H}{300}+7\ast \frac{301-Sec L}{300}+9\ast \frac{301-Sec C}{300};$$

where IF = irritation factor; H = hemorrhage; L = vascular lysis; C = coagulation; Sec H = start of hemorrhage reactions (s); Sec L = onset of vessel lysis on CAM (s); Sec C = onset of (s).

5. Conclusions

This study presented the synthesis, cytotoxicity assessment, and influence on angiogenesis of a series of diacetylbetulin derivatives containing 5-Substituted-1,2,4-triazoles at C₃₀ (Bet-TZ1-4). While the synthesis protocol led to obtaining good yields of target compounds, the NMR analysis revealed that, in the DMSO solution, they exist in two tautomeric forms that could have an influence on the anticancer effect, the hypothesis that remains to be explored in further studies. The cytotoxicity assessment of Bet-TZ1-4 against A375 (melanoma), MCF-7 (breast cancer), HT-29 (colorectal cancer), and HaCaT (human keratinocytes) revealed Bet-TZ1 as the lead candidate of the series against all tested lines. However, the cytotoxicity of Bet-TZ1 manifested also against the non-malignant HaCaT cell line, indicating a reduced selectivity of the derivative. Promising results were also obtained for Bet-TZ3, which exhibited a selective cytotoxic effect against melanoma cells, and along Bet-TZ1, which showed promising anti-migratory properties. A related cytotoxic correlated pro-apoptotic effect was observed for both compounds confirmed by morphological nuclear assessment and PCR results that showed an increase in the expression of caspase 9. The HET−CAM test revealed that Bet-TZ1-4 does not have an irritative potential, supporting their safety application in local treatments. Although our study obtained modest results in terms of cytotoxicity, further investigation of betulin-triazole derivatives still remains a pathway that should be explored, focusing on the synthesis of more selective derivatives against cancer.