Next Article in Journal
Dynamic Thermal Properties Estimation Using Sensitivity Coefficients for Rapid Heating Process
Next Article in Special Issue
Traditional Fermented Beverages of Mexico: A Biocultural Unseen Foodscape
Previous Article in Journal
Consumer Preferences and Socioeconomic Factors Decided on Plantain and Plantain-Based Products in the Central Region of Cameroon and Oyo State, Nigeria
Previous Article in Special Issue
Bacterial Community of Grana Padano PDO Cheese and Generical Hard Cheeses: DNA Metabarcoding and DNA Metafingerprinting Analysis to Assess Similarities and Differences
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 10
Issue 8
10.3390/foods10081957
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Enteric Viruses and Core Microbiome Analysis in Artisanal Colonial Salami-Type Dry-Fermented Sausages from Santa Catarina, Brazil

by
Roberto Degenhardt
1,2,
Doris Sobral Marques Souza
1,3,
Leidiane A. Acordi Menezes
1,4,
Gilberto Vinícius de Melo Pereira
5,
David Rodríguez-Lázaro
6,7,
Gislaine Fongaro
3 and
Juliano De Dea Lindner
1,*
1
Food Technology and Bioprocess Research Group, Department of Food Science and Technology, Federal University of Santa Catarina (UFSC), Florianópolis 88034-000, SC, Brazil
2
Biological and Health Sciences Department, West of Santa Catarina State University (UNOESC), Joaçaba 89600-000, SC, Brazil
3
Laboratory of Applied Virology, Department of Microbiology, Immunology and Parasitology, Federal University of Santa Catarina (UFSC), Florianópolis 88034-000, SC, Brazil
4
Neoprospecta Microbiome Technologies, Sapiens Park, Florianópolis 88056-000, SC, Brazil
5
Department of Bioprocess Engineering and Biotechnology, Federal University of Paraná (UFPR), Curitiba 80060-000, PR, Brazil
6
Microbiology Division, Faculty of Sciences, University of Burgos, 9070 Burgos, Spain
7
Center for Emerging Pathogens and Global Health, University of Burgos, 9070 Burgos, Spain
*
Author to whom correspondence should be addressed.
Foods 2021, 10(8), 1957; https://doi.org/10.3390/foods10081957
Submission received: 16 July 2021 / Revised: 6 August 2021 / Accepted: 18 August 2021 / Published: 22 August 2021
(This article belongs to the Special Issue New Insights into Food Fermentation)
Browse Figures
Versions Notes

Abstract

:
Microbial fermentation plays an important role in the manufacturing of artisanal sausages and can have major effects on product quality and safety. We used metagenomics and culture-dependent methods to study the presence of Hepatitis E virus (HEV) and Rotavirus-A (RV-A), and fungal and bacterial communities, in artisanal Colonial salami-type dry-fermented sausages in Santa Catarina state, Brazil. Lactic acid bacteria (LAB) and yeast dominated the microbiome. Latilactobacillus sakei and Debaryomyces hansenii were ubiquitous and the most abundant species. The DNA of some foodborne pathogens was found in very low concentrations although viable cells of most of these species were undetectable by cultivation methods. The characteristics of the raw material and hygiene of the artisanal sausage manufacturing process resulted in high loads of beneficial microorganisms and the absence of HEV and RV-A viruses as determined by RT-qPCR assays. In conclusion, high LAB load in sausages was more relevant to preventing pathogen growth than the ripening time and/or physicochemical characteristics. However, the presence of Clostridium spp. and other pathogens in some samples must be taken into account for the development of future preservation methods; appropriate LAB starter cultures and health surveillance are required in the production process to prevent foodborne outbreaks.

1. Introduction

Fermented sausages (dry and semi-dry) make up a substantial proportion of pork produced and consumed in western Santa Catarina State. This is in part a consequence of the European origin and cultural characteristics of the population in this region in the south of Brazil. Several small and medium-scale production companies are dedicated to the transformation of pork meat, employing artisanal production techniques including natural fermentation. However, these production practices can allow the survival and multiplication of spoilage and pathogenic microorganisms if hygiene and sanitary conditions and process parameters are not strictly controlled.
There is a great diversity of dry-fermented sausages produced in the world. Different raw meat types, formulations, additives, processes, casing, and drying periods are used [1]. Colonial sausages produced in Santa Catarina State are characterized by low acidity and high moisture content when they are offered for sale, but they continue the ripening process outdoors in the market, gradually losing moisture [2]. These uncontrolled conditions can lead to a risk for the multiplication of undesirable microorganisms.
The production of artisanal sausages involve fermentation by the indigenous microbiota of meat (composed mainly by lactic acid bacteria—LAB) producing organic acids, and consequently a decrease in the pH that allows preservation of the product. Lactobacillus, Pediococcus, Enterococcus, and Leuconostoc are believed to be the principal genera involved in sausage fermentation [3,4], and diverse LAB are found in food products according to the manufacturing practices used. The preservation ability of LAB is based on competition for nutrients and the production of antimicrobial metabolites, hydrogen peroxide and bacteriocins. The selective influence of diverse factors (e.g., pH, redox potential, water activity (aw), temperature, relative humidity, oxygen availability) in fermented sausage will contribute to determining the microbial consortium present.
The microbial communities in fermented sausage play significant roles in the flavor, texture, quality, and safety of sausages [5,6]. Understanding the ecology of fermented sausages is clearly key to understanding the physical and chemical changes that occur during fermentation and ripening [7]. High-throughput sequencing of the microbiota from salami-type dry-fermented sausages of different origins indicates that LAB and coagulase-negative cocci, including both micrococci and coagulase-negative staphylococci (CNS) are the predominant groups in spontaneously fermented artisanal sausages [8]. Debaryomyces, Penicillium, and Aspergillus are the yeast and mold genera most commonly found [6,9,10,11]. Studies involving metagenomics for this type of fermented product are scarce in Brazil, and therefore, the ecology of Brazilian artisanal dry-fermented sausages needs further investigation.
Hepatitis E virus (HEV) and Rotavirus—A (RV-A) belong to the human enteric viruses group. They are non-enveloped and icosahedral viruses, and are very persistent in the environment [12]. HEV has a positive-sense single-stranded RNA and RV-A a double-stranded and segmented RNA (11 segments) that facilitates reassortment events among species [12]. Both are zoonotic viruses that infect many animal species as well as humans. They are mainly transmitted by the fecal-oral route, although HEV is also transmitted parenterally (rare), or by the ingestion of contaminated meat from viremic animals [12,13].
HEV and RV-A infect domestic pigs, which serve as reservoirs, and are emerging risks for human infection [13,14]. These viruses are excreted at high concentrations in animal stools (mainly from swine) so animal waste can contaminate water supplies, and when used in crops may contaminate food. Indeed, they persist as infectious particles in the environment, e.g., water and sewage, for several weeks at lower than body temperatures [13,15,16,17]. HEV circulation has already been reported in humans and domestic swine in Brazil [17,18,19].
The present study aimed to detect and quantify HEV and RV-A in artisanal Colonial salami-type dry-fermented sausages. We also analyzed the presence of fermenting, spoiling, and pathogenic microorganisms in the sausages. Both culture-dependent and -independent (metagenomic) approaches were used.

2. Materials and Methods

2.1. Colonial Salami-Type Dry-Fermented Sausage Production

Colonial salami-type dry-fermented sausages were collected from 13 production sites (Table 1) under the state inspection system (SIE) in the Vale do Rio do Peixe zone, Santa Catarina state, Brazil (ca. 27°10’ S; 51°30’ W). The sausages were prepared using the same manufacturing process in all sites. Pigs were slaughtered and the carcasses underwent temperature equalization for up to 24 h in cooling chambers to establish rigor mortis. The carcasses were exposed and shanks and palettes were used to prepare the sausages. The meat was comminuted in a meat grinder and seasoned with NaCl, curing agent (NO2), and spices.
The production of these sausages does not involve addition of commercial starter cultures for pan-curing. The fermentation is due to the natural microbiota of the meat and environment. After homogenization in a mixer, the meat is extruded into a natural bovine or a synthetic cellulose casing. The sausages are placed in a smoker where the drying is started, and the curing is completed under smoking. After smoking, the sausages are ready for sale. Thereafter, drying took place in the market, subject to the environmental conditions of the market stall site. The 13 sausage samples used had drying times of between one and 40 days, with half of the samples having been dried for more than seven days.

2.2. Physical-Chemical Evaluation

The physical-chemical characteristics of the sausages (Table 1) were determined using the official methods of the Ministry of Agriculture, Livestock and Supply (MAPA) [20]. The pH was determined using a potentiometer (Quimis, model Q400A, Diadema, SP, Brazil). The moisture content was determined by a gravimetric method, placing the samples in a drying oven (SP Labor, model SP-100/150, SP, Brazil) at 105 °C for 24 h [21]. The NaCl content was determined by the mercury metric method [20]. The aw was determined by grinding the samples and placing them into a digital hygrometer at 25 °C (Aqualab Model-Series 3 TE, Decagon Devices Inc., Pullman, USA). Water phase salt (WPS) was calculated from the values of NaCl and moisture content, according to Koral and Köse [22], using the following equation:
WPS% = (NaCl%/(NaCl% + moisture%)) × 100

2.3. Microbiological Analyses

The samples were tested for several microbial groups: total coliforms (TC), thermotolerant coliforms (TTC), coagulase-positive staphylococci (CPS), sulfite-reducing clostridia (SRC), LAB, Enterococci, Salmonella and Listeria monocytogenes. TC were counted by spread plating on Violet Red Bile Lactose agar (VRBL, Oxoid Limited, Hampshire, United Kingdom), incubated aerobically at 37 °C for 24 h [23]; TTC by pour plating on double-layered VRBL agar, incubated aerobically at 44 °C for 24 h; CPS by spread plating on Baird-Parker agar (BPA, Neogen, Lansing, MI, USA), incubated aerobically at 35 °C for 24–48 h [24]; SRC by pour plating on Iron Sulfite agar (ISA, Neogen), incubated anaerobically at 37 °C for 24–48 h [25]; LAB by pour plating on De Man, Rogosa and Sharpe agar (MRS, Neogen), incubated anaerobically at 30 °C for 72 h [26]; Enterococci by spread plating on m-Enterococcus agar (Neogen), incubated anaerobically at 35 ± 2 °C for 24–48 h; Salmonella by incubating a 25 g pre-enrichment sample in buffered peptone water (BPW, Neogen) at 34–38 °C for 18 h, selective enrichment by adding 0.1 mL of the BPW to modified semi-solid Rappaport-Vassiliadis medium (MSRV, Neogen) at 41.5 ± 1 °C for 24 h and 1 mL of BPW to Muller-Kauffmann Tetrathionate-Novobiocin broth (MKTTn, Neogen) at 37 ± 1 °C for 24 h, plating-out in xylose lysine deoxycholate agar (XLD, Neogen) at 37 °C for 24 h and brilliant green agar (BGA, Neogen) at 37 °C for 24 h, with confirmation by biochemical and serological testing [27]; Listeria spp. by incubating a 25 g pre-enrichment sample in demi Fraser broth (DF, Neogen) at 30 °C for 24 h, selective enrichment by incubating 0.1 mL of the DF in Fraser broth (Neogen) at 35 ± 1 °C for 24–48 h, then plating-out on Listeria agar (ALOA, Laborclin, Pinhais, Paraná, Brazil) at 37 °C for 24 h, with confirmation by biochemical testing [28].
Yeasts and molds were counted by spread plating on dichloran glycerol agar (DG18, Neogen) containing chloramphenicol (0.1 g/L) and incubating at 25 °C for 5–7 days [29]. Macroscopic observation was used to distinguish between yeasts and molds among the colonies growing on the plates.

2.4. Viral Detection by RT-qPCR

Virus was detected by mechanical disruption of tissues followed by silica-membrane RNA extraction, as described by García et al. [14] and Rodríguez-Lázaro et al. [30]. Briefly, 25 g samples of sausage (Table 1) were collected, chopped using a sterile scalpel blade and homogenized; aliquots of 0.25 g were taken from the samples, and they were inoculated with ~105 PFU (Plaque Forming Units) of MNV-1 (Murine Norovirus-1) as sample process control virus (SPCV). Each sample (including SPCV) was homogenized in 1 mL of lysis buffer RLT (Qiagen, Hilden, Germany) containing 0.14M β-mercapto-ethanol in a tissue homogenizer, and incubated for 5 min at room temperature. The samples were then centrifuged at 10,000× g for 20 min at 4 °C and the supernatants (800 µL) were transferred to new tubes for nucleic acid extraction with the RNeasy® Mini kit (Qiagen, Germany), following the manufacturer’s protocols. The resulting nucleic acid samples were subjected to RT-qPCR, both undiluted and diluted tenfold to reduce the inhibitory effects of any contaminants in the samples.
The TaqMan technique was used for RT-qPCR, as previously described by Baert et al. [31] for MNV-1 as SPCV, Jothikumar et al. [32] for HEV and [33] for RV-A. All amplifications were performed in a StepOne Plus® Real-Time PCR System (Applied Biosystems, Waltham, MA, USA), and each sample was analyzed in triplicate. Ultrapure water was used as the non-template control for each assay.

2.5. Metagenomic Analyses

DNA was extracted from samples with the DNeasy Power Soil Pro kit (Qiagen, Germany), following the manufacturer’s instructions. Total DNA extracted was used as the template for Next Generation Sequencing (NGS), on the Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA).
The microbiome of the samples was studied by high throughput sequencing for bacterial taxonomic identification based on conserved and variable regions V3/V4 of the 16S rRNA gene with primers 341F (CCTACGGGRSGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) [34,35]. Extracted DNA was subjected to PCR using a previously described protocol [36] developed by Neo-prospecta Microbiome Technologies (Florianopolis, Brazil). The first PCR used sequences based on Illumina’s TruSeq adapters, which allows a second PCR with primers with indexed sequences. PCRs were carried out in triplicate using Taq Platinum (Invitrogen, Waltham, MA, EUA) with the following conditions: PCR1—95 °C/5 min, 25 cycles (95 °C/45 s, 55 °C/30 s, 72 °C/45 s) and final extension 72 °C/2 min; PCR2—95 °C/5 min, 10 cycles (95 °C/45 s, 66 °C/30 s, 72 °C/45 s) and final extension 72 °C/2 min.
The community of filamentous fungi and yeasts was studied by amplifying the ITS1 region using ITS1F (GAACCWGCGGARGGATCA) and ITS2R (GCTGCGTTCTTCATCGATGC) primers [37], and the same conditions for PCR1. For PCR2, the conditions were: 95 °C/5 min, 15 cycles (95 °C/45 s, 66 °C/30 s, 72 °C/45 s) and final extension 72 °C/2 min. The final reaction products were purified using a protocol developed by Neoprospecta involving magnetic beads. The samples were grouped in libraries quantified by Real-Time PCR using KAPA Library Quantification (KAPA Biosystems, Woburn, MA, USA). Library pools were sequenced in a MiSeq sequencer system (Illumina Inc., USA) using V2- 300 cycle kit, in a paired-end run, without normalization of libraries. The raw data (DNA sequences in fastq files) were analyzed through bioinformatics workflow considering accumulated error in the sequencing to be at most 1%. To identify the species of microorganisms present in the samples, the DNA sequences obtained were compared with a proprietary database containing well-characterized DNA sequences.
Sequencing data for each sample were processed with the Quantitative Insights into Microbial Ecology (Qiime) software package [38]. The sequencing output was analyzed by a read quality filter; reads with an average Phred score < 20 were removed and then 100% identical reads were clustered. Clusters with fewer than five reads were excluded from further analysis, to remove putative chimeric sequences. The remaining good-quality sequences were further clustered at 97% similarity to define operational taxonomic units (OTU). OTUs were classified by comparison with a custom 16S rRNA/ITS1 database (NEORefDB, Neoprospecta). Sequences with at least 99% identity to the reference database were taxonomically assigned. Each OTU was given an arbitrary unit corresponding to the relative abundance (r.a.) calculated as the number of reads pertaining to each species as a percentage of the total number of sequences read for each sample. Species with a r.a. below 1% were grouped in the category “others”. The r.a. values were compared between OTUs using heatmaps prepared on Qiime.

2.6. Statistical Analyses

Differences in virus parameters between samples collected from different sites and seasons were analyzed by nonparametric analysis of variance (Kruskal–Wallis) performed with Statistic 7.0. Pearson correlation and linear regression tests, ANOVA, and Student’s t-tests were performed using GraphPad Prism 5.0 (USA). Differences were considered statistically significant at a p-value ≤ 0.05.

3. Results and Discussion

3.1. Physical-Chemical Characteristics

Selected physical-chemical characteristics (pH, moisture, NaCl, WPS and aw) of the sausage samples are summarized in Table 1. The sausages can be classified into two subgroups according to the criteria of Brazilian legislation [39]: (i) dry sausages, with moisture ≤ 40% and aw ≤ 0.92, and (ii) semi-dry sausages, for which these parameters are not stipulated. A particular feature of these locally produced sausages is that they are offered for sale as semi-dry sausages and, due to the environmental conditions, they start to present dry sausage characteristics as the ripening continues. The dry sausages (L01, L04, L07, L10, L12) had undergone seven or more days of ripening, whereas the semi-dry sausages (L02, L03, L05, L06, L08, L09, and L11) had undergone up to six, except for samples L02 and L06; these two sausages had been maintained under refrigeration at the site of sale, reducing dehydration.
All the samples presented pH between 5.1 and 6.4 (Table 1), characteristic of the sausages produced in the region. This weak acidity is also characteristic of Italian sausages, produced in the Mediterranean region only with pork meat. Low pH and aw are the two main obstacles to spoilage and the development of pathogenic microorganisms in fermented sausages [40]. If these factors are weak, as is the case in our samples due to the relatively high pH of the samples (≥5.1), the association between aw and the competitive microbiota (mainly LAB) becomes very important to the safety of the product. The WPS is not frequently used to assess the potential for multiplication of spoilage and/or pathogenic microorganisms in meat sausages in Brazil, but it is a potentially valuable indicator for small producers, due to its relationship with water activity.
The minimum salt concentration in the samples was 3.01 (sample L08) and the maximum was 6.15 (sample L04). The upper limit of sensorial consumer acceptability for salt in cured meats is 3.5% to 5.0% with 1.5% to 2.0% being optimal. The salt concentration was therefore acceptable in the samples, except for sample L04. The higher concentration of salt in this case appears to be a consequence of excessive drying: the moisture content was only 30.2%. In artisanal cured products, salt is still the main resource used for conservation, and this is the main reason for the high salt content in these sausages, mostly between 3.7% and 5.04% (Table 1). These values are compatible with those required for the preservation of sausages and related products [41].

3.2. Viral Detection

The samples of artisanal Colonial salami-type dry-fermented sausages from different production sites (Table 1) were tested by RT-qPCR for HEV and RV-A. Neither virus was detected in any of the sausage samples, and the mean viral extraction efficiency (measured as SPCV -MNV-1 recovery) was 30%.
HEV is more frequently detected in feces than serum and liver samples from infected animals [42], but there is nevertheless a risk of foodborne hepatitis E infection from consumption of pork products. Boxman et al. [43] found HEV RNA in 14.6% of pork sausages collected from a Dutch market from 2017 to 2019, and HEV RNA was detected in 18.5% of salami (n = 92) samples; sequence-based typing was successful for 33 samples, and all were genotype 3c. Berto et al. [44] found HEV RNA in four samples of liver sausage in France, and three of them had infectious particles of HEV as assessed by cell culture assay. Colson et al. [45] found HEV RNA of genotype 3 in seven samples of raw figatelli purchased in French supermarkets. However, HEV RNA was not detected in any of the 22 sausages from different production sites analyzed in this work. This contrasts with Souza et al. [17], who detected HEV in effluent after swine manure digestion by psychrophilic anaerobic biodigesters (PABs) in Concórdia city, in Santa Catarina state. This demonstrates the circulation of HEV in the pig-finishing farms in the zone where the Colonial sausage we studied was produced.
Lowering pH during meat fermentation is believed to inhibit the growth of certain pathogens. Wolff et al. [46] tested the pH resistance of a genotype 3 strain of HEV. Only minimal inactivating effects were found at pH conditions common in sausages during curing (4.5 to 6.5), simulated using D/L-lactic acid. High salt concentrations are also used to preserve meat products and to inactivate foodborne pathogens. Wolff et al. [47] tested the effects of NaCl, sodium nitrite, and sodium nitrate concentrations on the infectivity of HEV. Conditions consistent with those in fermented sausages were simulated. Treatments with up to 20% NaCl for 24 h at 23 °C, with and without the addition of 0.015% nitrite or 0.03% nitrate, did not inactivate the virus, demonstrating that HEV is highly stable at salt concentrations used to preserve raw meat products. Therefore, the acid pH and high salinity of the products we tested were unlikely to be responsible for the absence of HEV.
Organs from naturally HEV-infected pigs were tested by García et al. [14] and the HEV virus was not detected in loin samples: meat even from infected animals may therefore be only a low risk for HEV transmission. The main ingredient used in the preparation of Colonial salami is the loin, and this may explain the absence of HEV RNA from the samples tested, despite evidence of the circulation of HEV in pig farms in the region [17]. Other organs would need to be analyzed to assess the HEV contamination of the pigs in the region.
RV-A RNA was not detected in the Colonial sausage samples analyzed, evidencing the good sanitary conditions during slaughter and sausages preparation. RV-A zoonotic transmission to humans usually occurs via direct contact with infected animals or fomites [15]. RV-A causes diarrheic diseases in swine and meat contamination could occur in the slaughterhouse or during sausage preparation by handlers and fomites. RV-A is the most prevalent rotaviral cause of diarrhea in swine [48]. Other RV species that can infect pigs were not investigated in this work.

3.3. Microbiological and Metagenomic Analyses

The combined culture-dependent and -independent approaches are best for analyses of the microbiota of fermented foods [49]. Culture-dependent analysis showed high levels of LAB and yeasts and the presence of enterococci and molds in all samples. There were low or undetectable counts of undesirable microbiota, in accordance with Brazilian standards (Table 2). In general, the samples showed similar cell count values that were independent of the ripening time. Likewise, there was no correlation between ripening time and microbiota in the metagenomic analyses. The pH in all samples was higher than 5.0, indicating that LAB community was mostly bacteria with low acid production capacity, resulting in low acidity fermented sausages. Although low acidity does not favor the inhibition of undesirable microbiota, it enhances the water-retention capacity of meat proteins, contributing to the maintenance of moisture during ripening [50]. The yeast community is important for the development of flavor and inhibition of toxigenic molds.
The 16S amplicon target sequencing identified more than 60 species each with a r.a. above 0.1% (Figure 1 shows the 31 species with over 1% r.a., in one or more samples). Species with a very small number of reads (r.a. < 1%) were classified into the category “others”.
LAB and CNS were the most abundant groups in our samples (Figure 1), consistent with previous reports for dry sausages from Spain and Italy [6,8]. LAB was predominant in 11 of the 13 sausage samples: Latilactobacillus sakei was the most abundant taxon in samples L01, L03, L05, L06, L08, L10, L12, and L13 (r.a. of 43.56%, 65.85%, 49.57%, 38.38%, 42.70%, 62.75%, 40.30%, and 92.14%, respectively); Latilactobacillus curvatus was predominant in sample L02 (r.a. 60.31%); Lactococcus lactis in sample L04 (r.a. 33.33%), and Pediococcus pentosaceus in sample L11 (r.a. 36.39%).
Most samples (Figure 1) contained three or four species with r.a. above 5%, although in sample L13 Lb. sakei was massively predominant and the microbial community was not very diverse. Lb. curvatus was found at r.a. of between 5% and 12% in samples L01, L07, L09, and L12, Lactococcus lactis at between 9% and 14% in samples L05 and L12, Lactococcus garvieae at around 13% in samples L08 and L011, Leuconostoc mesenteroides at 17% in L08, Lactiplantibacillus plantarum at 7% in L02 and Weissella hellenica at 18% in L10. Lb. sakei, Lb. curvatus and Lp. plantarum are the species of LAB commonly found in sausages with no added starters. Other species of Weissella, Leuconostoc, Lactococcus, and Pediococcus were also found, but as part of the subdominant microbiota in our samples. The fermentation in these sausages is spontaneous, so the microorganisms detected come from the meat and the surrounding environment [6].
The manufacturing process of artisanal Colonial salami-type dry-fermented sausages from Santa Catarina includes spontaneous fermentation, cure and drying as conservation. Thus, the obstacles to the development of spoilage and pathogenic microbiota are the addition of preservatives (NaCl and sodium nitrite), pH, aw, and the competitive microbiota, mostly LAB. The protective effects of LAB are due in part to their production of bacteriocins with antimicrobial activity against pathogens [51]. Hebert et al. [52] showed that Lb. curvatus CRL705 isolated from Argentinean artisanal fermented sausage produces bacteriocin with anti-listeria activity. Palavecino et al. [6] describe coagulase-negative staphylococci (CNS) with antimicrobial activity. The presence of CNS (Staphylococcus saprophyticus, Staphylococcus galinarum, and Staphylococcus equorum) in our samples (Figure 1) may be one of the reasons for the absence of pathogens common in meat products, such as Clostridium botulinum, Staphylococcus aureus, Listeria monocytogenes, and Escherichia coli [53].
In general, the sausage samples (Table 2) that showed the best hygiene indicator results (TC, TTC, CPS, SRC, and Salmonella) were drier (e.g., L10) and had longer ripening time (e.g., L02). This is in contrast to the observation for the high LAB semi-dry sausage subgroup, which corroborates the metagenomic data (Figure 1). Listeria spp. were detected in 38.4% of the samples, but L. monocytogenes was not detected at a significant r.a. in any sample (Figure 1). Listeria spp. are detected in many fermented sausages with low acidity and high aw [54,55,56]. Listeria spp. counts determined by culture-dependent methods are generally low in fermented sausages [57,58], and culture-dependent methods employ enrichment and cell concentration steps. Therefore, the possibility of isolating a microorganism is greater than for the metagenomic analysis when it is present at low r.a.
In addition to LAB, species of the Micrococcaceae family, mainly belonging to the genus Staphylococcus, are commonly found in artisanal sausages. S. saprophyticus, Staphylococcus xylosus, S. equorum, and Staphylococcus carnosus are often predominant. Staphylococcus succinus is also frequently observed in sub-dominant populations [7,59]. For samples L07 and L09 (Figure 1), the predominant microorganism was S. saprophyticus (r.a. 42.60% and 61.65%, respectively). This species was also found in samples L01, L06, L08, L10, and L12 (r.a. from 15% to 26%). S. succinus was found in sample L09 at an r.a. off 20%.
Brochothrix thermosphacta, Carnobacterium spp., clostridia, and Pseudomonas spp. are among the bacteria most frequently causing spoilage of refrigerated pork meat [60]. Pseudomonas fragi (Figure 1) was found in samples L01, L03, L05, L06, and L011 with r.a. between 10% and 23%. Carnobacterium divergens (r.a. 1.87%) and Clostridium perfringens (r.a. 27.76%) were found in sample L04, in which the abundance of lactobacilli was low. B. thermosphacta was detected in samples (Figure 1) with a low abundance of lactobacilli (L03, L05, and L11). However, for sample L09, S. saprophyticus was predominant, and although the r.a. of lactobacilli were low, no sequences belonging to B. thermosphacta, C. divergens (r.a. 1.87%), Pseudomonas spp. or clostridia were detected.
Taxonomical assignment of the yeasts (Figure 2) showed the dominance of Debaryomyces hansenii in L02, L04, L06, L07, L09, L10, L11, and L12 (r.a. 63.49%, 44.25%, 82.44%, 80.01%, 65.71%, 35.20%, 28.92% and 10.85%, respectively) followed by Candida zeylanoides, predominant in samples L01, L03, and L12 (r.a. 73.91%, 19.13%, and 58.23%, respectively), Yarrowia galli predominant in L05 (r.a. 42.15%), and Kodamaea ohmeri in L08 (r.a. 53.31%). D. hansenii, C. zeylanoides and Yarrowia lipolytica were found in all the samples, although they were less abundant than the other yeast groups. Y. galli, Pichia kudriavzevii, K. ohmeri, Candida parapsilosis and Candida tropicalis were also found with relevant r.a. in the sub-dominant populations of the samples.
D. hansenii is the most common yeast in fermented sausages and contributes to two important characteristics: production of volatile compounds during ripening, especially esters, branched alcohols, and aldehydes [61,62], and bioprotective antifungal activity against toxigenic penicillia [63]. Species belonging to the genera Candida, Yarrowia, and Pichia are also frequently found [6,51,64].
Development of mold on the surface of the casings during ripening of fermented sausages is common, and molds are present in the environment at the production and ripening sites. Molds are important in the development of flavor, but some fungi of the genera Aspergillus and Penicillium can produce undesirable mycotoxins [65]. For example, a combination of high moisture, low temperature and the predominance of penicillia has been found to be conducive to the production of penicillic acid, a carcinogen [66]. The filamentous fungus found at the highest abundance was Aspergillus cibarius in L02, L11 and L12 (3.38%, 42.51%, and 35.30%, respectively) followed by Penicillium thymicola (r.a. 8.78% in L12), and Geotrichum candidum (r.a. 4.90% in L04). Aspergillus and Penicillium are the main genera found in fermented sausages, while Geotrichum is found with lower frequency [6,51,67,68,69].

4. Conclusions

The present study suggests that LAB may provide a larger contribution to prevent pathogen growth than ripening time and/or physicochemical characteristics (pH, moisture, NaCl, and aw) in dry-fermented, low-acid artisanal Colonial sausages. Although we provide some evidence for a protective role of LAB, and enteric zoonotic viruses (HEV and RV-A) were not detected in the sausage samples, the presence of Cl. perfringens is an indication of the need for sanitary improvements in the production process to prevent foodborne outbreaks.

Author Contributions

Conceptualization, R.D., D.S.M.S., L.A.A.M., G.F. and J.D.D.L.; Data curation, R.D., D.S.M.S. and L.A.A.M.; Formal analysis, R.D., D.S.M.S. and L.A.A.M.; Funding acquisition, G.F. and J.D.D.L.; Methodology, D.S.M.S., L.A.A.M. and G.F.; Project administration, J.D.D.L.; Supervision, J.D.D.L.; Writing—original draft, R.D., D.S.M.S. and L.A.A.M.; Writing—review & editing, G.V.d.M.P., D.R.-L., G.F. and J.D.D.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CNPq project number 556276/2009-4 (CT-Hidro 22/2009) and by CAPES/PNPD 88887.473179/2020-00 (Postdoc fellowship).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The Data associated with this article can be requested by e-mail.

Conflicts of Interest

The role of the Neoprospecta Microbiome Technologies company in the manuscript was to provide the metagenomic analyses. The authors declare no conflict of interest.

References

  1. Toldrá, F.; Nip, W.K.; Hiu, Y.H. Dry-Fermented Sausages: An Overview. In Handbook of Fermented Meat and Poultry, 1st ed.; Toldrá, F., Ed.; Blackwell Publishing: Hoboken, NJ, USA, 2007; pp. 321–325. ISBN 0–8247–4780–1. [Google Scholar]
  2. Degenhardt, R.; Sant’ Anna, E.S. Pesquisa de Listeria sp, em embutidos cárneos fermentados produzidos na região Meio-Oeste de Santa Catarina, Brasil. Boletim do Centro de Pesquisa de Processamento de Alimentos 2007, 25, 133–140. [Google Scholar] [CrossRef]
  3. Fontana, C.; Fadda, S.; Cocconcelli, P.S.; Vignolo, G. Lactic Acid Bacteria in Meat Fermentations. In Lahtinen, 4th ed.; Ouwehand, A.C., Salminen, S., Von Wright, A., Eds.; CRC Press. Taylor & Francis Group: London, UK, 2012; pp. 247–264. [Google Scholar]
  4. Fraqueza, M.J. Antibiotic resistance of lactic acid bacteria isolated from dry-fermented sausages. Int. J. Food Microbiol. 2015, 212, 76–88. [Google Scholar] [CrossRef] [PubMed]
  5. Hu, Y.; Zhang, L.; Zhang, H.; Wang, Y.; Chen, Q.; Kong, B. Physicochemical properties and flavour profile of fermented dry sausages with a reduction of sodium chloride. LWT 2020, 124, 109061. [Google Scholar] [CrossRef]
  6. Palavecino Prpich, N.Z.; Camprubí, G.E.; Cayré, M.E.; Castro, M.P. Indigenous Microbiota to Leverage Traditional Dry Sausage Production. Int. J. Food Sci. 2021, 30, 6696856. [Google Scholar] [CrossRef]
  7. Dalla Santa, O.R.; Chacón Alvarez, D.; Dalla Santa, H.S.; Zanette, C.M.; Freitas, R.J.S.; Macedo, R.E.F.; Terra, N.N. Microbiota of sausages obtained by spontaneous fermentation produced in the South of Brazil. Food Sci. Technol. 2012, 32, 653–660. [Google Scholar] [CrossRef] [Green Version]
  8. Aquilanti, L.; Garofalo, C.; Osimani, A.; Clementi, F. Ecology of lactic acid bacteria and coagulase negative cocci in fermented dry sausages manufactured in Italy and other Mediterranean countries: An overview. Int. Food Res. J. 2016, 23, 429–445. [Google Scholar]
  9. Cocolin, L.; Urso, R.; Rantsiou, K.; Cantoni, C.; Comi, G. Dynamics and characterization of yeasts during natural fermentation of Italian sausages. FEMS Yeast Res. 2006, 6, 692–701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Mendonça, R.C.; Gouvêa, D.M.; Hungaro, H.M.; Sodré, A.D.F.; Querol-Simon, A. Dynamics of the yeast flora in artisanal country style and industrial dry cured sausage (yeast in fermented sausage). Food Control. 2013, 29, 143–148. [Google Scholar] [CrossRef] [Green Version]
  11. Sunesen, L.O.; Stahnke, L.H. Mould starter cultures for dry sausages—Selection, application and effects. Meat Sci. 2003, 65, 935–948. [Google Scholar] [CrossRef]
  12. Knipe, D.M.; Howley, P.M. (Eds.) Fields Virology, 6th ed.; Lippincott Williams & Wilkins a Wolters Kluwer Business: Philadelphia, PA, USA, 2013. [Google Scholar]
  13. Doceul, V.; Bagdassarian, E.; Demange, A.; Pavio, N. Zoonotic hepatitis E virus: Classification, animal reservoirs and transmission routes. Viruses 2016, 8, 270. [Google Scholar] [CrossRef]
  14. García, N.; Hernández, M.; Gutierrez-Boada, M.; Valero, A.; Navarro, A.; Muñoz-Chimeno, M.; Fernández-Manzano, A.; Escobar, F.M.; Martínez, I.; Bárcena, C.; et al. Occurrence of Hepatitis E Virus in Pigs and Pork Cuts and Organs at the Time of Slaughter, Spain. Front. Microbiol. 2020, 10, 1–10. [Google Scholar] [CrossRef] [Green Version]
  15. Doro, R.; Farkas, S.L.; Martella, V.; Banyai, K. Zoonotic transmission of rotavirus: Surveillance and control. Expert Rev. Anti-Infect. Ther. 2015, 13, 1337–1350. [Google Scholar] [CrossRef]
  16. Krog, J.S.; Hjulsager, C.K.; Larsen, M.A.; Larsen, L.E. Triple-reassortant influenza A virus with H3 of human seasonal origin, NA of swine origin, and internal A (H1N1) pandemic 2009 genes is established in Danish pigs. Influenza Other Respir. Viruses 2017, 11, 298–303. [Google Scholar] [CrossRef] [Green Version]
  17. Souza, D.S.M.; Tápparo, D.C.; Rogovski, P.; Cadamuro, R.D.; de Souza, E.B.; da Silva, R.; Degenhardt, R.; De Dea Lindner, J.; Viancelli, A.; Michelon, W.; et al. Hepatitis E Virus in Manure and Its Removal by Psychrophilic anaerobic Biodigestion in Intensive Production Farms, Santa Catarina, Brazil, 2018. Microorganisms 2020, 8, 2045. [Google Scholar] [CrossRef]
  18. Amorim, A.R.; Mendes, G.S.; Pena, G.P.A.; Santos, N. Hepatitis E virus infection of slaughtered healthy pigs in Brazil. Zoonoses Public Health 2018, 65, 501–504. [Google Scholar] [CrossRef]
  19. Tengan, F.M.; Figueiredo, G.M.; Nunes, A.K.; Manchiero, C.; Dantas, B.P.; Magri, M.C.; Prata, T.V.G.; Nascimento, M.; Mazza, C.C.; Abdala, E.; et al. Seroprevalence of hepatitis E in adults in Brazil: A systematic review and meta-analysis. Infect. Dis. Poverty 2019, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
  20. BRASIL Ministério da Agricultura e do Abastecimento. Instrução Normativa n° 20, de 31 de julho de 2000, que oficializa os Métodos Analíticos Físico-químicos, para controle dos produtos cárneos e seus ingredientes–Sal e Salmoura. Diário Oficial da União, 27 jul. Seção 1, p. 10; Ministério da Agricultura e do Abastecimento: Brasília, Brazil, 2020. [Google Scholar]
  21. AOAC. Official Methods of Analysis; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2002. [Google Scholar]
  22. Koral, S.; Köse, S. The Effect of Using Frozen Raw Material and Different Salt Ratios on the Quality Changes of Dry Salted Atlantic Bonito (Lakerda) at Two Storage Conditions. Food Health 2018, 4, 213–230. [Google Scholar] [CrossRef]
  23. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Enumeration of Coliforms—Colony-Count Technique; ISO 4832:2012; International Standards Organization: Geneva, Switzerland, 2012. [Google Scholar]
  24. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Enumeration of Coagulase-Positive Staphylococci (Staphylococcus Aureus and Other Species) Part 1: Technique Using Baird-Parker Agar Medium; ISO 6888–1:2019; International Standards Organization: Geneva, Switzerland, 2019. [Google Scholar]
  25. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Enumeration of Sulfite-Reducing Bacteria Growing under Anaerobic Conditions; ISO 15213:2003; International Standards Organization: Geneva, Switzerland, 2003. [Google Scholar]
  26. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Enumeration of Mesophilic Lactic Acid Bacteria—Colony-Count Technique at 30 Degrees °C; ISO 15214:1998; International Standards Organization: Geneva, Switzerland, 1998. [Google Scholar]
  27. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp.; ISO 6579–1:2017; International Standards Organization: Geneva, Switzerland, 2017. [Google Scholar]
  28. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Detection and Enumeration of Listeria Monocytogenes and of Listeria spp. Part 1: Detection Method; ISO 11290–1:2017; International Standards Organization: Geneva, Switzerland, 2017. [Google Scholar]
  29. International Standards Organization. Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Enumeration of Yeasts and Moulds—Part 2: Colony Count Technique in Products with Water Activity Less Than or Equal to 0.95, ISO 21527–2:2008 standard.; International Standards Organization: Geneva, Switzerland, 2008. [Google Scholar]
  30. Rodríguez-Lázaro, D.; Cook, N.; Ruggeri, F.M.; Sellwood, J.; Nasser, A.; Nascimento, M.S.J.; van der Poel, W.H.M. Virus hazards from food, water and other contaminated environments. FEMS Microb. Rev. 2012, 36, 786–814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Baert, L.; Wobus, C.E.; Van Coillie, E.; Thackray, L.B.; Debevere, J.; Uyttendaele, M. Detection of murine norovirus 1 by using plaque assay, transfection assay, and real-time reverse transcription-PCR before and after heat exposure. Appl. Environ. Microbiol. 2008, 74, 543–546. [Google Scholar] [CrossRef] [Green Version]
  32. Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef] [PubMed]
  33. Zeng, S.Q.; Halkosalo, A.; Salminen, M.; Szakal, E.D.; Puustinen, L.; Vesikari, T. One-step quantitative RT-PCR for the detection of rotavirus in acute gastroenteritis. J. Virol. Methods 2008, 153, 238–240. [Google Scholar] [CrossRef]
  34. Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Huntley, J.; Fierer, N.; Knight, R. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012, 6, 1621–1624. [Google Scholar] [CrossRef] [Green Version]
  35. Wang, Y.; Qian, P.Y. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies. PLoS ONE 2009, 4, e7401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Christoff, A.P.; Cruz, G.N.F.; Sereia, A.F.R.; Yamanaka, L.E.; Silveira, P.P.; De Oliveira, L.F.V. End-to-end assessment of fecal bacteriome analysis: From sample processing to DNA sequencing and bioinformatics results. BioRxiv 2019, 646349. [Google Scholar] [CrossRef]
  37. Schmidt, P.A.; Bálint, M.; Greshake, B.; Bandow, C.; Römbke, J.; Schmitt, I. Illumina metabarcoding of a soil fungal community. Soil Biol. Biochem. 2013, 65, 128–132. [Google Scholar] [CrossRef]
  38. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Knight, R. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [Green Version]
  39. BRASIL Ministério da Agricultura e do Abastecimento. Instrução Normativa n°22, de 31 de julho de 2000, aprova os Regulamento Técnicos de Identidade e Qualidade de Copa, de Jerked Beef, de Presunto tipo Parma, de Presunto Cru, de Salame, de Salaminho, de Salaminho tipo Alemão, de Salame tipo Calabrês, de Salame tipo Friolano, de Salame tipo Napolitano, de Salame tipo Hamburguês, de Salame tipo Italiano, de Salame tipo Milano, de Lingüiça Colonial e Pepperoni. Diário Oficial da União, 3 ago. Seção 1, p. 15; Ministério da Agricultura e do Abastecimento: Brasília, Brazil, 2020.
  40. Ingham, S.C.; Engel, R.A.; Fanslau, M.A.; Schoeller, E.L.; Searls, G.; Buege, D.R.; Zhu, J. Fate of Staphylococcus aureus on Vacuum-Packaged Ready-to-Eat Meat Products Stored at 21 °C. J. Food Protec. 2005, 68, 1911–1915. [Google Scholar] [CrossRef] [Green Version]
  41. Tim, H. Sodium–Technological functions of salt in the manufacturing of food and drink products. Br. Food J. 2002, 104, 126–152. [Google Scholar] [CrossRef]
  42. De Souza, A.J.S.; Gomes-Gouvêa, M.S.; Soares, M.d.C.P.; Pinho, J.R.R.; Malheiros, A.P.; Carneiro, L.A.; Dos Santos, D.R.L.; Pereira, W.L.A. HEV infection in swine from Eastern Brazilian Amazon: Evidence of co-infection by different subtypes. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 477–485. [Google Scholar] [CrossRef]
  43. Boxman, I.L.; Jansen, C.C.; Zwartkruis-Nahuis, A.J.; Hägele, G.; Sosef, N.P.; Dirks, R.A. Detection and quantification of hepatitis E virus RNA in ready to eat raw pork sausages in the Netherlands. Int. J. Food Microb. 2020, 333, 108791. [Google Scholar] [CrossRef] [PubMed]
  44. Berto, A.; Grierson, S.; Hakze-van der Honing, R.; Martelli, F.; Johne, R.; Reetz, J.; Banks, M. HEV in Pork Liver sausages, France. Emerg. Infec. Dis. 2013, 19, 3–5. [Google Scholar] [CrossRef]
  45. Colson, P.; Borentain, P.; Queyriaux, B.; Kaba, M.; Moal, V.; Gallian, P.; Gerolami, R. Pig Liver Sausage as a Source of Hepatitis E Virus Transmission to Humans. J. Infect. Dis. 2010, 202, 825–834. [Google Scholar] [CrossRef] [Green Version]
  46. Wolff, A.; Günther, T.; Albert, T.; Schilling-Loeffler, K.; Gadicherla, A.K.; Johne, R. Stability of hepatitis E virus at different pH values. Int. J. Food Microbiol. 2020, 325, 108625. [Google Scholar] [CrossRef]
  47. Wolff, A.; Günther, T.; Albert, T.; Johne, R. Effect of Sodium Chloride, Sodium Nitrite and Sodium Nitrate on the Infectivity of Hepatitis E Virus. Food Environ. Virol. 2020, 12, 350–354. [Google Scholar] [CrossRef] [PubMed]
  48. Dhama, K.; Chauhan, R.S.; Mahendran, M.; Malik, S.V.S. Rotavirus diarrhea in bovines and other domestic animals. Vet. Res. Commun. 2009, 33, 1–23. [Google Scholar] [CrossRef]
  49. Terzić-Vidojević, A.; Veljović, K.; Tolinački, M.; Živković, M.; Lukić, J.; Lozo, J.; Golić, N. Diversity of non-starter lactic acid bacteria in autochthonous dairy products from Western Balkan Countries-technological and probiotic properties. Food Res. Int. 2020, 136, 109494. [Google Scholar] [CrossRef]
  50. Lund, P.A.; De Biase, D.; Liran, O.; Scheler, O.; Mira, N.P.; Cetecioglu, Z.; O’Byrne, C. Understanding how microorganisms respond to acid pH is central to their control and successful exploitation. Front. Microbiol. 2020, 11, 2233. [Google Scholar] [CrossRef]
  51. Franciosa, I.; Alessandria, V.; Dolci, P.; Rantsiou, K.; Cocolin, L. Sausage fermentation and starter cultures in the era of molecular biology methods. Int. J. Food Microbiol. 2018, 279, 26–32. [Google Scholar] [CrossRef] [PubMed]
  52. Hebert, E.M.; Saavedra, L.; Taranto, M.P.; Mozzi, F.; Christian Magni, C.; Nader, M.E.F.; de Valdez, G.F.; Sesma, F.; Vignolo, G.; Raya, R.R. Genome Sequence of the Bacteriocin-Producing Lactobacillus curvatus Strain CRL. J. Bacteriol. 2012, 194, 538–539. [Google Scholar] [CrossRef] [Green Version]
  53. Mainar, M.S.; Xhaferi, R.; Samapundo, S.; Devlieghere, F.; Leroy, F. Opportunities and limitations for the production of safe fermented meats without nitrate and nitrite using an antibacterial Staphylococcus sciuri starter culture. Food Control. 2016, 69, 267–274. [Google Scholar] [CrossRef]
  54. Colak, H.; Hampikyan, H.; Ulusoy, B.; Bingol, E.B. Presence of Listeria monocytogenes in Turkish style fermented sausage (sucuk). Food Control. 2007, 18, 30–32. [Google Scholar] [CrossRef]
  55. De Cesare, A.; Mioni, R.; Manfreda, G. Prevalence of Listeria monocytogenes in fresh and fermented Italian sausages and ribotyping of contaminating strains. Int. J. Food Microbiol. 2007, 120, 124–130. [Google Scholar] [CrossRef]
  56. Meloni, D. Presence of Listeria monocytogenes in Mediterranean-style dry fermented sausages. Foods 2015, 4, 34–50. [Google Scholar] [CrossRef] [Green Version]
  57. Auvolat, A.; Besse, N.G. The challenge of enumerating Listeria monocytogenes in food. Food Microb. 2016, 53, 135–149. [Google Scholar] [CrossRef]
  58. Thevenot, D.; Delignette-Muller, M.L.; Christieans, S.; Vernozy-Rozand, C. Prevalence of Listeria monocytogenes in 13 dried sausage processing plants and their products. Int. J. Food Microb. 2005, 102, 85–94. [Google Scholar] [CrossRef]
  59. Mainar, M.S.; Stavropoulou, D.A.; Leroy, F. Exploring the metabolic heterogeneity of coagulase-negative staphylococci to improve the quality and safety of fermented meats: A review. Int. J. Food Microb. 2017, 247, 24–37. [Google Scholar] [CrossRef] [PubMed]
  60. Stellato, G.; La Storia, A.; De Filippis, F.; Borriello, G.; Villani, F.; Ercolini, D. Overlap of spoilage-associated microbiota between meat and the meat processing environment in small-scale and large-scale retail distributions. Appl. Environ. Microb. 2016, 82, 4045–4054. [Google Scholar] [CrossRef] [Green Version]
  61. Andrade, M.J.; Córdoba, J.J.; Casado, E.M.; Córdoba, M.G.; Rodríguez, M. Effect of selected strains of Debaryomyces hansenii on the volatile compound production of dry fermented sausage “salchichón”. Meat Sci. 2010, 85, 256–264. [Google Scholar] [CrossRef]
  62. Cano-García, L.; Rivera-Jiménez, S.; Belloch, C.; Flores, M. Generation of aroma compounds in a fermented sausage meat model system by Debaryomyces hansenii strains. Food Chem. 2014, 151, 364–373. [Google Scholar] [CrossRef]
  63. Núñez, F.; Lara, M.S.; Peromingo, B.; Delgado, J.; Sánchez-Montero, L.; Andrade, M.J. Selection and evaluation of Debaryomyces hansenii isolates as potential bioprotective agents against toxigenic penicillia in dry-fermented sausages. Food Microb. 2015, 46, 114–120. [Google Scholar] [CrossRef] [PubMed]
  64. Encinas, J.P.; López-Díaz, T.M.; García-López, M.L.; Otero, A.; Moreno, B. Yeast populations on Spanish fermented sausages. Meat Sci. 2000, 54, 203–208. [Google Scholar] [CrossRef]
  65. Mižáková, A.; Pipová, M.; Turek, P. The occurrence of moulds in fermented raw meat products. Czech. J. Food Sci. 2002, 20, 89–94. [Google Scholar] [CrossRef] [Green Version]
  66. Ciegler, A.; Mintzlaff, H.J.; Weisleder, D.; Leistner, L. Potential production and detoxification of penicillic acid in mold-fermented sausage (salami). Appl. Microb. 1972, 24, 114–119. [Google Scholar] [CrossRef] [PubMed]
  67. Castellari, C.; Quadrelli, A.M.; Laich, F. Surface mycobiota on Argentinean dry fermented sausages. Int. J. Food Microbiol. 2010, 142, 149–155. [Google Scholar] [CrossRef] [PubMed]
  68. Sonjak, S.; Ličen, M.; Frisvad, J.C.; Gunde-Cimerman, N. The mycobiota of three dry-cured meat products from Slovenia. Food Microbiol. 2011, 28, 373–376. [Google Scholar] [CrossRef]
  69. Zadravec, M.; Vahčić, N.; Brnić, D.; Markov, K.; Frece, J.; Beck, R.; Pleadin, J. A study of surface moulds and mycotoxins in Croatian traditional dry-cured meat products. Int. J. Food Microbiol. 2020, 317, 108459. [Google Scholar] [CrossRef]
Foods 10 01957 g001 550
Figure 1. Relative abundance (%) of bacterial species in artisanal Colonial salami-type dry-fermented sausages. Species with a very small number of reads (relative abundance < 1%) were classified into the category “others”.
Figure 1. Relative abundance (%) of bacterial species in artisanal Colonial salami-type dry-fermented sausages. Species with a very small number of reads (relative abundance < 1%) were classified into the category “others”.
Foods 10 01957 g001
Foods 10 01957 g002 550
Figure 2. Relative abundance (%) of fungal species in artisanal Colonial salami-type dry-fermented sausages. Species with a very small number of reads (relative abundance < 1%) were classified into in the category “others”.
Figure 2. Relative abundance (%) of fungal species in artisanal Colonial salami-type dry-fermented sausages. Species with a very small number of reads (relative abundance < 1%) were classified into in the category “others”.
Foods 10 01957 g002
Table
Table 1. Origin of Colonial salami-type dry-fermented sausages in Santa Catarina State, ripening time and physical-chemical characteristics.
Table 1. Origin of Colonial salami-type dry-fermented sausages in Santa Catarina State, ripening time and physical-chemical characteristics.
SampleCity Ripening (Days)CasingpHMoisture (%)NaCl (%)WPS (%)aw
L01Piratuba40N5.5030.024.3012.500.891
L02Herval Velho16S6.3050.533.706.800.950
L03Jaborá1S6.1051.143.175.800.957
L04Concórdia7S5.1030.206.1516.900.829
L05Luzerna2N5.8050.224.207.700.943
L06Videira9N5.5041.034.329.500.927
L07Salto Veloso12N6.4040.854.7510.400.917
L08Salto Veloso6N5.6038.103.017.300.946
L09Tangará6N6.0056.694.186.900.949
L10Caçador16N6.0028.485.0415.000.857
L11Videira2N6.0043.224.499.400.928
L12Iomerê10N5.7039.024.9211.200.908
L13Lacerdópolis7S5.4039.064.4110.100.920
WPS: water phase salt; aw: water activity; N: natural; S: synthetic.
Table
Table 2. Microbial analyses of Colonial salami-type dry-fermented sausages.
Table 2. Microbial analyses of Colonial salami-type dry-fermented sausages.
SampleTC *TTC *CPS *SRC *LAB *Enterococci *Yeasts *Molds *Salmonella **Listeria spp. **
L012.042.002.001.007.605.898.34<2.00AP
L02<1.00<1.00<2.00<1.006.914.296.647.00AP
L031.701.70<2.00<1.008.323.113.117.30AA
L043.893.81<2.001.486.605.686.814.30AA
L054.734.732.48<1.007.845.788.307.48AP
L062.26<1.00<2.00<1.007.843.637.287.00AA
L071.001.004.73<1.007.866.206.817.30AA
L08<1.00<1.00<2.00<1.007.913.676.787.00AA
L092.081.602.90<1.008.386.257.204.48AA
L10<1.00<1.00<2.00<1.006.793.156.557.30AA
L112.862.282.00<1.006.754.707.477.30AA
L122.002.002.30<1.008.483.877.954.00AP
L13<1.00<1.00<2.001.007.962.306.83<2.00AP
* cfu·log−1; ** Presence (P) or absence (A) in 25 g of sausage; TC: total coliforms; TTC: thermotolerant coliforms; CPS: coagulase-positive staphylococci; SRC: sulfite-reducing clostridia; LAB: lactic acid bacteria.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Degenhardt, R.; Sobral Marques Souza, D.; Acordi Menezes, L.A.; de Melo Pereira, G.V.; Rodríguez-Lázaro, D.; Fongaro, G.; De Dea Lindner, J. Detection of Enteric Viruses and Core Microbiome Analysis in Artisanal Colonial Salami-Type Dry-Fermented Sausages from Santa Catarina, Brazil. Foods 2021, 10, 1957. https://doi.org/10.3390/foods10081957

AMA Style

Degenhardt R, Sobral Marques Souza D, Acordi Menezes LA, de Melo Pereira GV, Rodríguez-Lázaro D, Fongaro G, De Dea Lindner J. Detection of Enteric Viruses and Core Microbiome Analysis in Artisanal Colonial Salami-Type Dry-Fermented Sausages from Santa Catarina, Brazil. Foods. 2021; 10(8):1957. https://doi.org/10.3390/foods10081957

Chicago/Turabian Style

Degenhardt, Roberto, Doris Sobral Marques Souza, Leidiane A. Acordi Menezes, Gilberto Vinícius de Melo Pereira, David Rodríguez-Lázaro, Gislaine Fongaro, and Juliano De Dea Lindner. 2021. "Detection of Enteric Viruses and Core Microbiome Analysis in Artisanal Colonial Salami-Type Dry-Fermented Sausages from Santa Catarina, Brazil" Foods 10, no. 8: 1957. https://doi.org/10.3390/foods10081957

APA Style

Degenhardt, R., Sobral Marques Souza, D., Acordi Menezes, L. A., de Melo Pereira, G. V., Rodríguez-Lázaro, D., Fongaro, G., & De Dea Lindner, J. (2021). Detection of Enteric Viruses and Core Microbiome Analysis in Artisanal Colonial Salami-Type Dry-Fermented Sausages from Santa Catarina, Brazil. Foods, 10(8), 1957. https://doi.org/10.3390/foods10081957

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop