Next Article in Journal
Identification of Small-Molecule Bioactive Constituents from the Leaves of Vaccinium bracteatum Confirms It as a Potential Functional Food with Health Benefits
Previous Article in Journal
Investigations into Determinants of Blueberry Coating Effectiveness
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 12
Issue 1
10.3390/foods12010175
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Protein Requirements of Oncorhynchus mykiss Cultured in the Convection-Water Cages by Evaluating Growth, Body Composition and Liver Health

by
Wei Zhao
,
Yu-Cai Guo
,
Rong Yao
,
An-Qi Chen
,
Bao-Yang Chen
and
Jin Niu
*
State key Laboratory of Biocontrol, Guangdong Provincial Key Laboratory for Aquatic Economic Animals and Southern Marine Science and Engineering Guangdong Laboratory (Zhuhai), School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, China
*
Author to whom correspondence should be addressed.
Foods 2023, 12(1), 175; https://doi.org/10.3390/foods12010175
Submission received: 22 November 2022 / Revised: 21 December 2022 / Accepted: 26 December 2022 / Published: 1 January 2023
(This article belongs to the Section Food Nutrition)
Browse Figures
Versions Notes

Abstract

:
The diet formulation for trout has changed dramatically over the last decade due to changes in the ingredient markets and advances in feed processing technology. The protein requirements of Oncorhynchus mykiss were established at the end of the last century, and it is unclear whether these requirements are applicable to modern dietary formulations. Therefore, an eight-week feeding trial was performed to measure the protein requirements of O. mykiss by evaluating growth, body composition, antioxidation property, innate immune response and liver morphology. The five experimental diets were prepared to contain the same levels of crude lipid (120 g/kg) and graded levels of crude protein (356.3, 383.9, 411.5, 439.2 and 466.8 g/kg). The results suggested that the growth, feed utilization and whole-body crude protein levels were significantly increased when fish were fed diets containing 439.2 and 466.8 g/kg crude protein. Meanwhile, low dietary protein levels (356.3 and 383.9 g/kg) significantly down-regulated the mRNA levels of insulin-like growth factor I, catalase, glutathione peroxidase, superoxide dismutase, complement 3 and lysozyme, and also up-regulated the insulin-like growth factor binding protein 1 as well as proinflammatory cytokine expression in the liver, including interleukin 1β, interleukin 8 and tumor necrosis factor-α. Moreover, low dietary protein levels (356.3 and 383.9 g/kg) damaged liver structure, suppressed total antioxidative capacity and increased the malondialdehyde content in liver. In conclusion, high dietary protein (439.2 and 466.8 g/kg) promoted fish growth, while low dietary protein (356.3 and 383.9 g/kg) damaged liver structure, induced oxidative stress and inflammatory responses and weakened non-specific immunity. The protein requirement of O. mykiss reared in the convection-water cages is no less than 439.2 g/kg for optimal growth, antioxidant and immune properties.

1. Introduction

Protein is crucial to the growth and metabolism of fish because it provides amino acids for tissue renewal and synthesis of body protein, and is also the main component of metabolically active substances (enzymes and antibodies). In intensive aquaculture, feeds account for nearly 50–60% of the total production costs [1]. Protein is the most expensive macronutrient in fish feed, such that the economic benefits of fish production are closely related to dietary protein levels. Both excessive and inadequate dietary protein levels would inhibit fish growth and suppress immune functions and antioxidant properties [2,3,4]. Furthermore, excess dietary protein would be broken down into energy, thereby increasing ammonia emissions and reducing the quality of discharged aquaculture tailwater [2,5]. Accordingly, it is beneficial to investigate the dietary protein requirements of farmed fish for the purpose of saving breeding costs and formulating environment-friendly feed.
Rainbow trout (Oncorhynchus mykiss) is an important commercially farmed cold-water fish in the worldwide with an annual production of 959,600 ton in 2020 [6]. Some studies have reported the protein requirements of O. mykiss by evaluating growth rate and feed utilization [2,7]. The protein requirement of O. mykiss cultured in an indoor flow-through freshwater system ranges from 36% to 48% [7], whereas that cultured in an indoor flow-through seawater system ranges from 40–45% [2]. In addition, protein requirements vary with the size and growth stage of the fish, with juveniles requiring more protein than larger trout [8]. In previous studies, the protein requirement of O. mykiss was assessed with a fixed dietary lipid level of about 20% [2,9]. However, a high dietary lipid level is not conducive to feed production and preservation, and reduces the diameter and number of white muscle fibers, which affects the taste and quality of fish fillets [10]. Furthermore, the diet formulation of trout has changed considerably over the last decade due to changes in the ingredient markets, advances in feed processing technology and the emergence of faster-growing strains of trout. Therefore, it is necessary to assess the protein requirements of O. mykiss trout under a moderate-fat level and modern feed ingredients, which is beneficial to improve the quality of fish fillets and the market price of the product. In addition, the effects of dietary protein level on liver morphology, oxidation resistance and immune response of O. mykiss cultured in the convection-water cages remain unknown.
In this study, diets with fixed carbohydrate (100 g/kg), lipid levels (120 g/kg) and graded protein levels were used to determine the protein requirements of O. mykiss cultured in the convection-freshwater cages. The effects of dietary protein level on the growth performance and health of O. mykiss were evaluated by growth performance, body composition, antioxidant properties, immune response and liver morphology.

2. Materials and Methods

2.1. Test Diets

The five experimental diets were prepared to contain the same levels of crude lipid and carbohydrate and graded levels of crude protein (356.3, 383.9, 411.5, 439.2 and 466.8 g/kg), which were named P1, P2, P3, P4 and P5, respectively (Table 1). The experimental diet consisted of fish meal, soybean meal, black soldier fly (Hermetia illucens) larvae meal, soy protein concentrate, krill meal and chicken meal as protein sources; fish oil and soybean lecithin as lipid sources; and wheat flour as a carbohydrate source, supplemented with methionine, lysine and threonine to meet the nutritional requirements of O. mykiss. All ingredients were finely crushed and sieved through an 80-mesh sieve, and then weighed according to the amount required by the formula. All the required ingredients were mixed evenly, and then fish oil, soybean lecithin and water were added for further mixing. Finally, pellets with a diameter of 3.5 mm were obtained and dried in a room with a constant temperature (20 °C) to reduce the moisture to about 10%. All experimental diets were stored at −20 °C until used.

