Next Article in Journal
Extraction Kinetics of Pyridine, Quinoline, and Indole from the Organic Phase with Natural Deep Eutectic Solvents and Separation Study Using a Centrifugal Extractor
Next Article in Special Issue
Synergistic Effects of Plastid Terminal Oxidases 1 and 2 in Astaxanthin Regulation under Stress Conditions
Previous Article in Journal
Determining the Role of Water Molecules in Sodalite Formation Using the Vapor Phase Crystallization Method
Previous Article in Special Issue
Underutilized Fig (Ficus carica L.) Cultivars from Puglia Region, Southeastern Italy, for an Innovative Product: Dried Fig Disks
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Processes
Volume 12
Issue 3
10.3390/pr12030487
processes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MYB Transcriptional Factors Affects Upstream and Downstream MEP Pathway and Triterpenoid Biosynthesis in Chlamydomonas reinhardtii

by
Muhammad Anwar
1,2,†,
Jingkai Wang
1,†,
Jiancheng Li
1,*,
Muhammad Mohsin Altaf
2 and
Zhangli Hu
1,*
1
Shenzhen Engineering Laboratory for Marine Algal Biotechnology, Guangdong Engineering Research Center for Marine Algal Biotechnology, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China
2
School of Tropical Agriculture and Forestry, Hainan University, Haikou 570228, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Processes 2024, 12(3), 487; https://doi.org/10.3390/pr12030487
Submission received: 5 December 2023 / Revised: 12 February 2024 / Accepted: 21 February 2024 / Published: 28 February 2024
(This article belongs to the Special Issue Advances in Chemical Characterization, Pharmacological Applications and Synthetic Biology of Natural Products)
Browse Figures
Versions Notes

Abstract

:
Terpenoids are enormous and different types of naturally occurring metabolites playing an important role in industrial applications. Cost-effective and sustainable production of terpenoids at commercial scale is the big challenge because of its low abundance from their natural sources. Metabolic and genetic engineering in microorganisms provide the ideal platform for heterologous overexpression protein systems. The photosynthetic green alga Chlamydomonas reinhardtii is considered as a model host for the production of economic and sustainable terpenoids, but the regulation mechanism of their metabolisms is still unclear. In this study, we have investigated the genetic and metabolic synthetic engineering strategy of MYB transcriptional factors (MYB TFs) in terpenoids’ synthesis from C. reinhardtii for the first time. We heterologous overexpressed MYB TFs, specifically SmMYB36 from Salvia miltiorrhiza in C. reinhardtii. MYB upregulated the key genes involved in the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. Expression of the SQS gene, which is involved in the downstream triterpenoid synthesis pathway, highly accumulated in MYB-overexpression lines of C. reinhardtii. The contents of squalene increased about 90.20 μg/g in MYB-overexpressed lines. Our results propose the rerouting of the carbon flux toward the biosynthesis of triterpenoids upon overexpression of MYB TFs in C. reinhardtii. Our study suggests imperative novel understandings into the regulation mechanisms of C. reinhardtii triterpenoid metabolism through MYB TFs in photosynthetic green microalgae C. reinhardtii. The role of MYB TFs is investigated for the first time in C. reinhardtii, and provides a prodigious potential for recognizing important transcriptional regulators of the MEP pathway as goals for prospective metabolic and genetic manipulation investigation for increased production of triterpenoids.

1. Introduction

Globally, the population is rapidly increasing, which ultimately leads to accelerated demand for food, pharmaceutical compounds, and energy. Alternative sources are crucial to fulfill the demand for these bioproducts. In this perspective, the cultivation of photosynthetic green microalgae might be an attractive opportunity due to their reduced water footprint than those of agriculture crops and the best option of cultivating them in diverse environmental conditions consuming wastewater as a phosphorous and nitrogen source. Existence mechanisms of carbon concentration in photosynthetic green microalgae facilitate to assimilate CO2 efficiently and liberate O2 as a byproduct through the process of photosynthesis [1]. The biomass created by microalgae contains relatively high concentrations of sterols, phenolic compounds, and others [2]. Thus, microalgae could be deliberated to increase CO2 sequestration, able to recover nutrients from waste and yield valuable compounds [3]. Terpenoids are enormous and a different class of naturally occurring metabolites playing an important function in various industrial applications [4]. Most commercially available terpenoids are obtained from higher plants, but their cost-effective and sustainable production for industrial purposes is still challenging because of their low abundance of production from natural sources, extraction and purification obstacles, and degree of labor intensity [5]. In response to these confronts, bioengineering of microorganisms in controlled bioreactors for terpenoid production has appeared as an ideal solution. Microorganisms including bacteria (Escherichia coli) and yeast (Saccharomyces cerevisiae) are unable to naturally produce plant metabolites. So these organisms are usually selected as heterologous ideal hosts for the production of terpenoids owing to the advantages of complete information regarding their metabolism and genetic tractability [6]. E. coli and S. cerevisiae need sources of organic compounds for their optimized growth. Therefore, the production of terpenoids from these organisms at a commercial level also presents economic challenges. Currently, genetically modified photosynthetic green microbial hosts have become a carbon-neutral alternative to a generally utilized fermentative system. These carbon-neutral alternatives have the potential to transform CO2 into highly valuable bioproducts [7]. Previous studies have provided evidence of heterologous terpenoid expression for Synechocystis sp. PCC 6803 and C. reinhardtii [8,9].
C. reinhardtii is a single-celled eukaryotic green alga, known as “photosynthetic yeast” due to its simple cultivation conditions, short growth cycle, rapid growth, and high photosynthetic efficiency. It has a complex post-translational modification system that can accurately process and modify eukaryotic proteins to ensure that recombinant proteins have the same activity as natural proteins [10]. The growth and metabolism of Chlamydomonas reinhardtii do not produce toxic waste, and the extraction and purification process of the product is relatively simple. There is no risk of environmental pollution from by-products. These advantages indicate that it is a promising terpenoid production system [7].
Squalene is a critical intermediate in the biosynthesis of sterol in a range of organisms from bacteria to humans [11]. Squalene C30 has been considered for various biological functions, such as a natural antioxidant, anticancer, dietary complement, auxiliary for vaccines, and skin moisturizer for therapeutic, cosmetic, and pharmacological uses as well as a protective response to cardiovascular diseases [12,13]. Shark liver oil is the main source of squalene, with a content of up to 80% [14]. Among vegetable sources of squalene, extra virgin olive oil (EVOO) is one of the richest ones, containing squalene in 0.1–1.2%, along with amaranth oil that contains a higher amount (7–8%) but is produced with lower yields compared to olive oil [14,15]. The determination of squalene content in olive oil by transmethylation and GC analysis is 2.88 ± 0.08 (mg g−1) [16]. Eating olive oil is beneficial to prevent colon cancer and breast cancer, and also has the ability to reduce blood pressure [17]. Microorganisms, including microalgae, have also been investigated for the biosynthesis of squalene at a commercial level [18]. Compared with extracting squalene from vegetable oil, the production cycle of squalene using microorganisms is shorter, the cost is lower, it is economical, environmentally friendly, and easier to regulate [19]. To assure a sustainable supply of squalene and fulfill its industrial demand, substitute sources are required, such as marine organisms. The amount of squalene in microorganisms varies greatly depending on the species. The contents of squalene obtained from Torulaspora delbrueckii and S. cerevisiae were 0.24 and 0.04 μg/mg, respectively [20]. A higher amount of squalene (171 μg mg−1 dry weight) in the cells of Aurantiochytrium sp. strain 18W-13a was accumulated [21]. Previous studies reported that Euglena and Botryococcus braunii were able to accumulate squalene in their cells [11]. Functionally, the characterization of a few genes, which are considered for the metabolism of squalene, has been documented in microalgae [22].
The two general biosynthetic pathways, including the mevalonate (MVA) pathway and the methylerythritol phosphate (MEP) pathway, are involved in the production of squalene in plants, while green algae entertain the MEP biosynthetic pathway only [23]. IPP and DMAPP are the universal precursors of terpenoids, which are regulated by the MEP/MVA biosynthetic pathway. The building blocks of particular terpenoids are the GPP, FPP, and GGPP, which are formed by the condensation of IPP and DMAPP. The heterologous terpenoid synthesis usually involves the whole biosynthetic pathways or specific enzyme expressions, which link to endogenous terpenoid metabolism and change the substrate of prenyl phosphate into the required product [24]. In order to obtain higher yields of the desirable product, it is essential to modify the upstream terpenoid biosynthetic pathways (MEP) through genetic and metabolic engineering [6]. In microalgae, to increase sustainable terpenoid production, metabolic engineering is required in the MEP pathway in order to improve the carbon flow toward the synthesis of terpenoids [25]. In the current study, we have investigated MYB transcriptional factors as a prospective elicitor of the MEP/MVA biosynthetic pathway in the plants. R2R3-MYB transcriptional factors are the largest family in plants and play an important role in the regulation of secondary metabolites and terpenoids. VvMYB5b transcriptional factors increased the accumulation of terpenoids, as previously described [26]. SmMYB97 TFs belong to medicinal plants (S. miltiorrhiza) and increase the contents of the terpenoids (tanshinones) in their overexpression lines [27]. SmMYB98 belong to the R2R3-MYB subgroup 20, which are involved in the biosynthesis of phenolic acid and terpenoids. SmMYB98 accumulate the terpenoids (tanshinones) in overexpressed lines [28]. In light of the above evidence, MYB transcriptional factors play an important role in the synthesis of terpenoids in higher plants. In microalgae, a few studies have been reported on the regulation of MYB transcriptional factors in terpenoid synthesis. For example, MYB44 positively regulate the carotenoid biosynthesis in U. prolifera, which is known as marine green algae [29]. However, the role of MYB transcriptional factors in the regulation of terpenoids in C. reinhardtii is not yet functionally characterized.
In C. reinhardtii, the biosynthesis of squalene is excepted through the MEP pathway [30]. In the initial stage, squalene is synthesized by squalene synthase (SQS) from farnesyl diphosphate (FPP). A two-step reaction produces squalene by reductive dimerization of FPP with SQS. This reaction continues through head-to-head coupling of two FPP molecules to produce squalene through a stable cyclopropylcarbinyl diphosphate intermediate [31].
In the current study, by using advanced synthetic biotechnology approaches, heterologous overexpression of MYB TFs was achieved in C. reinhardtii, which might play an important role in the production of squalene (Figure 1). To optimize MYB TFs’ expression in C. reinhardtii, it was completely redesigned. The vectors were constructed with the goal of expressing and accumulating the targeted protein in C. reinhardtii’s nucleus.

2. Materials and Methods

2.1. Strain of C. reinhardtii and Culture Condition

Chlamydomonas reinhardtii (CC-124) was obtained from Guangdong Technology Research Center for Marine Algal Bioengineering, Shenzhen University, and was cultivated in media (Tris-Acetate-Phosphate (TAP)) under a photoperiod of 16/8 h light and dark cycle with the photon fluence rate of 50 µmol m−2 s−1 in a growth chamber at 25 °C. The maintenance of transgenic C. reinhardtii cells were carried out in the TAP media supplemented with respective antibiotics. Transgenic C. reinhardtii cells were chosen on the agar plate (TAP) supplemented with zeocin (8 µg/mL) (Invitrogen, Carlsbad, CA, USA). The transgenic lines and wild type cells of C. reinhardtii were cultured to 1 × 106 cell/mL cell density. In order to harvest the cells of transgenic and wild type of C. reinhardtii CC124, centrifugation at 6000× g for 5 min was carried out.

2.2. The Construction of Plasmid and Expression Screening

The coding sequence of SmMYB36 was optimized according to the codon bias of C. reinhardtii in order to achieve high transformation efficiency and the expression of foreign genes. The synthesis and redesign of nucleotides for its optimization were carried out by the company GenScript Biotech Corp. (Nanjing, China). The optimized nucleotide sequence was introduced into the expression vector in order to acquire the RPL23-SmMYB98-RPL23-ble plasmid (Figure 2). This vector contains the RPL23 promoter to induce the expression of the gene of interest. The designated vector was multiplied in E. coli on LB media, which was supplemented with ampicillin antibiotic (100 µg/mL). The optimized codon synthesized sequence of SmMYB36 contains BamH1 and EcoRI restriction sites, respectively, and were cloned into the RPL23-SmMYB98-RPL23-ble vector, which carries bleomycin resistance. The confirmation of nucleotide sequence accuracy of each plasmid was carried out by sending the samples to the company. The plasmid RPL23-SmMYB98-RPL23-ble was constructed and was used to transform Chlamydomonas cells.

2.3. Transformation and Screening

The wild type strain C. reinhardtii (CC124) was transformed following electroporation protocol. The cells of wild type C. reinhardtii CC124 strain were cultured in TAP liquid media at 25 °C under continuous light intensity (100 µE·m−2·s−1). The incubator shaker was adjusted at 110 rpm. Cells of C. reinhardtii (1~2 × 107 cell/mL) were collected in a 50 mL centrifuge tube. The centrifugation was carried out at 6000× g for 5 min to harvest the fresh cells. TAP liquid medium was used to adjust the density of cells and then carried out the transformation. Electroporation method was used for the transformation. After transformation, the cells were placed on TAP plates consisting of zeocin (15 μg/mL) to screen the positive colonies of transformed cells of C. reinhardtii.

2.4. Genomic DNA and RNA Extraction and cDNA Synthesis

In order to conduct genomic DNA and RNA extraction, 50 mL fresh cells of C. reinhardtii after cultivation were harvested by centrifugation at 5000× g for 5 min at 4 °C. Then the cells were frozen in liquid nitrogen and stored at −80 °C for further investigation. Genomic DNA was isolated from the cells of C. reinhardtii CC124 and MYB36-overexpression lines by following the instructions of Plant Genomic DNA extraction kit (Transgene, Shenzhen, China). The total RNA from C. reinhardtii CC124 and MYB36-overexpression lines were extracted by using the Plant RNA Extraction Kit (Trangene, China). Aliquots of 2 µg RNA were used to synthesize the first strand of cDNA by following the instructions of Prime ScriptTM RT reagent Kit with gDNA Eraser (Takara, Dalian, China). The quantity of RNA was examined by using a nanodrop. The quality of RNA was checked using electrophoresis on a 1% agarose gel.

2.5. The Analysis of qPCR and Genomic PCR

The green colonies, which were obtained after transformation, were transferred to a fresh TAP media harboring zeocin (8 µg/mL) and 100 ampicillins (µg/mL), and cultured for 3–5 days. Genomic PCR was carried out to detect the transgenic cells of C. reinhardtii. We have selected 200 transformed cells of C. reinhardtii and confirmed by genomic PCR as previously described.
The genes’ relative expressions were investigated by RT-qPCR in three technical replicates using SYBR Premix Ex Taq GC (Takara, Dalian, China). The cDNA from C. reinhardtii CC124 and MYB36-overexpression lines was diluted (1:20). A total of 20 μL volume per reaction was exploited with specific primer (Table 1). For an internal control, the β-actin gene was used. The relative expressions of genes were calculated as previously described [32]. The pairs of primers used for qRT-PCR in this study are listed in Table 1.

2.6. Measurements of Squalene Contents

For triterpenoid analysis, fresh cells from the C. reinhardtii CC124 strain and MYB36-overexpression lines were harvested. The fresh cells of C. reinhardtii CC124 strain and MYB36-overexpression lines were then cultured (1 × 107/mL) in 50 mL TAP media for 2 days and transferred to a 1 L conical flask containing 400 mL TAP media for optimal growth. The cells of C. reinhardtii CC124 strain and MYB36-overexpression lines were harvested followed by centrifugation at 8000 rmp for 5 min at 4 °C. The collected cells were rinsed once with TAP medium and sterilized distilled water, snap frozen, and stored at −80 °C. The collected cells of each treatment were freeze-dried, and the dry weights were recorded. The extraction and analysis of squalene were performed by GCMS. Squalene was (Sigma-Aldrich, St. Louis, MO, USA) used as an internal control. The squalene samples were analyzed on Thermo Fisher TRACE GC1300 MS ISQ LT equipped with Thermo Fisher TG-5ms 30 × 0.25 mm × 0.25 µm column (Thermo Fisher Scientific, Waltham, MA, USA). Helium was used as a carrier gas with a flow rate of 0.8 mL/min. Injection volume was 2 μL with 300 °C and split ratio was 40:1. Mass spectrometry was performed in an electron impact approach at an ionization voltage of 70 eV. The ion source temperature was 230 °C. The squalene was identified in samples by its relevant retention time.

2.7. Statistical Analysis

Three biological replications of each treatment were carried out for this study. The results are indicated as standard deviation (SD). The difference of significance was analyzed by using one-way ANOVA. The statistical significance was represented by p < 0.05 or p < 0.01.

3. Results

3.1. The Design Expression Cassette of MYB36

The full-length CDS sequence of MYB36 (KF059390.1) was acquired from the National Center for Biotechnology Information (NCBI) website. MYB36 transcriptional factors for heterologous overexpression in C. reinhardtii CC124 were synthetically redesigned by codon optimization to improve transgene expression, as previously described [33]. After codon optimization, the MYB gene’s GC contents increased from 48% to 65% (Figure 2). The MYB36 gene was then inserted into the vector in order to obtain the RPL23-SmMYB-RPL23-ble plasmid (Figure 2).

3.2. The Screening of Transgenic Strain of C. reinhardtii

The RPL23-SmMYB98-RPL23-ble plasmid was transformed into the cells of C. reinhardtii using the electroporation method. After 14 days of recovery, we have observed visible green colonies of transformed cells of C. reinhardtii and we then transferred them to fresh TAP media containing 100 µg/mL ampicillin and 8 µg/mL zeocin. We have obtained more than 200 colonies and a frequency of transformation (3 × 10−8) was noticed. After that, in order to screen positive transformants, genomic PCR targeting the MYB36 gene was carried out. According to PCR results, no target bands were obtained in non-transgenic cells of C. reinhardtii (Figure S1).

3.3. MYB36 Transcriptional Factors Upregulate the MEP Biosynthetic Pathway in Overexpression Lines of C. reinhardtii

As MYB transcriptional factors have a critical role in the production of terpenoids in plants, we hypothesized that our candidate MYB36 gene stimulates the biosynthesis of terpenoid precursors in the cells of C. reinhardtii. The general building blocks of entire terpenoids are isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). In C. reinhardtii, these precursors are uniquely synthesized by the MEP pathway, while the MVA biosynthetic pathway is absent in C. reinhardtii [34]. So, transcript levels of key structural genes involved in the MEP pathway were assessed in MYB36-overexpression lines by qPCR analysis. The transcript level of gene encoding enzymes CrDXS, CrDXR, CrGPS, CrGPPS, CrFPS, CrFPPS, CrIPP2, CrIPP1, CrIDS, CrCMS, and CrCMK were investigated by qPCR (Figure 3). The outcomes from this study indicated that the expression levels of the above-mentioned genes were higher than the wild type of C. reinhardtii CC124. DXS and DXR play a key function in the regulation of flux in the MEP pathway of land plants [35]. Overexpression of DXS accumulates in the isoprenoid production in transgenic Arabidopsis, suggesting that DXS catalyzes one of the rate-limiting steps involved in the biosynthetic pathway of MEP [36]. DXR and HDR are other enzymes that play a function as rate-limiting factors in the formation of IPP and DMAPP [37]. Recently, investigations on DXS have attained more attention in order to modify terpenoid metabolisms. Methyl jasmonate (MeJ)-treated C. reinhardtii cells increase in the expression of DXS leading to an increase in the triterpenoid squalene synthesis [38]. Heterologous overexpression of Salvia pomifera DXS in C. reinhardtii improved flux toward diterpenoid production via the MEP biosynthetic pathway [24]. MEP plays a crucial function in the regulation of the MEP biosynthetic pathway. The MEP is the initial obligated precursor of the pathway and triggers the MDS gene transcript level [39]. The change in metabolism regarding the IPP production implies a promising accumulation of geranyl pyrophosphate (GPP) and farnesyl pyrophosphate (FPP) in the MYB36-overexpression lines. The expression levels of FPP and GGPP were remarkably higher in the MYB36-overexpression C. reinhardtii lines compared to parent lines. Our results were similar to the previous study, which indicated that the accumulation of GGPP expression in MeJ-treated cells of C. reinhardtii improved the terpenoid production [38]. The incidence of a metabolic change toward the production of triterpenoids, such as squalene, is also supported by the accumulation of FPP.

3.4. MYB 36 Affect the Endogenous Squalene Biosynthetic Pathway Genes

To check the functional characterization of the MYB36 transcriptional factor in the squalene biosynthesis, the R2R3-MYB36 gene was overexpressed in the cells of C. reinhardtii. A plasmid, which is used for the overexpression of the R2R3-MYB36 gene, consisting of the coding region of the R2R3-MYB36 gene under the control of the constitutive RPL23 promoter in C. reinhardtii CC124 strain, was appropriate for the effective and stable expression of foreign genes. qRT-PCR was carried out to check the total expression levels of endogenous CrSQS. Expression levels of CrSQS were higher in the MYB36-overexpression lines compared to the wild type C. reinhardtii CC124 strain (Figure 4A).

3.5. Accumulation of Squalene on MYB-Overexpression Lines

The membranes of C. reinhardtii consist of sterols. They are produced from squalene by a pathway similar to higher plants [40]. Squalene (C30 precursor of triterpenoids) is the product of the condensation of two FPP molecules. The determination of squalene was determined by the GC-MS method from the harvested cells of MYB36-overexpressed lines of C. reinhardtii and wild type strain C. reinhardtii CC124 (Figure 4 and Figure S1). The peak with a retention time of 15.61 is the squalene (Figure 5). The squalene contents determined in the MYB36-overexpreesed lines (OE-1, OE-2, and OE-3) were 93.20, 52, and 80 μg/g, respectively. The squalene contents were higher in MYB36-overexpreesed lines compared to wild type strain C. reinhardtii CC124 (Figure 4B). The squalene’s increasing contents were correlated with the improved accumulation of the CrSQS encoding gene. The accumulation of SQS transcript levels led to the increase in the squalene contents, as previously described [41]. The entire sterol biosynthetic pathway upregulation could indicate higher levels of the intermediate upstream of squalene.

4. Discussion

The MYB TFs are a large transcriptional family found in plants and play an important role in the regulation of plant secondary metabolites and other functions [42,43]. In previous studies, some MYB TFs have been described, which play key roles in the regulation of terpenoid biosynthesis in plants [44,45] and green microalga [29,46]. In Tripterygium wilfordii, BpMYB21 TFs are involved in the regulation of squalene through the upregulation of squalene epoxidase a and Cycloartenol synthesis [47]. CiMYB42 TFs from citrus regulate the triterpenoids and transcript level of SQS involved in squalene synthesis [48]. By comparison, evidence on the transcriptional regulation of triterpenoids synthesis by MYB TFs in C. reinhardtii is extremely limited.
In the current study, we have investigated the role of heterologous overexpression of MYB36 in the regulation of triterpenoids in C. reinhardtii and its effect on the upstream and downstream of the MEP pathway and its derivative biosynthetic pathway. We have obtained the R2R3 MYB36 (KF059390.1) TFs from the National Center for Biotechnology Information (NCBI) website. R2R3 MYB TFs belong to the medicinal plant Salvia miltiorrhiza. S. miltiorrhiza contains various biologically active compounds, which have great potential to treat different diseases, including cerebrovascular diseases and others [49]. MYB36 showed an imperative role in the regulation of terpenoids, especially tanshinones and phenolic acid [49].
In order to improve transgene expression, MYB36 transcriptional factors were redesigned synthetically by codon optimization for heterologous expression in C. reinhardtii, as previously described [33]. After codon optimization, the MYB gene’s GC contents increased from 48% to 65%. In order to analyze the foreign transcriptional factor, R2R3-MYB36 overexpressed in C. reinhardtii. We have found that the genes encoding for the upstream MEP biosynthetic pathway, including CrDXS, CrDXR, CrCMS, CrCMK, Cr. HDS, and Cr. HDR genes, were upregulated in the MYB36-overexpression lines. Previously similar studies showed that SmMYB97 TFs belong to the medicinal plant S. miltiorrhiza and affect the MEP biosynthetic encoding genes in its overexpression lines [27]. SmMYB98 TFs also upregulate upstream MEP biosynthetic encoding genes in transgenic lines [28]. In higher plants, DXS and DXR have a significant task in the regulation of flux in the MEP pathway [35]. Overexpression of DXS accumulated the isoprenoid production in transgenic Arabidopsis, suggesting that catalyzing of DXS is one of the rate-limiting steps involved in the MEP biosynthetic pathway [36]. DXR and HDR are other enzymes that play a function as rate-limiting factors in the formation of IPP and DMAPP [37]. Recently, investigations on DXS have attained more attention in order to modify terpenoid metabolisms. Methyl jasmonate (MeJ)-treated C. reinhardtii cells increase the expression of DXS leading to increase the triterpenoids’ squalene synthesis [38]. Heterologous overexpression of DXS from S. pomifera in C. reinhardtii improved flux toward diterpenoid production via the MEP biosynthetic pathway [24]. MEP plays a crucial function in the control of the MEP biosynthetic pathway. MEP triggers the MDS gene expression, which is the initial obligated precursor of the pathway [39]. MYB36-overexpression lines may accumulate geranyl pyrophosphate (GPP) and farnesyl pyrophosphate (FPP) as a result of an altered metabolism toward IPP. The expression levels of FPP and GGPP were significantly higher in the MYB36-overexpression C. reinhardtii lines compared to parent lines. Our results were similar with a previous study, which indicated that accumulation of GGPP expression in MeJ-treated cells of C. reinhardtii improved the terpenoid production [38].
The FPP (C15) is formed by the condensation of IPP and DMAPP. FPP (C15) further transformed into the squalene (C30 triterpenoid precursor), which was catalyzed by squalene synthase (SQS). The first precursor of triterpenoids is squalene. SQS is positioned at a key branch point and entertains as a switch. Therefore, SQS has a potential regulatory role in the synthesis of triterpenoids [50]. In our study, the squalene contents in the MYB36-overexpreesed lines (OE-32, OE-35, and OE-36) were 93.20, 52, and 80 μg/g, respectively, and were higher in MYB36-overexpreesed lines compared to wild type strain C. reinhardtii CC124. The squalene’s increasing contents was correlated with the improved accumulation of the CrSQS encoding gene. The accumulation of CrSQS transcript level leads to an increase in the squalene contents, as previously described [41]. The previous study showed that CiMYB42 regulates the CiSQS gene [50].

5. Conclusions

Most commercially available terpenoids are obtained from higher plants, but their cost-effective and sustainable production for industrial purposes is still challenging because of their low abundance production from natural sources, extraction and purification obstacles, and degree of labor intensity. In this study, we have redesigned and codon-optimized the MYB36 TFs by using the advanced synthetic biotechnology approaches and heterologous overexpressed in C. reinhardtii CC124 in order to analyze its potential role in triterpenoid biosynthesis for the first time. We have found that MYB36 TFs positively affect the MEP biosynthetic pathway encoding genes in MYB36-overexpressed lines compared to the wild type of C. reinhardtii strain CC124. The first precursor of triterpenoids is squalene. Our results showed that the transcript level of CrSQS involved in squalene synthesis increased, and ultimately led to an increase in the contents of squalene in MYB36-overexpressed lines of C. reinhardtii. So, MYB36 TFs also trigger the accumulation of the downstream pathway of triterpenoid biosynthesis genes. Our study provides new insights into the heterologous overexpression system of transcriptional factors in microalgae to modified and metabolic engineering in triterpenoid biosynthesis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pr12030487/s1, Figure S1. Concentration of Squalene in WT type (CC124) and MYB36 Overexpression lines (MYB36-OE1 and OE2).

Author Contributions

Conceptualization, Z.H.; Methodology, M.A.; Software, M.A.; Validation, Z.H.; Formal analysis, M.A., J.W., J.L. and M.M.A.; Investigation, J.L.; Data curation, M.A.; Writing—original draft, M.A. and Z.H.; Writing—review & editing, M.A.; Project administration, Z.H.; Funding acquisition, Z.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Chinese National Key R&D Project for Synthetic Biology (2018FA0902500). National Science Foundation of China (32273118), The Guangdong Key R&D Project (2022B11111070005). Shenzhen Special Fund for Sustainable Development (KCXFZ20211102164013021) and Shenzhen University 2035 Program for Excellent Research (2022B010) to Z.H.

Data Availability Statement

Data will be available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Onyeaka, H.; Miri, T.; Obileke, K.; Hart, A.; Anumudu, C.; Al-Sharify, Z.T. Minimizing carbon footprint via microalgae as a biological capture. Carbon Capture Sci. Technol. 2021, 1, 100007. [Google Scholar] [CrossRef]
  2. Blas-Valdivia, V.; Ortiz-Butrón, R.; Pineda-Reynoso, M.; Hernández-Garcia, A.; Cano-Europa, E. Chlorella vulgaris administration prevents HgCl 2-caused oxidative stress and cellular damage in the kidney. J. Appl. Phycol. 2011, 23, 53–58. [Google Scholar] [CrossRef]
  3. Torres-Tiji, Y.; Fields, F.J.; Mayfield, S.P. Microalgae as a future food source. Biotechnol. Adv. 2020, 41, 107536. [Google Scholar] [CrossRef] [PubMed]
  4. Singh, S.; Saha, P.; Rai, N.; Kumari, S.; Pandey-Rai, S. Unravelling triterpenoid biosynthesis in plants for applications in bioengineering and large-scale sustainable production. Ind. Crops Prod. 2023, 199, 116789. [Google Scholar] [CrossRef]
  5. Vickers, C.E.; Williams, T.C.; Peng, B.; Cherry, J. Recent advances in synthetic biology for engineering isoprenoid production in yeast. Curr. Opin. Chem. Biol. 2017, 40, 47–56. [Google Scholar] [CrossRef]
  6. Vickers, C.E.; Behrendorff, J.B.; Bongers, M.; Brennan, T.C.; Bruschi, M.; Nielsen, L.K. Production of industrially relevant isoprenoid compounds in engineered microbes. In Microorganisms in Biorefineries; Springer: Berlin/Heidelberg, Germany, 2015; pp. 303–334. [Google Scholar]
  7. Masi, A.; Leonelli, F.; Scognamiglio, V.; Gasperuzzo, G.; Antonacci, A.; Terzidis, M.A. Chlamydomonas reinhardtii: A factory of nutraceutical and food supplements for human health. Molecules 2023, 28, 1185. [Google Scholar] [CrossRef] [PubMed]
  8. Yahya, R.Z.; Wellman, G.B.; Overmans, S.; Lauersen, K.J. Engineered production of isoprene from the model green microalga Chlamydomonas reinhardtii. Metab. Eng. Commun. 2023, 16, e00221. [Google Scholar] [CrossRef]
  9. Sun, J.; Xu, X.; Wu, Y.; Sun, H.; Luan, G.; Lu, X. Conversion of carbon dioxide into valencene and other sesquiterpenes with metabolic engineered Synechocystis sp. PCC 6803 cell factories. GCB Bioenergy 2023, 15, 1154–1165. [Google Scholar] [CrossRef]
  10. Xie, Z.; He, J.; Peng, S.; Zhang, X.; Kong, W. Biosynthesis of protein-based drugs using eukaryotic microalgae. Algal Res. 2023, 74, 103219. [Google Scholar] [CrossRef]
  11. Spanova, M.; Daum, G. Squalene–biochemistry, molecular biology, process biotechnology, and applications. Eur. J. Lipid Sci. Technol. 2011, 113, 1299–1320. [Google Scholar] [CrossRef]
  12. Ibrahim, N.I.; Fairus, S.; Zulfarina, M.S.; Naina Mohamed, I. The efficacy of squalene in cardiovascular disease risk-a systematic review. Nutrients 2020, 12, 414. [Google Scholar] [CrossRef] [PubMed]
  13. Kim, S.-K.; Karadeniz, F. Biological importance and applications of squalene and squalane. Adv. Food Nutr. Res. 2012, 65, 223–233. [Google Scholar]
  14. Pacetti, D.; Scortichini, S.; Boarelli, M.C.; Fiorini, D. Simple and rapid method to analyse squalene in olive oils and extra virgin olive oils. Food Control 2019, 102, 240–244. [Google Scholar] [CrossRef]
  15. Nocito, F.; Labrador Garcia, A. Towards New Sustainable Squalene Resources: Extraction from Apulian “Aged Extra-Virgin Olive Oil Sludge”(AEVOO-S). A Comparison Between Organic Solvent and Supercritical Fluid Techniques. Waste Biomass Valorization 2023, 14, 2275–2284. [Google Scholar] [CrossRef]
  16. Acosta-Martínez, V.; Burow, G.; Zobeck, T.; Allen, V. Soil microbial communities and function in alternative systems to continuous cotton. Soil Sci. Soc. Am. J. 2010, 74, 1181–1192. [Google Scholar] [CrossRef]
  17. Waterman, E.; Lockwood, B. Active components and clinical applications of olive oil. Altern. Med. Rev. 2007, 12, 331–342. [Google Scholar]
  18. Song, X.; Wang, X.; Tan, Y.; Feng, Y.; Li, W.; Cui, Q. High production of squalene using a newly isolated yeast-like strain Pseudozyma sp. SD301. J. Agric. Food Chem. 2015, 63, 8445–8451. [Google Scholar] [CrossRef]
  19. Paramasivan, K.; Mutturi, S. Recent advances in the microbial production of squalene. World J. Microbiol. Biotechnol. 2022, 38, 91. [Google Scholar] [CrossRef]
  20. Bhattacharjee, P.; Shukla, V.; Singhal, R.; Kulkarni, P. Studies on fermentative production of squalene. World J. Microbiol. Biotechnol. 2001, 17, 811–816. [Google Scholar] [CrossRef]
  21. Nakazawa, A.; Matsuura, H.; Kose, R.; Kato, S.; Honda, D.; Inouye, I.; Kaya, K.; Watanabe, M.M. Optimization of culture conditions of the thraustochytrid Aurantiochytrium sp. strain 18W-13a for squalene production. Bioresour. Technol. 2012, 109, 287–291. [Google Scholar] [CrossRef] [PubMed]
  22. Hong, W.K.; Heo, S.Y.; Park, H.M.; Kim, C.H.; Sohn, J.H.; Kondo, A.; Seo, J.W. Characterization of a squalene synthase from the thraustochytrid microalga Aurantiochytrium sp. krs101. J. Microbiol. Biotechnol. 2013, 23, 759–765. [Google Scholar] [CrossRef] [PubMed]
  23. Lohr, M.; Schwender, J.; Polle, J.E. Isoprenoid biosynthesis in eukaryotic phototrophs: A spotlight on algae. Plant Sci. 2012, 185–186, 9–22. [Google Scholar] [CrossRef] [PubMed]
  24. Lauersen, K.J.; Wichmann, J.; Baier, T.; Kampranis, S.C.; Pateraki, I.; Møller, B.L.; Kruse, O. Phototrophic production of heterologous diterpenoids and a hydroxy-functionalized derivative from Chlamydomonas reinhardtii. Metab. Eng. 2018, 49, 116–127. [Google Scholar] [CrossRef]
  25. Davies, F.K.; Jinkerson, R.E.; Posewitz, M.C. Toward a photosynthetic microbial platform for terpenoid engineering. Photosynth. Res. 2015, 123, 265–284. [Google Scholar] [CrossRef] [PubMed]
  26. Mahjoub, A.; Hernould, M.; Joubès, J.; Decendit, A.; Mars, M.; Barrieu, F.; Hamdi, S.; Delrot, S. Overexpression of a grapevine R2R3-MYB factor in tomato affects vegetative development, flower morphology and flavonoid and terpenoid metabolism. Plant Physiol. Biochem. 2009, 47, 551–561. [Google Scholar] [CrossRef]
  27. Li, L.; Wang, D.; Zhou, L.; Yu, X.; Yan, X.; Zhang, Q.; Li, B.; Liu, Y.; Zhou, W.; Cao, X.; et al. JA-responsive transcription factor SmMYB97 promotes phenolic acid and tanshinone accumulation in Salvia miltiorrhiza. J. Agric. Food Chem. 2020, 68, 14850–14862. [Google Scholar] [CrossRef]
  28. Hao, X.; Pu, Z.; Cao, G.; You, D.; Zhou, Y.; Deng, C.; Shi, M.; Nile, S.H.; Wang, Y.; Zhou, W.; et al. Tanshinone and salvianolic acid biosynthesis are regulated by SmMYB98 in Salvia miltiorrhiza hairy roots. J. Adv. Res. 2020, 23, 1–12. [Google Scholar] [CrossRef]
  29. He, Y.; Li, M.; Wang, Y.; Shen, S. The R2R3-MYB transcription factor MYB44 modulates carotenoid biosynthesis in Ulva prolifera. Algal Res. 2022, 62, 102578. [Google Scholar] [CrossRef]
  30. Kong, F.; Yamasaki, T.; Ohama, T. Expression levels of domestic cDNA cassettes integrated in the nuclear genomes of various Chlamydomonas reinhardtii strains. J. Biosci. Bioeng. 2014, 117, 613–616. [Google Scholar] [CrossRef]
  31. Pandit, J.; Danley, D.E.; Schulte, G.K.; Mazzalupo, S.; Pauly, T.A.; Hayward, C.M.; Hamanaka, E.S.; Thompson, J.F.; Harwood, H.J. Crystal structure of human squalene synthase: A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 2000, 275, 30610–30617. [Google Scholar] [CrossRef]
  32. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
  33. Li, A.; Huang, R.; Wang, C.; Hu, Q.; Li, H.; Li, X. Expression of anti-lipopolysaccharide factor isoform 3 in Chlamydomonas reinhardtii showing high antimicrobial activity. Mar. Drugs 2021, 19, 239. [Google Scholar] [CrossRef] [PubMed]
  34. Lange, B.M.; Rujan, T.; Martin, W.; Croteau, R. Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes. Proc. Natl. Acad. Sci. USA 2000, 97, 13172–13177. [Google Scholar] [CrossRef] [PubMed]
  35. Vranová, E.; Coman, D.; Gruissem, W. Network analysis of the MVA and MEP pathways for isoprenoid synthesis. Annu. Rev. Plant Biol. 2013, 64, 665–700. [Google Scholar] [CrossRef]
  36. Estévez, J.M.; Cantero, A.; Reindl, A.; Reichler, S.; León, P. 1-Deoxy-D-xylulose-5-phosphate synthase, a limiting enzyme for plastidic isoprenoid biosynthesis in plants. J. Biol. Chem. 2001, 276, 22901–22909. [Google Scholar] [CrossRef] [PubMed]
  37. Cordoba, E.; Salmi, M.; León, P. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants. J. Exp. Bot. 2009, 60, 2933–2943. [Google Scholar] [CrossRef] [PubMed]
  38. Commault, A.S.; Fabris, M.; Kuzhiumparambil, U.; Adriaans, J.; Pernice, M.; Ralph, P.J. Methyl jasmonate treatment affects the regulation of the 2-C-methyl-D-erythritol 4-phosphate pathway and early steps of the triterpenoid biosynthesis in Chlamydomonas reinhardtii. Algal Res. 2019, 39, 101462. [Google Scholar] [CrossRef]
  39. Banerjee, A.; Sharkey, T. Methylerythritol 4-phosphate (MEP) pathway metabolic regulation. Nat. Prod. Rep. 2014, 31, 1043–1055. [Google Scholar] [CrossRef]
  40. Brumfield, K.M.; Laborde, S.M.; Moroney, J.V. A model for the ergosterol biosynthetic pathway in Chlamydomonas reinhardtii. Eur. J. Phycol. 2017, 52, 64–74. [Google Scholar] [CrossRef]
  41. Kajikawa, M.; Kinohira, S.; Ando, A.; Shimoyama, M.; Kato, M.; Fukuzawa, H. Accumulation of squalene in a microalga Chlamydomonas reinhardtii by genetic modification of squalene synthase and squalene epoxidase genes. PLoS ONE 2015, 10, e0120446. [Google Scholar] [CrossRef]
  42. Anwar, M.; Duan, S.; Ma, M.; Chen, X.; Wu, L.; Zeng, L. NataMYB4, a flower specific gene, regulates the flavonoid biosynthesis in Chinese Narcissus. Sci. Hortic. 2023, 318, 112101. [Google Scholar] [CrossRef]
  43. Anwar, M.; Chen, L.; Xiao, Y.; Wu, J.; Zeng, L.; Li, H.; Wu, Q.; Hu, Z. Recent advanced metabolic and genetic engineering of phenylpropanoid biosynthetic pathways. Int. J. Mol. Sci. 2021, 22, 9544. [Google Scholar] [CrossRef]
  44. Yin, J.; Li, X.; Zhan, Y.; Li, Y.; Qu, Z.; Sun, L.; Wang, S.; Yang, J.; Xiao, J. Cloning and expression of BpMYC4 and BpbHLH9 genes and the role of BpbHLH9 in triterpenoid synthesis in birch. BMC Plant Biol. 2017, 17, 214. [Google Scholar] [CrossRef]
  45. Wei, J.; Yang, Y.; Peng, Y.; Wang, S.; Zhang, J.; Liu, X.; Liu, J.; Wen, B.; Li, M. Biosynthesis and the Transcriptional Regulation of Terpenoids in Tea Plants (Camellia sinensis). Int. J. Mol. Sci. 2023, 24, 6937. [Google Scholar] [CrossRef]
  46. Thiriet-Rupert, S.; Carrier, G.; Trottier, C.; Eveillard, D.; Schoefs, B.; Bougaran, G.; Cadoret, J.-P.; Chénais, B.; Saint-Jean, B. Identification of transcription factors involved in the phenotype of a domesticated oleaginous microalgae strain of Tisochrysis lutea. Algal Res. 2018, 30, 59–72. [Google Scholar] [CrossRef]
  47. Xia, M.; Tu, L.; Liu, Y.; Jiang, Z.; Wu, X.; Gao, W.; Huang, L. Genome-wide analysis of MYB family genes in Tripterygium wilfordii and their potential roles in terpenoid biosynthesis. Plant Direct 2022, 6, e424. [Google Scholar] [CrossRef] [PubMed]
  48. Zhang, P.; Liu, X.; Yu, X.; Wang, F.; Long, J.; Shen, W.; Jiang, D.; Zhao, X. The MYB transcription factor CiMYB42 regulates limonoids biosynthesis in citrus. BMC Plant Biol. 2020, 20, 254. [Google Scholar] [CrossRef] [PubMed]
  49. Ding, K.; Pei, T.; Bai, Z.; Jia, Y.; Ma, P.; Liang, Z. SmMYB36, a novel R2R3-MYB transcription factor, enhances tanshinone accumulation and decreases phenolic acid content in Salvia miltiorrhiza hairy roots. Sci. Rep. 2017, 7, 5104. [Google Scholar] [CrossRef] [PubMed]
  50. Fu, J.; Liu, G.; Yang, M.; Wang, X.; Chen, X.; Chen, F.; Yang, Y. Isolation and functional analysis of squalene synthase gene in tea plant Camellia sinensis. Plant Physiol. Biochem. 2019, 142, 53–58. [Google Scholar] [CrossRef] [PubMed]
Processes 12 00487 g001
Figure 1. Proposed model for heterologous overexpression of MYB transcriptional factors in C. reinhardtii. Role of MYB TFs affect the MEP biosynthetic pathway, indicated in pink box, and the downstream biosynthesis of triterpenoids are indicated by sky blue box.
Figure 1. Proposed model for heterologous overexpression of MYB transcriptional factors in C. reinhardtii. Role of MYB TFs affect the MEP biosynthetic pathway, indicated in pink box, and the downstream biosynthesis of triterpenoids are indicated by sky blue box.
Processes 12 00487 g001
Processes 12 00487 g002
Figure 2. The alignment between the original codon and codon-optimized MYB36 gene. Ori MYB36 denotes the original codon of MYB36 gene, while Opt MYB36 denotes the optimized MYB36 gene (A). Plasmid construction and screening of transformation (B).
Figure 2. The alignment between the original codon and codon-optimized MYB36 gene. Ori MYB36 denotes the original codon of MYB36 gene, while Opt MYB36 denotes the optimized MYB36 gene (A). Plasmid construction and screening of transformation (B).
Processes 12 00487 g002
Processes 12 00487 g003
Figure 3. Heterologous overexpression of MYB36 TF gene in C. reinhardtii. MYB36 TFs affect the MEP biosynthetic pathway encoding genes. CC124 is the wild type of C. reinhardtii and MY36-OE are the transgenic lines of C. reinhardtii. The error bars stand for the SE of three biological replicates.
Figure 3. Heterologous overexpression of MYB36 TF gene in C. reinhardtii. MYB36 TFs affect the MEP biosynthetic pathway encoding genes. CC124 is the wild type of C. reinhardtii and MY36-OE are the transgenic lines of C. reinhardtii. The error bars stand for the SE of three biological replicates.
Processes 12 00487 g003
Processes 12 00487 g004
Figure 4. Overexpression of MYB36 TF gene in C. reinhardtii squalene biosynthesis. CC124 is the wild type of C. reinhardtii and MY36-OE32, 35, and 36 are the transgenic lines of C. reinhardtii. The error bars stand for the SE of three biological replicates. (A) The expression level of CrSQS. (B) The contents of squalene μg/g.
Figure 4. Overexpression of MYB36 TF gene in C. reinhardtii squalene biosynthesis. CC124 is the wild type of C. reinhardtii and MY36-OE32, 35, and 36 are the transgenic lines of C. reinhardtii. The error bars stand for the SE of three biological replicates. (A) The expression level of CrSQS. (B) The contents of squalene μg/g.
Processes 12 00487 g004
Processes 12 00487 g005
Figure 5. Concentration of squalene in MYB36-overexpression lines. The peak with 15.61 retention time is the squalene.
Figure 5. Concentration of squalene in MYB36-overexpression lines. The peak with 15.61 retention time is the squalene.
Processes 12 00487 g005
Table 1. List of primers used in this study.
Table 1. List of primers used in this study.
GenesForward (5′-3′)Reverse (5′-3′)
CrDXSGACGGTGGCTATGCACTATGGAAATCGAGGTGGAGCTGTG
CrDXRCCATCTTCCAGGTGATGCAGCCAGACCCTTGTTCATGAGTG
CrCMSGCACTACTGCTCCTACCAAGGAACGTCTCCAGCGAGTATG
CrCMKACGCTGCAGACCATGTACTAGTTGGAGAAGAAGACCGAGATG
CrMECPSCTCTGTGCCTCCCAGACATCGTTGCGGATGTTCTCCTTGTG
CHDSGCTGATTGAGGAGACCTTACGCAGAAGACGAAGTTGTGGTAG
CrHDRCTGACTGACTTCAAGGAGAAGGGATGTAGTTGGAGGCGAAGG
CrIPPITCCTCCTTCTCCTTCCTCACGCCATCATGGACTGAAGCTC
CrIPP2TTCCGCAACAAGGGATTCAGGAACCAGACCGTGTAGTCCT
CrGPSGTGCTGTCGCTCAATACCAGAGTAGGTCTTGGCCAGGTAG
CrFPSCCGAGGATGAGGTGTTCAAGCGCTTGAGGATGGAGTAGATG
CrGGPSCCATGGACAACGACGACTTCTTGCCCAGCTCCATGATTAC
CrSQSTGGCAGCATGCTACAACAACGAACTGCAGGAACCAGGTGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Anwar, M.; Wang, J.; Li, J.; Altaf, M.M.; Hu, Z. MYB Transcriptional Factors Affects Upstream and Downstream MEP Pathway and Triterpenoid Biosynthesis in Chlamydomonas reinhardtii. Processes 2024, 12, 487. https://doi.org/10.3390/pr12030487

AMA Style

Anwar M, Wang J, Li J, Altaf MM, Hu Z. MYB Transcriptional Factors Affects Upstream and Downstream MEP Pathway and Triterpenoid Biosynthesis in Chlamydomonas reinhardtii. Processes. 2024; 12(3):487. https://doi.org/10.3390/pr12030487

Chicago/Turabian Style

Anwar, Muhammad, Jingkai Wang, Jiancheng Li, Muhammad Mohsin Altaf, and Zhangli Hu. 2024. "MYB Transcriptional Factors Affects Upstream and Downstream MEP Pathway and Triterpenoid Biosynthesis in Chlamydomonas reinhardtii" Processes 12, no. 3: 487. https://doi.org/10.3390/pr12030487

APA Style

Anwar, M., Wang, J., Li, J., Altaf, M. M., & Hu, Z. (2024). MYB Transcriptional Factors Affects Upstream and Downstream MEP Pathway and Triterpenoid Biosynthesis in Chlamydomonas reinhardtii. Processes, 12(3), 487. https://doi.org/10.3390/pr12030487

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop