Development of an Event-Specific Droplet Digital PCR Assay for Quantification and Evaluation of the Transgene DNAs in Trace Samples of GM PRNP-Knockout Goat
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Test Materials
2.2. DNA Extraction and Purification
2.3. Oligonucleotide Primers and Probes
2.4. Conventional PCR
2.5. ddPCR
2.6. Performance Evaluation of the Event-Specific ddPCR Assay
2.7. ddPCR Analysis of Practical Samples
3. Results and Discussion
3.1. The Event-Specific ddPCR Assay of GM Goat Event KoP1 Has High Specificity
3.2. KoP1 ddPCR Assay Presents Higher Sensitivity than qPCR
3.3. The KoP1 ddPCR Assay Has Wide Dynamic Range and Good Repeatability
3.4. KoP1 ddPCR Quantification Results Were Accurate in Simulated Samples
3.5. KoP1 ddPCR Assay Was Successfully Applied to Practical Trace Samples Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lai, L.; Kolber-Simonds, D.; Park, K.W.; Cheong, H.T.; Greenstein, J.L.; Im, G.-S.; Samuel, M.; Bonk, A.; Rieke, A.; Day, B.N.; et al. Production of α-1, 3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 2002, 295, 1089–1092. [Google Scholar] [CrossRef] [PubMed]
- Kuroiwa, Y.; Kasinathan, P.; Matsushita, H.; Sathiyaselan, J.; Sullivan, E.J.; Kakitani, M.; Tomizuka, K.; Ishida, I.; Robl, J.M. Sequential targeting of the genes encoding immunoglobulin-μ and prion protein in cattle. Nat. Genet. 2004, 36, 775–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ledford, H. Salmon approval heralds rethink of transgenic animals. Nature 2015, 527, 417. [Google Scholar] [CrossRef] [PubMed]
- CAC. Guideline for the Conduct of Food Safety Assessment of Foods Derived from Recombinant-DNA Animals; FAO: Geneva, Switzerland; WHO: Geneva, Switzerland, 2008.
- Moghissi, A.A.; Jaeger, L.M.; Shafei, D.; Bloom, L.L. Regulatory science requirements of labeling of genetically modified food. Crit. Rev. Biotechnol. 2017, 38, 386–393. [Google Scholar] [CrossRef]
- Rupert, H.; Niccolo, B.; Anke, B.; Ottmar, G.; Lutz, G.; Joachim, K.; Marco, M.; Roy, M.; Elena, P. European Network of GMO Laboratories: Working Group “Seed Testing” (WG-ST): Working Group Report; European Union Reference Laboratory for Genetically Modified Food and Feed, JRC Science Hub: Brussels, Belgium, 2015. [Google Scholar]
- Alarcon, C.M.; Shan, G.; Layton, D.T.; Bell, T.A.; Whipkey, S.; Shillito, R.D. Application of DNA-and protein-based detection methods in agricultural biotechnology. J. Agric. Food Chem. 2019, 67, 1019–1028. [Google Scholar] [CrossRef]
- Kamle, S.; Ali, S. Genetically modified crops: Detection strategies and biosafety issues. Gene 2013, 522, 123–132. [Google Scholar] [CrossRef]
- Zhang, D.; Guo, J.C. The development and standardization of testing methods for genetically modified organisms and their derived products. J. Integr. Plant Biol. 2011, 53, 539–551. [Google Scholar] [CrossRef]
- Yang, L.; Chen, Y.; Li, R.; Xu, W.; Cui, J.; Zhang, D.; Zhang, X. Universal LNA Probe-Mediated Multiplex Droplet Digital Polymerase Chain Reaction for Ultrasensitive and Accurate Quantitative Analysis of Genetically Modified Organisms. J. Agric. Food Chem. 2021, 69, 1705–1713. [Google Scholar] [CrossRef]
- Li, R.; Chen, J.; Zhang, X.; Cui, J.; Tao, S.; Yang, L. Mini-Disk Capillary Array Coupling with LAMP for Visual Detection of Multiple Nucleic Acids using Genetically Modified Organism Analysis as an Example. J. Agric. Food Chem. 2020, 68, 899–906. [Google Scholar] [CrossRef]
- Hafsa, A.B.; Nabi, N.; Zellama, M.S.; Said, K.; Chaouachi, M. A new specific reference gene based on growth hormone gene (GH1) used for detection and relative quantification of Aquadvantage® GM salmon (Salmo salar L.) in food products. Food Chem. 2016, 190, 1040–1045. [Google Scholar] [CrossRef]
- Xu, W.T.; Cui, J.J.; Liu, B.; Yang, L.T. An Event-Specific Real-Time PCR Method for Measuring Transgenic Lysozyme Goat Content in Trace Samples. Foods 2021, 10, 925. [Google Scholar] [CrossRef] [PubMed]
- Baker, M. Digital PCR hits its stride. Nat. Methods 2012, 9, 541–544. [Google Scholar] [CrossRef]
- Demeke, T.; Dobnik, D. Critical assessment of digital PCR for the detection and quantification of genetically modified organisms. Anal. Bioanal. Chem. 2018, 410, 4039–4050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collier, R.; Dasgupta, K.; Xing, Y.P.; Hernandez, B.T.; Shao, M.; Rohozinski, D.; Kovak, E.; Lin, J.; de Oliveira, M.L.P.; Stover, E.; et al. Accurate measurement of transgene copy number in crop plants using droplet digital PCR. Plant J. 2017, 90, 1014–1025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kosir, A.B.; Demsar, T.; Stebih, D.; Zel, J.; Milavec, M. Digital pcr as an effective tool for gmo quantification in complex matrices. Food Chem. 2019, 294, 73–78. [Google Scholar] [CrossRef] [PubMed]
- Scollo, F.; Egea, L.A.; Gentile, A.; Malfa, S.L.; Dorado, G.; Hernandez, P. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies. Food Chem. 2016, 213, 388–394. [Google Scholar] [CrossRef]
- Deconinck, D.; Hostens, K.; Taverniers, I.; Volckaert, F.A.; Robbens, J.; Derycke, S. Identification and semi-quantification of Atlantic salmon in processed and mixed seafood products using Droplet Digital PCR (ddPCR). Food Chem. Toxicol. 2021, 154, 112329. [Google Scholar] [CrossRef]
- Köppel, R.; Bucher, T.; Frei, A.; Waiblinger, H.U. Droplet digital PCR versus multiplex real-time PCR method for the detection and quantification of DNA from the four transgenic soy traits MON87769, MON87708, MON87705 and FG72, and lectin. Eur. Food Res. Technol. 2015, 241, 521–527. [Google Scholar] [CrossRef]
- Moser, D.A.; Braga, L.; Raso, A.; Zacchigna, S.; Giacca, M.; Simon, P. Transgene detection by digital droplet PCR. PLoS ONE 2014, 9, e111781. [Google Scholar] [CrossRef] [Green Version]
- Aguzzi, A.; Glatzel, M. Prion infections, blood and transfusions. Nat. Clin. Pract. Neurol. 2006, 2, 321–329. [Google Scholar] [CrossRef]
- Yu, G.H. Preparation and Related Studies of Prion Protein Gene (PRNP) Knockout Goats; Graduate School of Chinese Academy of Sciences (Shanghai Academy of Life Sciences): Shanghai, China, 2006. [Google Scholar]
- Wang, Q.; Cai, Y.; He, Y.; Yang, L.; Li, J.; Pan, L. Droplet digital PCR (ddPCR) method for the detection and quantification of goat and sheep derivatives in commercial meat products. Eur. Food Res. Technol. 2018, 244, 767–774. [Google Scholar] [CrossRef]
- Marchesi, U.; Mazzara, M.; Broll, H.; Giacomo, M.D.; Woll, K.; European Network of GMO Laboratories (ENGL). Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing. 2015. Available online: https://gmo-crl.jrc.ec.europa.eu/doc/MPRReportApplication20_10_2015.pdf (accessed on 2 March 2022).
- Huggett, J.F.; Foy, C.A.; Benes, V.; Emslie, K.; Garson, J.A.; Haynes, R.; Hellemans, J.; Kubista, M.; Mueller, R.D.; Nolan, T.; et al. The digital MIQE guidelines: Minimum information for publication of quantitative digital PCR experiments. Clin. Chem. 2013, 59, 892–902. [Google Scholar] [CrossRef] [PubMed]
- The dMIQE Group; Huggett, J.F. The Digital MIQE Guidelines Update: Minimum Information for Publication of Quantitative Digital PCR Experiments for 2020. Clin. Chem. 2020, 66, 1012–1029. [Google Scholar] [CrossRef] [PubMed]
- Nawaz, M.A.; Mesnage, R.; Tsatsakis, A.M.; Golokhvast, K.S.; Yang, S.H.; Antoniou, M.N.; Chung, G. Addressing concerns over the fate of DNA derived from genetically modified food in the human body: A review. Food Chem. Toxicol. 2019, 124, 423–430. [Google Scholar] [CrossRef] [PubMed]
- Dong, S.; Zhang, D.; Yu, C.; Zhang, Z.; Liu, Y. Using droplet digital PCR to detect plant DNA in tissues of zebrafish (Danio rerio) fed genetically modified maize. Aquac. Res. 2021, 52, 4467–4474. [Google Scholar] [CrossRef]
- Yu, Y.J.; Majumdar, A.P.; Nechvatal, J.M.; Ram, J.L.; Basson, M.D.; Heilbrun, L.K.; Kato, I. Exfoliated cells in stool: A source for Reverse Transcription-PCR–based analysis of biomarkers of gastrointestinal cancer. Cancer Epidemiol. Biomark. Prev. 2008, 17, 455–458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, N.; Suliman, I.; Bandaletova, T.; Obichere, A.; Lywood, R.; Loktionov, A. Protein biomarkers in exfoliated cells collected from the human rectal mucosa: Implications for colorectal disease detection and monitoring. Int. J. Colorectal Dis. 2011, 26, 1287–1297. [Google Scholar] [CrossRef] [PubMed]
- Bao, Z.; Gao, X.; Zhang, Q.; Lin, J.; Hu, W.; Yu, H.; Chen, J.; Yang, Q.; Yu, Q. The effects of GH transgenic goats on the microflora of the intestine, feces and surrounding soil. PLoS ONE 2015, 10, e0139822. [Google Scholar] [CrossRef] [Green Version]
Assay | Primer/Probe | Sequence (5′–3′) | Amplicon (bp) |
---|---|---|---|
KoP1 | GM-Prion-F | TGCTGACACCCTCTTTATTTTGC | 131 |
GM-Prion-R | GATTGTCTGTTGTGCCCAGTC | ||
GM-Prion-P | FAM-TAGCCGAATAGCCTCTCCACCCAAGCG-BHQ1 | ||
PRLR | Goat-F | CCAACATGCCTTTAAACCCTCAA | 88 |
Goat-R | GGAACTGTAGCCTTCTGACTCG | ||
Goat-P | FAM-TGCCTTTCCTTCCCCGCCAGTCTC-BHQ1 |
Template Amounts (HGE/Per Reaction) | Accept Droplets | Tested HGE Copies | SD | RSD | Bias | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Rep 1 | Rep 2 | Rep 3 | Rep 1 | Rep 2 | Rep 3 | Mean | |||||
4500 | 13,025 | 12,904 | 12,867 | 3940 | 4260 | 4300 | 4166.67 | 197.32 | 4.74% | −7% | |
900 | 15,641 | 14,028 | 14,350 | 956 | 842 | 816 | 871.33 | 74.47 | 8.55% | −3% | |
180 | 12,585 | 13,493 | 12,323 | 186 | 174 | 188 | 182.67 | 7.57 | 4.15% | 1% | |
36 | 13,313 | 13,008 | 15,371 | 40 | 40 | 46 | 42.00 | 3.46 | 8.25% | 17% | |
7.2 | 14,878 | 14,432 | 13,456 | 6.6 | 6.2 | 8.4 | 7.07 | 1.17 | 16.58% | −2% | |
1.44 | 13,718 | 13,506 | 13,241 | 3.2 | 3.4 | 3.6 | 3.40 | 0.20 | 5.88% | 136% | |
0.29 | / | / | / | / | / | / | / | / | / | / | / |
Template Amounts (HGE/per Reaction) | Tested HGE Copies | SD | RSD | Bias | |||
---|---|---|---|---|---|---|---|
Rep1 | Rep2 | Rep3 | Average | ||||
16,000 | 16,640 | 16,220 | 15,480 | 16,113.33 | 587.31 | 3.64 | 0.71 |
1600 | 1480 | 1580 | 1640 | 1566.67 | 80.83 | 5.16 | −2.08 |
160 | 138 | 144 | 154 | 145.33 | 8.08 | 5.56 | −9.17 |
50 | 62 | 58 | 50 | 56.67 | 6.11 | 10.78 | 13.33 |
25 | 22 | 22 | 19 | 21.00 | 1.73 | 8.25 | −16.00 |
10 | 14 | 12 | 9 | 11.67 | 2.52 | 21.57 | 16.67 |
7.2 | 6.9 | 8.2 | 7.8 | 7.63 | 0.67 | 8.72 | 6.02 |
5 | 2.3 | 8.6 | 3.1 | 4.67 | 3.43 | 73.50 | −6.67 |
1 | / | / | / | / | / | / | / |
Sample (GM Content, %) | Assay | Accept Droplets | Tested HGE Copies | SD | RSD | GM Content | Bias | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Rep 1 | Rep 2 | Rep 3 | Rep 1 | Rep 2 | Rep 3 | Average | ||||||
B1 (1.7%) | KoP1 | 14,980 | 14,900 | 12,480 | 138 | 138 | 132 | 136.00 | 3.46 | 2.55% | 1.71% | 0.59% |
PRLR | 10,643 | 10,877 | 11,500 | 7620 | 8100 | 8180 | 7966.67 | 302.88 | 3.80% | |||
B2 (0.85%) | KoP1 | 16,542 | 15,859 | 12,803 | 62 | 65 | 74 | 67.00 | 6.24 | 9.32% | 0.86% | 1.18% |
PRLR | 11,854 | 10,364 | 11,925 | 7520 | 7500 | 8280 | 7766.67 | 444.67 | 5.73% | |||
B3 (0.5%) | KoP1 | 11,069 | 16,058 | 11,970 | 46 | 44 | 40 | 43.33 | 3.06 | 7.05% | 0.55% | 10.00% |
PRLR | 11,854 | 11,925 | 11,500 | 7690 | 7780 | 7960 | 7810.00 | 137.48 | 1.76% | |||
B4 (0.25%) | KoP1 | 11,441 | 13,213 | 13,213 | 20 | 24 | 22 | 22.00 | 2.00 | 9.09% | 0.28% | 12.00% |
PRLR | 12,764 | 11,642 | 12,850 | 7910 | 7790 | 8040 | 7913.33 | 125.03 | 1.58% |
Sample Type | Sample Name | Animal Type | KoP1 Event-Specific Assay | Goat Species Assay | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Tested Copies Per Reaction | SD | RSD | Tested Copies Per Reaction | SD | RSD | |||||||||
Rep 1 | Rep 2 | Rep 3 | Mean | Rep 1 | Rep 2 | Rep 3 | Mean | |||||||
Milk | 46 | GM | 1340 | 1340 | 1360 | 1346.7 | 11.55 | 0.86% | 1568 | 1610 | 1520 | 1566.0 | 45.03 | 2.88 |
323 | GM | 984 | 1056 | 1020 | 1020.0 | 36.00 | 3.53% | 1010 | 1050 | 1028 | 1029.3 | 20.03 | 1.95 | |
1606 | GM | 910 | 958 | 890 | 919.3 | 34.95 | 3.80% | 906 | 942 | 930 | 926.0 | 18.33 | 1.98 | |
1608 | GM | 820 | 830 | 848 | 832.7 | 14.19 | 1.70% | 804 | 796 | 782 | 794.0 | 11.14 | 1.40 | |
Fresh Feces | F1 | GM | N | N | N | / | / | / | N | N | N | / | / | / |
F2 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F3 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F4 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F5 | GM | 12 | 8 | N | 10 | 2.83 | 28.30% | 14 | 12 | 9 | 11.7 | 2.52 | 21.57 | |
F6 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F7 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F8 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F9 | GM | 11 | 24 | 8 | 14.3 | 8.5 | 59.34% | 8 | 6.4 | 4.6 | 6.3 | 1.70 | 26.86 | |
F10 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F11 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F12 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F13 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F14 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F15 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F16 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
F17 | Non-GM | N | N | N | / | / | / | 20.8 | 24.6 | 16 | 20.5 | 4.31 | 21.06 | |
F18 | Non-GM | N | N | N | / | / | / | N | N | N | / | / | / | |
Compost Soil | P1 | GM | N | N | N | / | / | / | N | N | N | / | / | / |
P2 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
P3 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
P4 | GM | N | N | N | / | / | / | N | N | N | / | / | / | |
P5 | GM | N | N | N | / | / | / | N | N | N | / | / | / |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, W.; Shen, P.; Li, R.; Liu, B.; Yang, L. Development of an Event-Specific Droplet Digital PCR Assay for Quantification and Evaluation of the Transgene DNAs in Trace Samples of GM PRNP-Knockout Goat. Foods 2022, 11, 868. https://doi.org/10.3390/foods11060868
Xu W, Shen P, Li R, Liu B, Yang L. Development of an Event-Specific Droplet Digital PCR Assay for Quantification and Evaluation of the Transgene DNAs in Trace Samples of GM PRNP-Knockout Goat. Foods. 2022; 11(6):868. https://doi.org/10.3390/foods11060868
Chicago/Turabian StyleXu, Wenting, Ping Shen, Rong Li, Biao Liu, and Litao Yang. 2022. "Development of an Event-Specific Droplet Digital PCR Assay for Quantification and Evaluation of the Transgene DNAs in Trace Samples of GM PRNP-Knockout Goat" Foods 11, no. 6: 868. https://doi.org/10.3390/foods11060868