2.2. Feeding Trial

Nutrient feeding trials were conducted in a commercial fishery (Qinghai, China), and cages were placed in the upper reaches of the Yellow River (101. 0′27″ E, 36.8′22″ N). Fish adapted to the experimental environment for 2 weeks before the formal feeding trial, during which they were fed with commercial feed (41% crude protein, 24% crude lipid, Aller Aqua, Qingdao, China) twice a day (7:30 and 17:30) to satiation status. Thereafter, six hundred healthy and energetic fish with an initial weight of 15.82 ± 0.27 g were randomly distributed in 20 cages (2.8 m × 2.7 m × 2 m). Each experimental diet was randomly assigned to 4 cages at a density of 30 fish per cage. Fish were fed to satiation status twice a day for 56 days at 7:30 and 17:30. Throughout the feeding trial, water temperature ranged from 12–15 °C, and dissolved oxygen was above 6.0 mg/L. The feed intake of the fish per cage was recorded daily.

2.3. Sampling

After the feeding trial, all fish were deprived of feed for 24 h and then anesthetized with 20 mg L−1 of tricaine methanesulfonate (MS-222, Sigma-Aldrich, St. Louis, MO, USA). Subsequently, all fish per cage were counted and weighed individually to calculate growth parameters and survival rates. Five fish were randomly sampled from each cage and stored at −20 °C for proximate composition analysis of the whole body. A segment of liver tissue from another 6 fish per cage were rapidly deprived, frozen in liquid nitrogen and then stored at −80 °C for enzyme activity and gene transcription level analysis. Finally, three fish were randomly selected from each cage and a segment of liver tissue was cut with a sharp scalpel, then stored in 4% paraformaldehyde solution for liver morphology observation.

2.4. Chemical Analysis

Crude protein, crude lipid and moisture of both the experimental diets and the whole body were quantified according to Association of Official Analytical Chemists (AOAC) [11] methods. The carbohydrate contents of experimental diets were determined by anthrone colorimetry method [12]. The estimated energy of experimental diets was calculated based on previously reported methods [13], where the energy values of protein, lipid and carbohydrate were considered to be 16.7, 37.6 and 16.7 kJ/g, respectively.

2.5. Anti-Oxidative Parameters Analysis

A 10% liver homogenate was prepared under ice-cold conditions. Subsequently, the homogenate was centrifuged at 5000 rpm for 20 min at 4 °C to obtain the supernatant for analysis of malondialdehyde (MDA) content, superoxide dismutase (SOD) activity and total antioxidant capacity (T-AOC). Anti-oxidative parameters were examined using the corresponding detection kits (Jiancheng Bioengineering Institute, Nanjing, China).

2.6. Liver Morphology Analysis

Liver specimens immobilized in a 4% paraformaldehyde solution were dehydrated with gradient alcohol (70–95%), and then the specimens were embedded in paraffin for subsequent sectioning. Sections with a thickness of 5 microns were obtained and stained with hematoxylin and eosin. An optical microscope (Nikon Eclipse Ni-U, Tokyo, Japan) was used to capture the images and identify liver morphology.

2.7. Gene Expression Analysis

The total RNA of liver specimens from each cage was isolated using a RNAeasy™ Plus Animal RNA Isolation Kit (Beyotime, Shanghai, China) according to the supplier’s instructions. The integrity of the isolated RNA was examined by electrophoresis on a 1% agarose gel, and then its concentration and purity (OD 260/280) was tested using a spectrophotometer (NanoDrop 2000, Thermo scientific, Waltham, MA, USA). Reverse transcription was performed using a reagent kit (PrimeScript RT Reagent kit with gDNA Eraser, TaKaRa, Dalian, China), following the instructions. Likewise, the concentration and purity of cDNA were detected using a NanoDrop spectrophotometer, and then the cDNA was diluted to the same concentration with diethylpyrocarbonate (DEPC) water for the following real-time quantitative PCR. The transcription level of the target gene was measured according to a procedure mentioned in previous research [14]. The relative mRNA expression level of the target gene was calculated based on the 2−ΔΔCT method, where β-actin was set as internal control gene. The gene-specific primers are shown in Table 2.

2.8. Calculations and Statistical Analysis

The weight gain rate (WGR), specific growth ratio (SGR), feed conversion ratio (FCR) and survival rate (SR) were calculated according to the equation previously reported [15].
The data were showed as means ± standard error (SE), and were subjected to one-way ANOVA using SPSS26.0. The data were evaluated for homogeneity and normality by the Levene’s test and the Kolmogorov–Smirnov test, respectively. Duncan’s multiple range test was used to compare whether the effect of dietary protein level on experimental parameters was significant. In addition, all data were compared by orthogonal polynomials to confirm whether there were linear or quadratic effects of dietary protein levels on experimental parameters. p < 0.05 was considered statistically significant.

3. Results

3.1. Biological Performance

The SR, feed utilization (FCR) and growth parameters (final body weight (FBW), WGR and SGR) are given in the Table 3. FBW, WGR, SGR and FCR were remarkedly affected by dietary protein levels, and showed both linear and quadratic effects (p < 0.05). The growth parameters of fish fed the P4 and P5 diets were obviously higher than those fed the other diets (p < 0.05), whereas a lower FCR was observed for the P4 and P5 diets (p < 0.05). The highest values of growth parameters and the lowest FCR were found in the P5 diet. The SR was not affected by the experimental diets (p > 0.05).

3.2. Proximate Compositions of the Whole Body

The crude protein was linearly and quadratically enhanced by dietary protein levels (p < 0.05) (Table 4). The fish fed the P5 diets showed the maximum crude protein, with a significant difference from that of other groups (p < 0.05). However, the crude lipid and moisture did not show any significant differences (p > 0.05).

3.3. Antioxidant Parameters

Experimental diets remarkedly influenced the MDA content, SOD activity and T-AOC in the liver, and also showed linear and quadratic effects (p < 0.05) (Figure 1). The fish fed the P3, P4 and P5 diets showed higher SOD activity and T-AOC, as well as lower MDA content, than those fed the P1 and P2 diet (p < 0.05).

3.4. Morphological Observation of the Liver

The hepatocytes of the P3, P4 and P5 diets were regular in shape and closely arranged, with nuclei located in the center, and no obvious pathological symptoms were observed. However, hepatocytes of P1 and P2 diets contained numerous vacuoles of varying sizes, and nuclear migration occurred (Figure 2).

3.5. Genes Transcription Levels

The transcription levels of the growth-related genes in the liver were markedly influenced by dietary protein levels (p < 0.05) (Figure 3). Insulin-like growth factor I (IGF-I) expression increased linearly and quadratically with the increase in the protein level, whereas insulin-like growth factor binding protein 1 (IGFBP1) expression decreased linearly and quadratically. P4 and P5 diets significantly up-regulated IGF-I expression and down-regulated IGFBP1 expression compared to those fed the P1, P2 and P3 diets (p < 0.05).
The transcription levels of antioxidant-related genes in the liver are given in Figure 4. Catalase (CAT), glutathione peroxidase (GSH-PX) and SOD expressions increased linearly and quadratically with the increase in protein levels. Fish fed the P3, P4 and P5 diets showed significantly higher transcription levels of CAT, GSH-PX and SOD than those fed the P1 and P2 diets (p < 0.05).
Dietary protein levels obviously affected the transcription levels of inflammation-related genes in the liver (Figure 5) (p < 0.05). The transcription abundances of interleukin 1β (IL-1β), interleukin 8 (IL-8) and tumor necrosis factor-α (TNF-α) decreased linearly and quadratically with the increasing protein levels. The P3, P4 and P5 diets markedly down-regulated IL-1β, IL-8 and TNF-α transcription abundances compared to those fed the P1 and P2 diets (p < 0.05).
Dietary protein levels had a significant effect on transcription levels of immune-related genes in the liver (Figure 6) (p < 0.05). Complement 3 (C3) and lysozyme (Lyz) transcription abundances increased linearly and quadratically with the increase in protein levels. Compared with the P1 and P2 diets, C3 and Lyz expressions were obviously elevated in the P3, P4 and P5 diets (p < 0.05).

4. Discussion

4.1. Growth and Feed Utilization

In this study, the WGR and SGR showed linear and quadratic increases with increasing dietary protein levels, and the optimal growth rate was obtained when the crude protein level was 466.8 g/kg. Lesiow et al. [16] indicated that a diet containing 360 g/kg crude protein and 160 g/kg crude lipid could meet the nutritional requirements of O. mykiss cultured in an indoor circulating freshwater system. Moreover, a previous study suggested that the optimal crude protein and crude lipid requirements of O. mykiss in an indoor flow-through system ranged from 400–450 g/kg and 150–200 g/kg, respectively [17]. Seemingly, the protein requirement of O. mykiss in outdoor convection-water cages was higher than that of those in indoor flow-through system, which may be attributed to the fact that fish in outdoor convection-water cages require more energy for movement and to cope with various environmental stresses. The findings of this study demonstrate that a diet with a crude lipid level of about 120 g/kg and a crude protein level of less than 439.2 g/kg cannot meet the nutritional requirements of O. mykiss reared in outdoor convection-water cages, and the optimal protein requirement is at least 466.8 g/kg. Likewise, Ahmed and Ahmad [18] suggested that a diet with a fixed crude lipid (140 g/kg) and 450–471 g/kg crude protein level was recommended for freshwater-farmed O. mykiss with an initial weight of 1.56 ± 0.22 g, in order to obtain the best growth rate. Differences in the protein requirements of O. mykiss can be attributed to differences in dietary lipid levels, growth stages, protein sources and farming conditions (salinity, temperature and farming systems).
The FCR reflects the efficiency of fish using feed for growth purposes. In this study, lower FCR values were found at dietary protein levels below 439.2 g/kg, consistent with trends in growth performance. These findings are consistent with those of previous studies on O. mykiss [2,18], where optimal dietary protein levels significantly improved growth performance and inhibited FCR, whereas excess or deficiency resulted in poor growth and FCR. Similar phenomena were also reported in genetically improved farmed tilapia [3], Misgurnus anguillicaudatus [19] and Argyrosomus regius [20]. The increase in fish growth caused by optimal dietary protein may be partly attributed to the improvement of nutrient utilization.
IGF-I, a peptide hormone, is produced primarily by the liver and is involved in the regulation of cell proliferation, differentiation, growth and apoptosis [21]. IGF-I is regulated by nutritional status and nutrient metabolism, thereby affecting the growth and development of vertebrates [3]. IGF-I activation is regulated by membrane receptors for insulin-like growth factors, and IGFBPs can suppress or boost IGF-I activity by modulating IGF-I receptor availability in target tissues, primarily in liver tissues [21,22]. IGFBP1, one of the major IGFBPs, is able to prevent IGF-I from interacting with its receptor to suppress IGF-I activity in fish [21,23]. In this study, hepatic IGF-I expression was remarkedly up-regulated in the diets with 439.2 and 466.8 g/kg protein levels, while IGFBP1 expression showed the opposite trend. The findings are consistent with those of WG and SGR in this study. Previous studies have shown that the high expression of IGFBP1 in the liver inhibited the growth-promoting actions of the GH/IGF axis and led to the poor growth of O. mykiss [24,25]. Likewise, Liu et al. [2] suggested that the optimal protein level significantly improved growth performance and hepatic IGF-I expression, and inhibited hepatic IGFBP1 expression in O. mykiss. Gao et al. [26] also reported that inadequate dietary protein inhibited IGF-I expression and caused poor growth in Epinephelus lanceolatus. These results suggest that optimal dietary protein could boost the growth performance of O. mykiss by promoting hepatic IGF-I expression and inhibiting hepatic IGFBP1 expression.

4.2. Proximate Composition of the Whole Body

Fish growth depends on the deposition of nutrients in the body tissues, especially protein, which is the primary component of the dry-weight basis of flesh and the whole body [27]. In this study, the whole-body crude protein levels in the 439.2 g/kg and 466.8 g/kg dietary crude protein feeding groups were higher than those in the other groups, which was consistent with the results of WG and SGR. Therefore, inadequate dietary protein results in low protein deposition in the whole body, which, in turn, leads to poor growth. Likewise, Gao et al. [26] reported that optimal dietary protein could boost the whole-body crude protein level and growth performance of E. lanceolatus, while the dietary protein level has less effect on the whole-body crude lipid content. Liu et al. [2] also reported that optimal dietary protein significantly improved the growth performance of O. mykiss, which can be partly attributed to protein and lipid deposition in the whole body. A similar phenomenon has been reported in genetically improved farmed tilapia and Caranx ignobilis, where dietary protein levels affect protein deposition in the whole body and, thus, affect fish growth [3,28]. The effect of dietary protein levels on the whole-body protein content is dose-dependent, and the growth rate of fish reaches its maximum when body protein content is at its maximum [29]. The findings of this study suggest that optimum dietary protein levels promote protein synthesis in fish tissues, which contributes to the improvement of fish growth.

4.3. Liver Morphology and Inflammatory Response

Tissue morphology can directly show the health status of fish. In this study, low dietary protein (356.3 and 383.9 g/kg) resulted in hepatocyte vacuolation and nuclear migration. Likewise, Liu et al. [30] indicated that inadequate dietary protein resulted in abnormal liver morphology in Oreochromis niloticus, including enlargement of the area of vacuolation and nuclear migration. Sun et al. [31] also reported that insufficient dietary protein led to hepatocyte vacuolization, while excessive dietary protein resulted in enlarged hepatocytes, steatosis and formation of a large number of lipid droplets in Aristichthys nobilis. The vacuoles are mainly composed of lipids and glycogen, and the increase in its quantity and area is closely related to the liver’s abnormal metabolism [32]. The vacuolation of hepatocytes and liver injury caused by low dietary protein may be attributed to abnormal metabolism [33]. The liver plays a key role in lipid homeostasis, and nutritional restriction changes the structure of the liver, leading to abnormal lipid metabolism and thus disrupting lipid homeostasis [34]. Abnormal accumulation of lipids in non-adipose tissue results in cell dysfunction, which, in turn, leads to inflammatory responses and cell death [35,36]. Similar findings were observed in this study, where low dietary protein up-regulated the expression of pro-inflammatory cytokines, including IL-1β, IL-8 and TNF-α. Likewise, nutrient deficiency- or excess-induced inflammation responses in the liver have been found in Ctenopharyngodon idella [37] and A. nobilis [31]. The findings of this study suggest that low dietary protein causes liver structural damage and further induces inflammatory responses, which may be mainly attributable to lipid deposition in the liver due to metabolic abnormalities. Metabolic abnormalities in the liver may further cause oxidative stress, which leads to poor antioxidant capacity. Therefore, we further examined antioxidant-related parameters to confirm this problem.

4.4. Antioxidation Property

Oxidative stress occurs when the production rate of reactive oxygen species (ROS) exceeds their removal rate, which leads to DNA damage, protein denaturation, lipid peroxidation and cell apoptosis [38]. Fish have developed two different types of antioxidant defense systems to avoid the negative effects caused by excessive ROS production, including enzymatic and non-enzymatic antioxidant systems [39]. The enzymatic antioxidant system is composed of a variety of antioxidant enzymes, including SOD, CAT and GSH-PX, and is also the first line of cellular antioxidant defense against toxicity caused by ROS [38]. SOD can eliminate superoxide by catalyzing the dismutation of O2−• into oxygen and H2O2, and CAT and GSH-PX are further responsible for converting H2O2 into water and molecular oxygen. The enzyme activity is positively correlated with the synthesis of corresponding enzyme proteins, which largely depend on gene transcription and translation [40]. In this study, low dietary protein down-regulated mRNA levels of SOD, CAT and GSH-PX and inhibited SOD activity in the liver. Similar phenomena have also been reported in A. nobilis [31], O. mykiss [2] and C. Idella [41], where dietary protein deficiency or excess reduced the activities and/or mRNA levels of antioxidant enzymes. T-AOC directly reflects the total antioxidant capacity of fish (including enzyme promoted and non-enzymatic system), while the MDA level indirectly reflects the degree of lipid peroxidation of cells. The findings of this study found that low dietary protein decreased T-AOC and increased MDA levels in the liver. This further confirms that dietary protein deficiency causes oxidative stress and weakens antioxidant properties of fish.

4.5. Innate Immune Response

Previous studies have suggested that dietary protein deficiency inhibited innate immune response and disease resistance in fish [31,42]. Therefore, immune-related parameters were examined to compare the effects of dietary protein levels on non-specific immunity of O. mykiss in this study. Lyz, a key antimicrobial protein, is able to dissolve bacteria by breaking the β-1,4-glycosidic bond between N-Acetylmuramic acid and N-Acetylglucosamine in the cell wall. Complement systems, phagocytes and lyz can play a synergistic role to boost bacteriolytic activity [43]. Accordingly, lyz and complements can evaluate the innate immune status of fish [44]. In this study, low dietary protein inhibited the Lyz and C3 expression in the liver. The findings suggest that dietary protein deficiency weakens the innate immune response and reduces the production of antibacterial compounds in fish. Supporting the findings in this work, earlier studies revealed that low dietary protein had a negative effect on lyz activity, transcription levels and complement content in A. nobilis [31], Labeo rohita [42] and C. Idella [45].

5. Conclusions

In summary, fish growth is significantly promoted by increasing feed utilization and body protein deposition, as well as up-regulating IGF-I expression when dietary protein is not lower than 439.2 g/kg. Fish fed with a diet containing 466.8 g/kg crude protein had the best growth performance. Moreover, the diet with crude protein levels of less than 411.5 g/kg damaged liver structure, induced oxidative stress and inflammatory responses and weakened non-specific immunity. The findings of this study will provide a reference for the feed formulation of O. mykiss cultured in convection-water cages on the basis of modern feed materials.

Author Contributions

W.Z.: conceptualization, methodology, formal analysis, writing—original draft. Y.-C.G.: methodology, data curation, investigation. R.Y.: methodology. A.-Q.C.: methodology. B.-Y.C.: methodology. J.N.: conceptualization, supervision, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Project of Science and Technology of Qinghai Province (2019-NK-104, 2020-QY-211), the Project of National Natural Science Foundation of China (31872580, 32172982), the Project of Science and Technology of Guangdong Province (2021B0202050002), the Project of Science and Technology of Guangdong Province (2019B110209005) and the Guangdong Provincial Special Fund for Morden Agriculture Industry Technology Innovation Teams (2019KJ143).

Institutional Review Board Statement

The study protocol and all experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC), Sun Yat-Sen University.

Informed Content Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Mohanta, K.N.; Rath, S.C.; Nayak, K.C.; Pradhan, C.; Mohanty, T.K.; Giri, S.S. Effect of restricted feeding and refeeding on compensatory growth, nutrient utilization and gain, production performance and whole body composition of carp cultured in earthen pond. Aquac. Nutr. 2017, 23, 460–469. [Google Scholar] [CrossRef]
  2. Liu, G.; Wang, L.; Yu, H.; Pan, M.; Yang, M.; Zhang, W.; Mai, K. Effects of dietary protein levels on growth performance, digestibility, anti-oxidative responses and expressions of growth-related genes in triploid rainbow trout Oncorhynchus mykiss farmed in seawater. Aquac. Nutr. 2021, 27, 998–1008. [Google Scholar] [CrossRef]
  3. Singha, K.P.; Shamna, N.; Sahu, N.P.; Sardar, P.; Harikrishna, V.; Thirunavukkarasar, R.; Kumar, M.; Krishna, G. Feeding graded levels of protein to Genetically Improved Farmed Tilapia (GIFT) juveniles reared in inland saline water: Effects on growth and gene expression of IGFeI, IGF-IR and IGF-BPI. Aquaculture 2020, 525, 735306. [Google Scholar] [CrossRef]
  4. Dong, Y.; Feng, L.; Jiang, W.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.; Zhang, Y.; et al. Effects of dietary protein levels on the disease resistance, immune function and physical barrier function in the gill of grass carp (Ctenopharyngodon idella) after challenged with Flavobacterium columnare. Fish Shellfish Immunol. 2016, 57, 1–16. [Google Scholar] [CrossRef]
  5. Yadata, G.W.; Ji, K.; Liang, H.; Ren, M.; Ge, X.; Yang, Q. Effects of dietary protein levels with various stocking density on growth performance, whole body composition, plasma parameters, nitrogen emission and gene expression related to TOR signaling of juvenile blunt snout bream (Megalobrama ambylcephala). Aquaculture 2020, 519, 734730. [Google Scholar] [CrossRef]
  6. Food and Agriculture Organization of the United Nations (FAO). The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation, Rome. Available online: https://doi.org/10.4060/cc0461en (accessed on 1 October 2022).
  7. NRC (National Research Council). Nutrient Requirements of Fish and Shrimp; National Academies Press: Washington, DC, USA, 2011. [Google Scholar] [CrossRef]
  8. Eliason, E.J.; Higgs, D.A.; Farrell, A. Effect of isoenergetic diets with different protein and lipid content on the growth performance and heat increment of rainbow trout. Aquaculture 2007, 272, 723–736. [Google Scholar] [CrossRef]
  9. Ma, R.; Liu, X.; Meng, Y.; Wu, J.; Zhang, L.; Han, B.; Qian, K.; Luo, Z.; Wei, Y.; Li, C. Protein nutrition on sub-adult triploid rainbow trout (1): Dietary requirement and effect on anti-oxidative capacity, protein digestion and absorption. Aquaculture 2019, 507, 428–434. [Google Scholar] [CrossRef]
  10. Alami-Durante, H.; Cluzeaud, M.; Duval, C.; Maunas, P.; Girod-David, V.; Medale, F. Early decrease in dietary protein:energy ratio by fat addition and ontogenetic changes in muscle growth mechanisms of rainbow trout: Short- and long-term effects. Brit. J. Nutr. 2014, 112, 674–687. [Google Scholar] [CrossRef] [Green Version]
  11. AOAC. Official Methods of Analysis; Association of Official Analytical Chemists, Association of Official Analytical Chemists: Gaithersburg, MD, USA, 1995. [Google Scholar]
  12. Plummer, P. Glycogen determination in animal tissues. In An Introduction to Practical Biochemistry, 3rd ed.; McGraw Hill Book: Maidenhead, UK, 1987; p. 332. [Google Scholar]
  13. Garling, J.D.L.; Wilson, R.P. Optimum dietary protein to energy ratio for channel catfish fingerlingsl, Ictalurus punctatus. J. Nutr. 1976, 106, 1368–1375. [Google Scholar] [CrossRef]
  14. Zhao, W.; Fang, H.H.; Gao, B.Y.; Dai, C.M.; Liu, Z.Z.; Zhang, C.W.; Niu, J. Dietary Tribonema sp. supplementation increased growth performance, antioxidant capacity, immunity and improved hepatic health in golden pompano (Trachinotus ovatus). Aquaculture 2020, 529, 735667. [Google Scholar] [CrossRef]
  15. Zhao, W.; Wei, H.; Chen, M.; Yao, R.; Wang, Z.; Niu, J. Effects of synthetic astaxanthin and Haematococcus pluvialis on growth, antioxidant capacity, immune response, and hepato-morphology of Oncorhynchus mykiss under cage culture with flowing freshwater. Aquaculture 2023, 562, 738860. [Google Scholar] [CrossRef]
  16. Lesiow, T.; Ockerman, H.W.; Dabrowski, K. Composition, properties and sensory quality of rainbow trout affected by feed formulations. J. World Aquacult. Soc. 2009, 40, 678–686. [Google Scholar] [CrossRef]
  17. Eya, J.C.; Yossa, R.; Ashame, M.F.; Pomeroy, C.F.; Gannam, A.L. Effects of dietary lipid levels on growth, feed utilization and mitochondrial function in low- and high-feed efficient families of rainbow trout (Oncorhynchus mykiss). Aquaculture 2013, 416, 119–128. [Google Scholar] [CrossRef]
  18. Ahmed, I.; Ahmad, I. Effect of dietary protein levels on growth performance, hematological profile and biochemical composition of fingerlings rainbow trout, Oncorhynchus mykiss reared in Indian himalayan region. Aquac. Rep. 2020, 16, 100268. [Google Scholar] [CrossRef]
  19. Yan, J.; Li, Y.; Liang, X.; Zhang, Y.; Dawood, M.A.O.; Matuli’c, D.; Gao, J. Effects of dietary protein and lipid levels on growth performance, fatty acid composition and antioxidant-related gene expressions in juvenile loach Misgurnus anguillicaudatus. Aquac. Res. 2017, 48, 5385–5393. [Google Scholar] [CrossRef]
  20. Velazco-vargas, J.; Tomás-vidal, A.; Hamdan, M.; López, F.J.M.; Cerda, M.J.; Martínez-llorens, S. Influence of digestible protein levels on growth and feed utilization of juvenile meagre Argyrosomus regius. Aquac. Nutr. 2014, 20, 520–531. [Google Scholar] [CrossRef]
  21. Tanaka, H.; Oishi, G.; Nakano, Y.; Mizuta, H.; Nagano, Y.; Hiramatsu, N.; Ando, H.; Shimizu, M. Production of recombinant salmon insulin-like growth factor binding protein-1 subtypes. Gen. Comp. Endocr. 2018, 257, 184–191. [Google Scholar] [CrossRef] [Green Version]
  22. Pierce, A.L.; Breves, J.P.; Moriyama, S.; Hirano, T.; Grau, E.G. Differential regulation of Igf1 and Igf2 mRNA levels in tilapia hepatocytes: Effects of insulin and cortisol on GH sensitivity. J. Endocrinol. 2011, 211, 201–210. [Google Scholar] [CrossRef] [Green Version]
  23. Wheatcroft, S.B.; Kearney, M.T. IGF-dependent and IGF-independent actions of IGF-binding protein-1 and -2: Implications for metabolic homeostasis. Trends Endocr. Met. 2009, 20, 153–162. [Google Scholar] [CrossRef]
  24. Kumar, V.; Lee, S.; Cleveland, B.M.; Romano, N.; Lalgudi, R.S.; Benito, M.R.; Hardy, R.W. Comparative evaluation of processed soybean meal (EnzoMealTM) vs. regular soybean meal as a fishmeal replacement in diets of rainbow trout (Oncorhynchus mykiss): Effects on growth performance and growth-related genes. Aquaculture 2020, 516, 734652. [Google Scholar] [CrossRef]
  25. Madison, B.N.; Tavakoli, S.; Kramer, S.; Bernier, N.J. Chronic cortisol and the regulation of food intake and the endocrine growth axis in rainbow trout. J. Endocr. 2015, 226, 103–119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Gao, Y.; Lu, S.; Wu, M.; Yao, W.; Jin, Z.; Wu, X. Effects of dietary protein levels on growth, feed utilization and expression of growth related genes of juvenile giant grouper (Epinephelus lanceolatus). Aquaculture 2019, 504, 369–374. [Google Scholar] [CrossRef]
  27. Wilson, R.P. Amino acids and proteins. In Fish Nutrition, 3rd ed.; Halver, J.E., Hardy, R.W., Eds.; Academic Press: Cambridge, MA, USA, 2002; pp. 143–179. [Google Scholar]
  28. Nguyen, M.C.; Fotedar, R.; Pham, H.D. Effects of dietary protein and lipid levels on growth performance, feed utilization and body composition of juvenile giant trevally (Caranx ignobilis Forsskal, 1775). Aquac. Res. 2022, 53, 6254–6263. [Google Scholar] [CrossRef]
  29. Kim, S.; Lee, K. Dietary protein requirement of juvenile tiger puffer (Takifugu rubripes). Aquaculture 2009, 287, 219–222. [Google Scholar] [CrossRef]
  30. Liu, W.; Wen, H.; Luo, Z. Effect of dietary protein levels and feeding rates on the growth and health status of juvenile genetically improved farmed tilapia (Oreochromis niloticus). Aquacult. Int. 2018, 26, 153–167. [Google Scholar] [CrossRef]
  31. Sun, S.; Wu, Y.; Yu, H.; Su, Y.; Ren, M.; Zhu, J.; Ge, X. Serum biochemistry, liver histology and transcriptome profiling of bighead carp Aristichthys nobilis following different dietary protein levels. Fish Shellfish Immunol. 2019, 86, 832–839. [Google Scholar] [CrossRef]
  32. Camargo, M.M.P.; Martinez, C.B.R. Histopathology of gills, kidney and liver of a Neotropical fish caged in an urban stream. Neotrop. Ichthyol. 2007, 5, 327–336. [Google Scholar] [CrossRef] [Green Version]
  33. Ramadan, W.S.; Alshiraihi, I.; Al-karim, S. Effect of maternal low protein diet during pregnancy on the fetal liver of rats. Ann. Anat. 2013, 195, 68–76. [Google Scholar] [CrossRef]
  34. Park, K.S.; Kim, S.K.; Kim, M.S.; Cho, E.Y.; Lee, J.H.; Lee, K.U.; Pak, Y.K.; Lee, H.K. Fetal and early postnatal protein malnutrition cause long-term changes in rat liver and muscle mitochondria. J. Nutr. 2003, 133, 3085–3090. [Google Scholar] [CrossRef]
  35. Wei, Y.; Wang, D.; Topczewski, F.; Pagliassotti, M.J. Saturated fatty acids induce endoplasmic reticulum stress and apoptosis independently of ceramide in liver cells. Am. J. Physiol. Endocrinol. Metab. 2006, 291, 275–281. [Google Scholar] [CrossRef]
  36. Zhao, W.; Cui, X.; Wang, Z.; Yao, R.; Xie, S.; Gao, B.; Zhang, C.; Niu, J. Beneficial changes in growth performance, antioxidant capacity, immune response, hepatic health, and flesh quality of Trachinotus ovatus fed with Oedocladium carolinianum. Front. Immunol. 2022, 13, 940929. [Google Scholar] [CrossRef] [PubMed]
  37. Ni, P.; Jiang, W.D.; Wu, P.; Liu, Y.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; Zhou, X.Q.; Feng, L. Dietary low or excess levels of lipids reduced growth performance, and impaired immune function and structure of head kidney, spleen and skin in young grass carp (Ctenopharyngodon idella) under the infection of Aeromonas hydrophila. Fish Shellfish Immunol. 2016, 55, 28–47. [Google Scholar] [CrossRef] [PubMed]
  38. Hoseinifar, S.H.; Yousefi, S.; Doan, H.V.; Ashouri, G.; Gioacchini, G.; Maradonna, F.; Carnevali, O. Oxidative stress and antioxidant defense in fish: The implications of probiotic, prebiotic, and synbiotics. Rev. Fish. Sci. Aquac. 2021, 29, 198–217. [Google Scholar] [CrossRef]
  39. Martínez-Álvarez, R.M.; Morales, A.E.; Sanz, A. Antioxidant defenses in fish: Biotic and abiotic factors. Rev. Fish Biol. Fisher. 2005, 15, 75–88. [Google Scholar] [CrossRef]
  40. Zhao, J.; Liu, Y.; Jiang, J.; Wu, P.; Chen, G.; Jiang, W.; Li, S.; Tang, L.; Kuang, S.; Feng, L.; et al. Effects of dietary isoleucine on growth, the digestion and absorption capacity and gene expression in hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Aquaculture 2012, 368, 117–128. [Google Scholar] [CrossRef]
  41. Xu, J.; Wu, P.; Jiang, W.D.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; Zhou, X.Q.; et al. Optimal dietary protein level improved growth, disease resistance, intestinal immune and physical barrier function of young grass carp (Ctenopharyngodon idella). Fish and Shellfish Immunol. 2016, 55, 64–87. [Google Scholar] [CrossRef]
  42. Yengkokpam, S.; Debnath, D.; Sahu, N.P.; Pal, A.K.; Jain, K.K.; Baruah, K. Dietary protein enhances non-specific immunity, anti-oxidative capability and resistance to Aeromonas hydrophila in Labeo rohita fingerlings pre-exposed to short feed deprivation stress. Fish Shellfish Immunol. 2016, 59, 439–446. [Google Scholar] [CrossRef]
  43. Ragland, S.A.; Criss, A.K. From bacterial killing to immune modulation: Recent insights into the functions of lysozyme. PLoS Pathog. 2017, 13, 1006512. [Google Scholar] [CrossRef] [Green Version]
  44. Saurabh, S.; Sahoo, P.K. Lysozyme: An important defence molecule of fish innate immune system. Aquac. Res. 2008, 39, 223–239. [Google Scholar] [CrossRef]
  45. Jiang, W.D.; Xu, J.; Zhou, X.Q.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. Dietary protein levels regulated antibacterial activity, inflammatory response and structural integrity in the head kidney, spleen and skin of grass carp (Ctenopharyngodon idella) after challenged with Aeromonas hydrophila. Fish Shellfish Immunol. 2017, 68, 154–172. [Google Scholar] [CrossRef]
Foods 12 00175 g001 550
Figure 1. Hepatic antioxidant capacity of Oncorhynchus mykiss fed diets with different protein levels. Values are presented as mean ± SE, n = 4. The small letters indicate significant differences at p < 0.05. SOD: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. T-AOC: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. MDA: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Figure 1. Hepatic antioxidant capacity of Oncorhynchus mykiss fed diets with different protein levels. Values are presented as mean ± SE, n = 4. The small letters indicate significant differences at p < 0.05. SOD: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. T-AOC: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. MDA: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Foods 12 00175 g001
Foods 12 00175 g002 550
Figure 2. Effect of protein levels on hepatic morphology of Oncorhynchus mykiss. The red arrow indicates hepatocyte vacuolation. The black arrow indicates hepatocyte nuclear migration. Magnification: 200× and 400×.
Figure 2. Effect of protein levels on hepatic morphology of Oncorhynchus mykiss. The red arrow indicates hepatocyte vacuolation. The black arrow indicates hepatocyte nuclear migration. Magnification: 200× and 400×.
Foods 12 00175 g002
Foods 12 00175 g003 550
Figure 3. The mRNA levels of growth-related genes in the livers of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). IGF-I: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. IGFBP1: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Figure 3. The mRNA levels of growth-related genes in the livers of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). IGF-I: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. IGFBP1: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Foods 12 00175 g003
Foods 12 00175 g004 550
Figure 4. The mRNA levels of antioxidant-related genes in the liver of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). SOD: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. CAT: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. GSH-PX: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Figure 4. The mRNA levels of antioxidant-related genes in the liver of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). SOD: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. CAT: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. GSH-PX: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Foods 12 00175 g004
Foods 12 00175 g005 550
Figure 5. The mRNA levels of inflammation-related genes in the gut of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). IL-1β: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. IL-8: ANOVA, 0.001; linear, 0.000; quadratic, 0.000. TNF-α: ANOVA, 0.003; linear, 0.000; quadratic, 0.001.
Figure 5. The mRNA levels of inflammation-related genes in the gut of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). IL-1β: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. IL-8: ANOVA, 0.001; linear, 0.000; quadratic, 0.000. TNF-α: ANOVA, 0.003; linear, 0.000; quadratic, 0.001.
Foods 12 00175 g005
Foods 12 00175 g006 550
Figure 6. The mRNA levels of immune-related genes in the livers of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). C3: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. Lyz: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Figure 6. The mRNA levels of immune-related genes in the livers of Oncorhynchus mykiss fed experimental diets. Values are presented as mean ± SE, n = 4. Means with different superscripts are significantly different (p < 0.05). C3: ANOVA, 0.000; linear, 0.000; quadratic, 0.000. Lyz: ANOVA, 0.000; linear, 0.000; quadratic, 0.000.
Foods 12 00175 g006
Table
Table 1. Composition and nutrient levels of the experimental diets (g/kg dry matter).
Table 1. Composition and nutrient levels of the experimental diets (g/kg dry matter).
IngredientsP1P2P3P4P5
Fish meal180220260300340
Soybean meal170170170170170
Hermetia illucens meal100100100100100
Soy protein concentrate4040404040
Wheat flour110110110110110
Bone meal a156.9119.782.645.38.1
Krill meal3030303030
Chicken meal3540455055
Fish oil76.573.069.465.962.4
Soybean lecithin2020202020
Ca(H2PO4)21010101010
Vitamin premix b1010101010
Mineral premix c1010101010
Choline55555
Vitamin C55555
DL-Met9.18.37.56.75.9
Lys-HCL (99%)15.513.211.08.86.6
Thr6.95.74.43.21.9
Inositol0.10.10.10.10.1
Sodium alginate1010101010
Total10001000100010001000
Nutrient levels d
Crude lipid125.1123.7125.4124.8126.6
Crude protein356.3383.9411.5439.2466.8
Moisture93.294.993.895.195.2
Carbohydrate98.597.997.399.896.8
Estimated energy (KJ/g)12.3012.7013.2113.6914.17
a Defatted and denitrified bone meal, supplied by Junyou Feed Corporation, Guangzhou, China. b Multi-vitamin (kg−1 diet): vitamin B1 30 mg, vitamin B2 60 mg, vitamin B6 20 mg, nicotinic acid 200 mg, calcium pantothenate 100 mg, inositol 100 mg, biotin 2.5 mg, folic acid 10 mg, vitamin B12 0.1 mg, vitamin K3 40 mg, vitamin A 3 mg, vitamin D3 0.05 mg, vitamin E 160 mg. c Multi-mineral (kg−1 diet): MgSO4∙7H2O 1090 mg, KH2PO4 932 mg, NaH2PO4∙2H2O 432 mg, FeC6H5O7∙5H2O 181 mg, ZnCl2 80 mg, CuSO4∙5H2O 63 mg, AlCl3∙6H2O 51 mg, MnSO4∙H2O 31 mg, KI 28 mg, CoCl2∙6H2O 6 mg, Na2SeO3∙H2O 0.8 mg. d Measured values.
Table
Table 2. Primer information of real-time fluorescent quantitative PCR.
Table 2. Primer information of real-time fluorescent quantitative PCR.
GenePrimer Sequence (5′ to 3′)Genbank No.
SOD-FTGAAGGCTGTTTGCGTGCTGACNM_001160614.1
SOD-RCCGTTGGTGTTGTCTCCGAAGG
CAT-FCCGTCCTTCGTCCACTCTCAGAXM_021564302.2
CAT-RCTCGGCATCCTCAGGCTTCAAG
GSH-PX-FTCATCATGTGGAGCCCTGTCTGAF281338.1
GSH-PX-RTCTGCCTCAATGTCACTGGTCA
IGFBP1-FGGAGAAGCTGGATGAATGCCNM_001124561.1
IGFBP1-RGGTCTAGGATCCCCAGCTCTTG
IGF-I-FTGCGTCCTAACCCTGACTTCGM95183.1
IGF-I-RGCAGCACTCGTCCACAATACC
IL-1β-FACGGTTCGCTTCCTCTTCTACAAJ245925.2
IL-1β-RGCTCCAGTGAGGTGCTGATGAA
IL-8-FGTCAGCCAGCCTTGTCGTTGTNM_001124362.1
IL-8-RCGTCTGCTTTCCGTCTCAATGC
TNF-α-F GGCGAGCATACCACTCCTCTGANM_001124362.1
TNF-α-R AGCTGGAACACTGCACCAAGGT
Lyz-F
Lyz-R		GAAACAGCCTGCCCAACT
GTCCAACACCACACGCTT		AF452171.1
C3-FGGCCAGTCCCTGGTGGTTAXM_036955530.1
C3-RGGTGGACTGTGTGGATCCGTA
β-actin-FTACAACGAGCTGAGGGTGGCAJ438158.1
β-actin-RGGCAGGGGTGTTGAAGGTCT
Table
Table 3. Effects of dietary protein levels on growth performance of Oncorhynchus mykiss.
Table 3. Effects of dietary protein levels on growth performance of Oncorhynchus mykiss.
Dietary Protein Levels
P1P2P3P4P5ANOVALinearQuadratic
IBW (g)15.88 ± 0.3615.58 ± 0.3715.67 ± 0.2415.88 ± 0.1816.09 ± 0.210.7430.4160.390
FBW (g)55.66 ± 1.18 a56.11 ± 0.66 a55.57 ± 0.64 a60.72 ± 1.27 b64.50 ± 1.52 c0.0010.0000.000
WGR (%)253.12 ± 8.07 a259.04 ± 14.38 a255.13 ± 9.99 a286.14 ± 4.51 bc306.11 ± 12.48 c0.0180.0020.003
SGR (%/d)2.25 ± 0.04 a2.28 ± 0.08 a2.26 ± 0.05 a2.41 ± 0.02 bc2.50 ± 0.05 c0.0200.0020.003
SR (%)98.33 ± 1.6799.17 ± 0.8397.50 ± 2.5098.33 ± 0.9698.33 ± 0.960.7910.7410.935
FCR1.31 ± 0.03 a1.31 ± 0.08 a1.31 ± 0.02 a1.19 ± 0.04 bc1.08 ± 0.03 c0.0120.0020.001
Values are presented as mean ± SE, n = 4. The superscript small letters in the same row indicate the significant differences at p < 0.05.
Table
Table 4. The whole-body composition of Oncorhynchus mykiss fed experimental diets (% wet weight basis).
Table 4. The whole-body composition of Oncorhynchus mykiss fed experimental diets (% wet weight basis).
ItemMoistureCrude ProteinCrude Lipid
P165.79 ± 0.4447.90 ± 0.89 a31.07 ± 0.22
P264.82 ± 0.5248.18 ± 1.12 a31.28 ± 0.43
P366.55 ± 1.1448.86 ± 0.28 a31.84 ± 0.31
P466.15 ± 0.7150.02 ± 0.28 a31.78 ± 0.58
P565.53 ± 1.6752.64 ± 0.44 b32.03 ± 0.13
ANOVA0.7900.0040.369
Linear0.7920.0000.039
Quadratic0.8970.0000.119
Values are presented as mean ± SE, n = 4. The superscript small letters in the same row indicate significant differences at p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, W.; Guo, Y.-C.; Yao, R.; Chen, A.-Q.; Chen, B.-Y.; Niu, J. Protein Requirements of Oncorhynchus mykiss Cultured in the Convection-Water Cages by Evaluating Growth, Body Composition and Liver Health. Foods 2023, 12, 175. https://doi.org/10.3390/foods12010175

AMA Style

Zhao W, Guo Y-C, Yao R, Chen A-Q, Chen B-Y, Niu J. Protein Requirements of Oncorhynchus mykiss Cultured in the Convection-Water Cages by Evaluating Growth, Body Composition and Liver Health. Foods. 2023; 12(1):175. https://doi.org/10.3390/foods12010175

Chicago/Turabian Style

Zhao, Wei, Yu-Cai Guo, Rong Yao, An-Qi Chen, Bao-Yang Chen, and Jin Niu. 2023. "Protein Requirements of Oncorhynchus mykiss Cultured in the Convection-Water Cages by Evaluating Growth, Body Composition and Liver Health" Foods 12, no. 1: 175. https://doi.org/10.3390/foods12010175

APA Style

Zhao, W., Guo, Y. -C., Yao, R., Chen, A. -Q., Chen, B. -Y., & Niu, J. (2023). Protein Requirements of Oncorhynchus mykiss Cultured in the Convection-Water Cages by Evaluating Growth, Body Composition and Liver Health. Foods, 12(1), 175. https://doi.org/10.3390/foods12010175

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop