Lactobacillus plantarum MA2 Ameliorates Methionine and Choline-Deficient Diet Induced Non-Alcoholic Fatty Liver Disease in Rats by Improving the Intestinal Microecology and Mucosal Barrier
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strain and Culture Conditions
2.2. Animal Treatment and Sample Collection
2.3. Histological Observation and Evaluation
2.4. Detection of Biomarkers in Serum
2.5. RNA Extraction and Real-Time PCR
2.6. Detection of Protein Expression
2.7. Analysis of the Intestinal Microbiota Diversity
2.8. Statistical Analysis
3. Results
3.1. Lactobacillus Plantrum MA2 Improved the Phenotype and Lipid Metabolism of the MCD-Induced NAFLD Rats
3.2. L. plantarum MA2 Improved Liver Lipid Deposition and Pathological Damage Caused by NAFLD
3.3. L. plantarum MA2 Protects the Rat Intestinal Mucosal Barrier System
3.4. Lactobacillus Plantrum MA2 has a Significant Regulating Effect on the Intestinal Microbiota
3.5. L. plantarum MA2 Reduces Liver Inflammation by Down-Regulating the Expression of Inflammation-Related Pathway Proteins
4. Discussion
4.1. L. plantrum MA2 Can Improve Lipid Metabolism and Relieve Liver Fat Accumulation and Liver Pathological Damage in MCD-Induced NAFLD Rats
4.2. L. plantarum MA2 Reduces Liver Inflammation by Acting on the LPS/TLR4 Inflammatory Pathway
4.3. L. plantarum MA2 Works by Improving the Structure of the Intestinal Microbiota and the Barrier of the Intestinal Mucosa
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Ethics Statement
References
- Chalasani, N.; Younossi, Z.; Lavine, J.E.; Charlton, M.; Cusi, K.; Rinella, M.; Harrison, S.A.; Brunt, E.M.; Sanyal, A.J. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the study of liver diseases. Hepatology 2018, 67, 328–357. [Google Scholar] [CrossRef]
- Borrelli, A.; Bonelli, P.; Tuccillo, F.M.; Goldfine, I.D.; Evans, J.L.; Buonaguro, F.M.; Mancini, A. Role of gut microbiota and oxidative stress in the progression of non-alcoholic fatty liver disease to hepatocarcinoma: Current and innovative therapeutic approaches. Redox Biol. 2018, 15, 467–479. [Google Scholar] [CrossRef]
- Rinella, M.E. Nonalcoholic fatty liver disease: A systematic review. JAMA 2015, 313, 2263–2273. [Google Scholar] [CrossRef]
- Zelber-Sagi, S.; Godos, J.; Salomone, F. Lifestyle changes for the treatment of nonalcoholic fatty liver disease: A review of observational studies and intervention trials. Therap. Adv. Gastroenterol. 2016, 9, 392–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- European Association for the Study of the Liver (EASL); European Association for the Study of Diabetes (EASD); European Association for the Study of Obesity (EASO). EASL-EASD-EASO clinical practice guidelines for the management of non-alcoholic fatty liver disease. Obes. Facts 2016, 9, 65–90. [Google Scholar] [CrossRef] [Green Version]
- Leung, C.; Rivera, L.; Furness, J.B.; Angus, P.W. The role of the gut microbiota in NAFLD. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 412–425. [Google Scholar] [CrossRef]
- Aron-Wisnewsky, J.; Warmbrunn, M.V.; Nieuwdorp, M.; Clément, K. Nonalcoholic fatty liver disease: Modulating gut microbiota to improve severity? Gastroenterology 2020, 158, 1881–1898. [Google Scholar] [CrossRef]
- Canfora, E.E.; Meex, R.C.R.; Venema, K.; Blaak, E.E. Gut microbial metabolites in obesity, NAFLD and T2DM. Nat. Rev. Endocrinol. 2019, 15, 261–273. [Google Scholar] [CrossRef]
- Day, C.P.; James, O.F. Steatohepatitis: A tale of two “hits”? Gastroenterology 1998, 114, 842–845. [Google Scholar] [CrossRef]
- Anstee, Q.M.; Goldin, R.D. Mouse models in non-alcoholic fatty liver disease and steatohepatitis research. Int. J. Exp. Pathol. 2006, 87, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Abu-Shanab, A.; Quigley, E.M. The role of the gut microbiota in nonalcoholic fatty liver disease. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 691–701. [Google Scholar] [CrossRef]
- Backhed, F.; Ding, H.; Wang, T.; Hooper, L.V.; Koh, G.Y.; Nagy, A.; Semenkovich, C.F.; Gordon, J.I. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. USA 2004, 101, 15718–15723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rolo, A.P.; Teodoro, J.S.; Palmeira, C.M. Role of oxidative stress in the pathogenesis of nonalcoholic steatohepatitis. Free Radic. Biol. Med. 2012, 52, 59–69. [Google Scholar] [CrossRef]
- Serviddio, G.; Bellanti, F.; Vendemiale, G. Free radical biology for medicine: Learning from nonalcoholic fatty liver disease. Free Radic. Biol. Med. 2013, 65, 952–968. [Google Scholar] [CrossRef] [Green Version]
- Tilg, H.; Moschen, A.R. Evolution of inflammation in nonalcoholic fatty liver disease: The multiple parallel hits hypothesis. Hepatology 2010, 52, 1836–1846. [Google Scholar] [CrossRef]
- Tiniakos, D.G.; Vos, M.B.; Brunt, E.M. Nonalcoholic fatty liver disease: Pathology and pathogenesis. Annu. Rev. Pathol. Mech. Dis. 2010, 5, 145–171. [Google Scholar] [CrossRef] [Green Version]
- Lorbek, G.; Urlep, Z.; Rozman, D. Pharmacogenomic and personalized approaches to tackle nonalcoholic fatty liver disease. Pharmacogenomics 2016, 17, 1273–1288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, R.Y.; Wan, Y.P.; Fang, Q.Y.; Lu, W.; Cai, W. Supplementation with probiotics modifies gut flora and attenuates liver fat accumulation in rat nonalcoholic fatty liver disease model. J. Clin. Biochem. Nutr. 2012, 50, 72–77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naudin, C.R.; Maner-Smith, K.; Owens, J.A.; Wynn, G.M.; Robinson, B.S.; Matthews, J.D.; Reedy, A.R.; Luo, L.; Wolfarth, A.A.; Darby, T.M.; et al. Lactococcus lactis subspecies cremoris elicits protection against metabolic changes induced by a western-style diet. Gastroenterology 2020, 159, 639–651. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.; Xing, Z.; Hu, W.; Li, C.; Wang, J.; Wang, Y. Antioxidative effects in vivo and colonization of Lactobacillus plantarum MA2 in the murine intestinal tract. Appl. Microbiol. Biotechnol. 2016, 100, 7193–7202. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, N.; Xi, A.; Ahmed, Z.; Zhang, B.; Bai, X. Effects of Lactobacillus plantarum MA2 isolated from Tibet kefir on lipid metabolism and intestinal microflora of rats fed on high-cholesterol diet. Appl. Microbiol. Biotechnol. 2009, 84, 341–347. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.; Xing, Z.; Li, C.; Wang, J.; Wang, Y. Molecular mechanisms and in vitro antioxidant effects of Lactobacillus plantarum MA2. Food Chem. 2017, 221, 1642–1649. [Google Scholar] [CrossRef] [PubMed]
- Van Herck, M.A.; Vonghia, L.; Francque, S.M. Animal models of nonalcoholic fatty liver disease—A starter's guide. Nutrients 2017, 9, 1072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, D.; Pan, Q.; Xin, F.Z.; Zhang, R.N.; He, C.X.; Chen, G.Y.; Liu, C.; Chen, Y.W.; Fan, J.G. Sodium butyrate attenuates high-fat diet-induced steatohepatitis in mice by improving gut microbiota and gastrointestinal barrier. World J. Gastroenterol. 2017, 23, 60–75. [Google Scholar] [CrossRef]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Nonalcoholic steatohepatitis clinical research network. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef]
- Nasiri-Ansari, Ν.; Dimitriadis, G.K.; Agrogiannis, G.; Perrea, D.; Kostakis, I.D.; Kaltsas, G.; Papavassiliou, A.G.; Randeva, H.S.; Kassi, E. Canagliflozin attenuates the progression of atherosclerosis and inflammation process in APOE knockout mice. Cardiovasc. Diabetol. 2018, 17, 106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhuge, Q.; Zhang, Y.; Liu, B.; Wu, M. Blueberry polyphenols play a preventive effect on alcoholic fatty liver disease C57BL/6 J mice by promoting autophagy to accelerate lipolysis to eliminate excessive TG accumulation in hepatocytes. Ann. Palliat. Med. 2020, 9, 1045–1054. [Google Scholar] [CrossRef]
- Schneider, K.M.; Mohs, A.; Kilic, K.; Candels, L.S.; Elfers, C.; Bennek, E.; Schneider, L.B.; Heymann, F.; Gassler, N.; Penders, J.; et al. Intestinal microbiota protects against MCD diet-induced steatohepatitis. Int. J. Mol. Sci. 2019, 20, 308. [Google Scholar] [CrossRef] [Green Version]
- Rogier, E.W.; Frantz, A.L.; Bruno, M.E.; Wedlund, L.; Cohen, D.A.; Stromberg, A.J.; Kaetzel, C.S. Secretory antibodies in breast milk promote long-term intestinal homeostasis by regulating the gut microbiota and host gene expression. Proc. Natl. Acad. Sci. USA 2014, 111, 3074–3079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neuschwander-Tetri, B.A.; Caldwell, S.H. Nonalcoholic steatohepatitis: Summary of an AASLD single topic conference. Hepatology 2003, 37, 1202–1219. [Google Scholar] [CrossRef]
- Ivanovic, N.; Minic, R.; Djuricic, I.; Skodric, S.R.; Zivkovic, I.; Sobajic, S.; Djordjevic, B. Active Lactobacillus rhamnosus LA68 or Lactobacillus plantarum WCFS1 administration positively influences liver fatty acid composition in mice on a HFD regime. Food Funct. 2016, 7, 2840–2848. [Google Scholar] [CrossRef]
- Ye, H.; Li, Q.; Zhang, Z.; Sun, M.; Zhao, C.; Zhang, T. Effect of a novel potential probiotic Lactobacillus paracasei Jlus66 isolated from fermented milk on nonalcoholic fatty liver in rats. Food Funct. 2017, 8, 4539–4546. [Google Scholar] [CrossRef] [PubMed]
- Chitturi, S.; Wong, V.W.; Farrell, G. Nonalcoholic fatty liver in Asia: Firmly entrenched and rapidly gaining ground. J. Gastroenterol. Hepatol. 2011, 26, 163–172. [Google Scholar] [CrossRef]
- Lonardo, A.; Byrne, C.D.; Caldwell, S.H.; Cortez-Pinto, H.; Targher, G. Global epidemiology of nonalcoholic fatty liver disease: Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 1388–1389. [Google Scholar] [CrossRef] [Green Version]
- Lv, L.X.; Hu, X.J.; Qian, G.R.; Zhang, H.; Lu, H.F.; Zheng, B.W.; Jiang, L.; Li, L.J. Administration of Lactobacillus salivarius LI01 or Pediococcus pentosaceus LI05 improves acute liver injury induced by D-galactosamine in rats. Appl. Microbiol. Biotechnol. 2014, 98, 5619–5632. [Google Scholar] [CrossRef] [PubMed]
- Roh, Y.S.; Seki, E. Toll-like receptors in alcoholic liver disease, non-alcoholic steatohepatitis and carcinogenesis. J. Gastroenterol. Hepatol. 2013, 28, 38–42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ceccarelli, S.; Panera, N.; Mina, M.; Gnani, D.; De Stefanis, C.; Crudele, A.; Rychlicki, C.; Petrini, S.; Bruscalupi, G.; Agostinelli, L.; et al. LPS-induced TNF-alpha factor mediates pro-inflammatory and pro-fibrogenic pattern in non-alcoholic fatty liver disease. Oncotarget 2015, 6, 41434–41452. [Google Scholar] [CrossRef] [Green Version]
- Soares, J.B.; Pimentel-Nunes, P.; Roncon-Albuquerque, R.; Leite-Moreira, A. The role of lipopolysaccharide/toll-like receptor 4 signaling in chronic liver diseases. Hepatol. Int. 2010, 4, 659–672. [Google Scholar] [CrossRef] [Green Version]
- Vahed, S.Z.; Sani, H.M.; Saadat, Y.R.; Barzegari, A.; Omidi, Y. Type 1 diabetes: Through the lens of human genome and metagenome interplay. Biomed. Pharmacother. 2018, 104, 332–342. [Google Scholar] [CrossRef]
- Wigg, A.J.; Roberts-Thomson, I.C.; Dymock, R.B.; McCarthy, P.J.; Grose, R.H.; Cummins, A.G. The role of small intestinal bacterial overgrowth, intestinal permeability, endotoxaemia, and tumour necrosis factor alpha in the pathogenesis of non-alcoholic steatohepatitis. Gut 2001, 48, 206–211. [Google Scholar] [CrossRef] [Green Version]
- Jandhyala, S.M.; Talukdar, R.; Subramanyam, C.; Vuyyuru, H.; Sasikala, M.; Reddy, D.N. Role of the normal gut microbiota. World J. Gastroenterol. 2015, 21, 8787–8803. [Google Scholar] [CrossRef]
- Duarte, S.M.B.; Stefano, J.T.; Oliveira, C.P. Microbiota and nonalcoholic fatty liver disease/nonalcoholic steatohepatitis (NAFLD/NASH). Ann. Hepatol. 2019, 18, 416–421. [Google Scholar] [CrossRef]
- Zhao, Z.; Chen, L.; Zhao, Y.; Wang, C.; Duan, C.; Yang, G.; Niu, C.; Li, S. Lactobacillus plantarum NA136 ameliorates nonalcoholic fatty liver disease by modulating gut microbiota, improving intestinal barrier integrity, and attenuating inflammation. Appl. Microbiol. Biotechnol. 2020, 104, 5273–5282. [Google Scholar] [CrossRef] [PubMed]
- Xiong, W.; Ma, H.; Zhang, Z.; Jin, M.; Wang, J.; Xu, Y.; Wang, Z. The protective effect of icariin and phosphorylated icariin against LPS-induced intestinal goblet cell dysfunction. Innate Immun. 2020, 26, 97–106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mullin, G.E. Article commentary: Intestinal dysbiosis: A possible mechanism of alcohol-induced endotoxemia and alcoholic steatohepatitis in rats. Nutr. Clin. Pract. 2010, 25, 312–313. [Google Scholar] [CrossRef]
- Vrieze, A.; Nood, E.V.; Holleman, F.; Salojarvi, J.; Kootte, R.S.; Bartelsman, J.F.; Dallinga-Thie, G.M.; Ackermans, M.T.; Serlie, M.J.; Oozeer, R.; et al. Transfer of intestinal microbiota from lean donors increases insulin sensitivity in individuals with metabolic syndrome. Gastroenterology 2012, 143, 913–916 e917. [Google Scholar] [CrossRef]
- Li, F.; Duan, K.; Wang, C.; McClain, C.; Feng, W. Probiotics and alcoholic liver disease: Treatment and potential mechanisms. Gastroenterol. Res. Pract. 2016, 2016, 5491465. [Google Scholar] [CrossRef] [Green Version]
- Ruiz, A.G.; Casafont, F.; Crespo, J.; Cayon, A.; Mayorga, M.; Estebanez, A. Fernadez-Escalante JC, Pons-Romero F: Lipopolysaccharide-binding protein plasma levels and liver TNF-alpha gene expression in obese patients: Evidence for the potential role of endotoxin in the pathogenesis of non-alcoholic steatohepatitis. Obes. Surg. 2007, 17, 1374–1380. [Google Scholar] [CrossRef]
- Oshima, T.; Miwa, H.; Joh, T. Aspirin induces gastric epithelial barrier dysfunction by activating p38 MAPK via claudin-7. Am. J. Physiol. Cell Physiol. 2008, 295, C800–C806. [Google Scholar] [CrossRef] [Green Version]
- Kevil, C.G.; Oshima, T.; Alexander, J.S. The role of p38 MAP kinase in hydrogen peroxide mediated endothelial solute permeability. Endothelium 2001, 8, 107–116. [Google Scholar] [CrossRef]
Target Genes | Forward (5’–3’) | Reverse (5’–3’) |
---|---|---|
TNF-α | GACGTGGAACTGGCAGAAGAG | TCTGGAAGCCCCCCATCT |
IL-6 | AGAGGAGACTTCACAGAGGATACC | AATCAGAATTGCCATTGCACAAC |
IL-1β | CTGTGTCTTTCCCGTGGACC | CAGCTCATATGGGTCCGACA |
IL-10 | AGGGCACCCAGTCTGAGAACA | CGGCCTTGCTCTTGTTTTCAC |
MyD88 | TGCGTCTGGTCCATTGCT | TCACATTCCTTGCTTTGC |
TLR4 | CATGAGCGCTGAAGTGGTGA | CGATCGATAATGGTGAGACC |
Claudin-1 | AAAGTGAAGAAGGCCCGTATA | TAATGTTGGTAGGGATCAAAGG |
AP-1 | CTGAAGGGATTGGAGAC | TGGGAGCGACATAGGA |
IL-4 | GCTATTGATGGGTCTCACCC | CAGGACGTCAAGGTACAGGA |
β-actin | TGGGACGATATGGAGAAGAT | ATTGCCGATAGTGATGACCT |
Group | Ace | Chao1 | Shannon | Simpson | Good’s Coverage |
---|---|---|---|---|---|
Normal | 293.11 ± 12.74 | 293.29 ± 14.05 | 5.85 ± 1.01 | 0.95 ± 0.042 | 1 |
NAFLD | 264.93 ± 9.48 # | 273.31 ± 8.94 # | 5.66 ± 0.7 | 0.94 ± 0.053 | 1 |
MA2 | 290.33 ± 5.2 * | 292.78 ± 6.93 * | 5.73 ± 0.49 | 0.94 ± 0.034 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Zhang, Y.; Yang, J.; Li, H.; Wang, J.; Geng, W. Lactobacillus plantarum MA2 Ameliorates Methionine and Choline-Deficient Diet Induced Non-Alcoholic Fatty Liver Disease in Rats by Improving the Intestinal Microecology and Mucosal Barrier. Foods 2021, 10, 3126. https://doi.org/10.3390/foods10123126
Wang Y, Zhang Y, Yang J, Li H, Wang J, Geng W. Lactobacillus plantarum MA2 Ameliorates Methionine and Choline-Deficient Diet Induced Non-Alcoholic Fatty Liver Disease in Rats by Improving the Intestinal Microecology and Mucosal Barrier. Foods. 2021; 10(12):3126. https://doi.org/10.3390/foods10123126
Chicago/Turabian StyleWang, Yanping, Yang Zhang, Jingnan Yang, Haoran Li, Jinju Wang, and Weitao Geng. 2021. "Lactobacillus plantarum MA2 Ameliorates Methionine and Choline-Deficient Diet Induced Non-Alcoholic Fatty Liver Disease in Rats by Improving the Intestinal Microecology and Mucosal Barrier" Foods 10, no. 12: 3126. https://doi.org/10.3390/foods10123126