Chemopreventive Effect of an In Vitro Digested and Fermented Plant Sterol-Enriched Wholemeal Rye Bread in Colon Cancer Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Samples
2.3. Semi-Dynamic In Vitro Digestion and Colonic Fermentation
2.4. Cell Culture
2.5. MTT Cytotoxicity Assay
2.6. Detection of Apoptosis: Annexin V/IP Assay
2.7. Cell Cycle Progression
2.8. Determination of Ceramide Levels
2.9. Levels of Reactive Oxygen Species (ROS)
2.10. Intracellular Reduced Glutathione (GSH)
2.11. Intracellular Calcium Levels
2.12. Evaluation of Gene Transcription by qPCR
2.12.1. RNA Extraction
2.12.2. Primer Design
2.12.3. Retrotranscription
2.12.4. Quantitative Real-Time PCR
2.12.5. Gene Expression Analysis
2.13. Total Antioxidant Capacity
2.13.1. Oxygen Radical Absorbance Capacity (ORAC) Method
2.13.2. Total Phenolic Content (TPC)
2.14. Short Chain Fatty Acids Determination
2.15. Statistic Analysis
3. Results
3.1. Cytotoxicity
3.2. Apoptosis
3.3. Cell Cycle
3.4. Cell Death Mechanisms
3.5. Cell Redox Status
3.6. Transcriptional Changes in Apoptosis and Cell Cycle Regulation-Related Genes
3.7. Total Antioxidant Capacity
3.8. Short Chain Fatty Acids
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- International Agency for Research on Cancer, World Health Organization. Available online: https://www.iarc.who.int/cancer-type/colorectal-cancer/ (accessed on 15 May 2023).
- Baena, R.; Salinas, P. Diet and colorectal cancer. Maturitas 2015, 80, 258–264. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Chinnathambi, S.; Kumar, M.; Pandian, G.N. Food intake and colorectal cancer. Nutr. Cancer 2023, 75, 1710–1742. [Google Scholar] [CrossRef] [PubMed]
- Barroso, E.; Cueva, C.; Peláez, C.; Martínez-Cuesta, M.C.; Requena, T. The computer-controlled multicompartmental dynamic model of the gastrointestinal system SIMGI. In The Impact of Food Bioactives on Health: In Vitro and Ex Vivo Models; Verhoeckx, K., Cotter, P., López-Expósito, I., Kleiveland, C., Lea, T., Mackie, A., Requena, T., Swiatecka, D., Wichers, H., Eds.; Springer: Cham, Switzerland, 2015; pp. 319–327. [Google Scholar]
- Zhu, Z.; Guan, X.; Liu, N.; Zhu, X.; Dai, S.; Xiong, D.; Li, X. Association between dietary factors and colorectal serrated polyps: A systematic review and meta-analysis. Front. Nutr. 2023, 10, 1187539. [Google Scholar] [CrossRef] [PubMed]
- Peters, U.; Sinha, R.; Chatterjee, N.; Subar, A.F.; Ziegler, R.G.; Kulldorff, M.; Bresalier, R.; Weissfeld, J.L.; Flood, A.; Schatzkin, A.; et al. Dietary fibre and colorectal adenoma in a colorectal cancer early detection programme. Lancet 2003, 361, 1491–1495. [Google Scholar] [CrossRef] [PubMed]
- Bingham, S.A.; Day, N.E.; Luben, R.; Ferrari, P.; Slimani, N.; Norat, T.; Clavel-Chapelon, F.; Kesse, E.; Nieters, A.; Boeing, H.; et al. Dietary fibre in food and protection against colorectal cancer in the European Prospective Investigation into Cancer and Nutrition (EPIC): An observational study. Lancet 2003, 361, 1496–1501. [Google Scholar] [CrossRef] [PubMed]
- Åman, P.; Andersson, A.A.M.; Rakha, A.; Andersson, R. Rye, a healthy cereal full of dietary fiber. Cereal Foods World 2010, 55, 231–234. [Google Scholar]
- Salehi, B.; Quispe, C.; Sharifi-Rad, J.; Cruz-Martins, N.; Nigam, M.; Mishra, A.P.; Konovalov, D.A.; Orobinskaya, V.; Abu-Reidah, I.M.; Zam, W.; et al. Phytosterols: From preclinical evidence to potential clinical applications. Front. Pharmacol. 2021, 11, 599959. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.U.; Khan, A.; Shal, B.; Khan, S.; Khan, M.; Ahmad, R.; Riaz, M. The critical role of the phytosterols in modulating tumor microenvironment via multiple signaling: A comprehensive molecular approach. Phytother. Res. 2023, 37, 1606–1623. [Google Scholar] [CrossRef]
- López-García, G.; Cilla, A.; Barberá, R.; Alegría, A. Antiproliferative effect of plant sterols at colonic concentrations on Caco-2 cells. J. Funct. Foods 2017, 39, 84–90. [Google Scholar] [CrossRef]
- Álvarez-Sala, A.; Ávila-Gálvez, M.A.; Cilla, A.; Barberá, R.; Garcia-Llatas, G.; Espín, J.C.; González-Sarrías, A. Physiological concentrations of phytosterols enhance the apoptotic effects of 5-fluorouracil in colon cancer cells. J. Funct. Foods 2018, 49, 52–60. [Google Scholar] [CrossRef]
- López-García, G.; Cilla, A.; Barberá, R.; Alegría, A. Anti-inflammatory and cytoprotective effect of plant sterol and galactooligosaccharides-enriched beverages in Caco-2 cells. J. Agric. Food Chem. 2020, 68, 1862–1870. [Google Scholar] [CrossRef] [PubMed]
- Glei, M.; Ludwig, D.; Lamberty, J.; Fischer, S.; Lorkowski, S.; Schlörmann, W. Chemopreventive potential of raw and roasted pistachios regarding colon carcinogenesis. Nutrients 2017, 9, 1368. [Google Scholar] [CrossRef] [PubMed]
- Schlörmann, W.; Lamberty, J.; Lorkowski, S.; Ludwig, D.; Mothes, H.; Saupe, C.; Glei, M. Chemopreventive potential of in vitro fermented nuts in LT97 colon adenoma and primary epithelial colon cells. Mol. Carcinog. 2017, 56, 1461–1471. [Google Scholar] [CrossRef] [PubMed]
- Glei, M.; Fischer, S.; Lamberty, J.; Ludwig, D.; Lorkowski, S.; Schlörmann, W. Chemopreventive potential of in vitro fermented raw and roasted hazelnuts in LT97 colon adenoma cells. Anticancer Res. 2018, 38, 83–93. [Google Scholar] [PubMed]
- Schlörmann, W.; Hiller, B.; Jahns, F.; Zoger, R.; Hennemeier, I.; Wilhelm, A.; Lindhauer, M.G.; Glei, M. Chemopreventive effects of in vitro digested and fermented bread in human colon cells. Eur. J. Nutr. 2012, 51, 827–839. [Google Scholar] [CrossRef] [PubMed]
- Schlörmann, W.; Atanasov, J.; Lorkowski, S.; Dawczynski, C.; Glei, M. Study on chemopreventive effects of raw and roasted beta-glucan-rich waxy winter barley using an in vitro human colon digestion model. Food Funct. 2020, 11, 2626–2638. [Google Scholar] [CrossRef] [PubMed]
- Schlörmann, W.; Atanasov, J.; Lorkowski, S.; Dawczynski, C.; Glei, M. Thermal processing has no impact on chemopreventive effects of oat and barley kernels in LT97 colon adenoma cells. Nutr. Cancer 2020, 73, 2708–2719. [Google Scholar] [CrossRef]
- Schlörmann, W.; Bockwoldt, J.A.; Hübner, S.M.; Wittwer, E.; Reiners, S.; Lorkowski, S.; Dawczynski, C.; Ehrmann, M.A.; Glei, M. Use of the β-Glucan-producing lactic acid bacteria strains Levilactobacillus brevis and Pediococcus claussenii for sourdough fermentation—Chemical characterization and chemopreventive potential of in situ-enriched wheat and rye sourdoughs and breads. Nutrients 2022, 14, 1510. [Google Scholar] [CrossRef]
- Glei, M.; Zetzmann, S.; Lorkowski, S.; Dawczynski, C.; Schlörmann, W. Chemopreventive effects of raw and roasted oat flakes after in vitro fermentation with human faecal microbiota. Int. J. Food Sci. Nutr. 2021, 72, 57–69. [Google Scholar] [CrossRef]
- Miedes, D.; Makran, M.; Cilla, A.; Barberá, R.; Garcia-Llatas, G.; Alegría, A. Aging-related gastrointestinal conditions decrease the bioaccessibility of plant sterols in enriched wholemeal rye bread: In vitro static digestion. Food Funct. 2023, 14, 6012–6024. [Google Scholar] [CrossRef]
- Tamargo, A.; Cueva, C.; Taladrid, D.; Khoo, C.; Moreno-Arribas, M.V.; Bartolomé, B.; González de Llano, D. Simulated gastrointestinal digestion of cranberry polyphenols under dynamic conditions. Impact on antiadhesive activity against uropathogenic bacteria. Food Chem. 2022, 368, 130871. [Google Scholar] [CrossRef] [PubMed]
- Faubel, N.; Makran, M.; Cilla, A.; Alegría, A.; Barberá, R.; Garcia-Llatas, G. Bioaccessibility of plant sterols in wholemeal rye bread using the INFOGEST protocol: Influence of oral phase and enzymes of lipid metabolism. J. Agric. Food Chem. 2022, 70, 13223–13232. [Google Scholar] [CrossRef] [PubMed]
- Gerlier, D.; Thomasset, N. Use of MTT colorimetric assay to measure cell activation. J. Immunol. Methods 1986, 94, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Darzynkiewicz, Z.; Bedner, E.; Smolewski, P. Flow cytometry in analysis of cell cycle and apoptosis. Semin. Hematol. 2001, 38, 179–193. [Google Scholar] [CrossRef] [PubMed]
- Restivo, I.; Attanzio, A.; Giardina, I.C.; Di Gaudio, F.; Tesoriere, L.; Allegra, M. Cigarette smoke extract induces p38 MAPK- initiated, fas-mediated eryptosis. Int. J. Mol. Sci. 2022, 23, 14730. [Google Scholar] [CrossRef] [PubMed]
- Cilla, A.; Attanzio, A.; Barberá, R.; Tesoriere, L.; Livrea, M.A. Anti-proliferative effect of main dietary phytosterols and β-cryptoxanthin alone or combined in human colon cancer Caco-2 cells through cytosolic Ca2+—And oxidative stress induced apoptosis. J. Funct. Foods 2015, 12, 282–293. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Prior, R.L.; Wu, X.; Schaich, K. Standardized methods for the determination of antioxidant capacity and phenolics in foods and dietary supplements. J. Agric. Food Chem. 2005, 53, 4290–4302. [Google Scholar] [CrossRef]
- Ou, B.; Hampsch-Woodill, M.; Prior, R.L. Development and validation of an improved oxygen radical absorbance capacity assay using fluorescein as the fluorescent probe. J. Agric. Food Chem. 2001, 49, 4619–4626. [Google Scholar] [CrossRef]
- Singleton, V.; Rossi, J. Colorimetry of total phenolic compounds with phosphomolybdic-phosphotungstic acid reagents. Am. J. Pathol. 1965, 16, 144–158. [Google Scholar]
- Huang, J.; Xu, M.; Fang, Y.J.; Lu, M.S.; Pan, Z.Z.; Huang, W.Q.; Chen, Y.M.; Zhang, C.X. Association between phytosterol intake and colorectal cancer risk: A case-control study. Br. J. Nutr. 2017, 117, 839–850. [Google Scholar] [CrossRef] [PubMed]
- Chau, I.; Cunningham, D. Chemotherapy in colorectal cancer: New options and new challenges. Br. Med. Bull. 2002, 64, 159–180. [Google Scholar] [CrossRef] [PubMed]
- Le Goff, M.; Le Ferrec, E.; Mayer, C.; Mimouni, V.; Lagadic-Gossmann, D.; Schoefs, B.; Ulmann, L. Microalgal carotenoids and phytosterols regulate biochemical mechanisms involved in human health and disease prevention. Biochimie 2019, 167, 106–118. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Zhang, X.; Wang, M.; Lin, Y.; Zhou, S. Stigmasterol simultaneously induces apoptosis and protective autophagy by inhibiting Akt/mTOR pathway in gastric cancer cells. Front. Oncol. 2021, 11, 629008. [Google Scholar] [CrossRef] [PubMed]
- Makran, M.; Cilla, A.; Barberá, R.; Alegría, A.; Garcia-Llatas, G. The selective cytotoxic effect of sterol metabolites on tumor and non-tumor colon cells. In Proceedings of the 3rd International Conference on Food Bioactives & Health, Parma, Italy, 24 June 2022. [Google Scholar]
- Aune, D.; Keum, N.; Giovannucci, E.; Fadnes, L.T.; Boffetta, P.; Greenwood, D.C.; Tonstad, S.; Vatten, L.J.; Riboli, E.; Norat, T. Whole grain consumption and risk of cardiovascular disease, cancer, and all cause and cause specific mortality: Systematic review and dose-response meta-analysis of prospective studies. BMJ 2016, 353, i2716. [Google Scholar] [CrossRef]
- Murphy, N.; Norat, T.; Ferrari, P.; Jenab, M.; Bueno-de-Mesquita, B.; Skeie, G.; Dahm, C.C.; Overvad, K.; Olsen, A.; Tjønneland, A.; et al. Dietary fibre intake and risks of cancers of the colon and rectum in the European prospective investigation into cancer and nutrition (EPIC). PLoS ONE 2012, 7, e39361. [Google Scholar] [CrossRef]
- Gråsten, S.M.; Juntunen, K.S.; Poutanen, K.S.; Gylling, H.K.; Miettinen, T.A.; Mykkänen, H.M. Rye bread improves bowel function and decreases the concentrations of some compounds that are putative colon cancer risk markers in middle-aged women and men. J. Nutr. 2000, 130, 2215–2221. [Google Scholar] [CrossRef]
- Tamargo, A.; González de Llano, D.; Cueva, C.; Navarro del Hierro, J.; Martin, D.; Molinero, N.; Bartolomé, B.; Moreno-Arribas, M.V. Deciphering the interactions between lipids and red wine polyphenols through the gastrointestinal tract. Food Res. Int. 2023, 165, 112524. [Google Scholar] [CrossRef]
- Matthews, G.M.; Howarth, G.S.; Butler, R.N. Short-chain fatty acids induce apoptosis in colon cancer cells associated with changes to intracellular redox state and glucose metabolism. Chemotherapy 2012, 58, 102–109. [Google Scholar] [CrossRef]
- Ebert, M.N.; Beyer-Sehlmeyer, G.; Liegibel, U.M.; Kautenburger, T.; Becker, T.W.; Pool-Zobel, B.L. Butyrate induces glutathione S-transferase in human colon cells and protects from genetic damage by 4-hydroxy-2-nonenal. Nutr. Cancer 2001, 41, 156–164. [Google Scholar] [CrossRef]
- Putaala, H.; Makivuokko, H.; Tiihonen, K.; Rautonen, N. Simulated colon fiber metabolome regulates genes involved in cell cycle, apoptosis, and energy metabolism in human colon cancer cells. Mol. Cell. Biochem. 2011, 357, 235–245. [Google Scholar] [CrossRef] [PubMed]
- Hinnebusch, B.F.; Meng, S.; Wu, J.T.; Archer, S.Y.; Hodin, R.A. The effects of short-chain fatty acids on human colon cancer cell phenotype are associated with histone hyperacetylation. J. Nutr. 2002, 132, 1012–1017. [Google Scholar] [CrossRef] [PubMed]
- Scharlau, D.; Borowicki, A.; Habermann, N.; Hofmann, T.; Klenow, S.; Miene, C.; Munjal, U.; Stein, K.; Glei, M. Mechanisms of primary cancer prevention by butyrate and other products formed during gut flora-mediated fermentation of dietary fibre. Mutat. Res. 2009, 682, 39–53. [Google Scholar] [CrossRef]
- Xiong, R.G.; Zhou, D.D.; Wu, S.X.; Huang, S.Y.; Saimaiti, A.; Yang, Z.J.; Shang, A.; Zhao, C.N.; Gan, R.Y.; Li, H.B. Health benefits and side effects of short-chain fatty acids. Foods 2022, 11, 2863. [Google Scholar] [CrossRef] [PubMed]
- Casanova, M.R.; Azevedo-Silva, J.; Rodrigues, L.R.; Preto, A. Colorectal cancer cells increase the production of short chain fatty acids by Propionibacterium freudenreichii impacting on cancer cells survival. Front. Nutr. 2018, 5, 44. [Google Scholar] [CrossRef]
- Caicedo-Lopez, L.H.; Cuellar-Nuñez, M.L.; Luzardo-Ocampo, I.; Campos-Vega, R.; Lóarca-Piña, G. Colonic metabolites from digested Moringa oleifera leaves induced HT-29 cell death via apoptosis, necrosis, and autophagy. Int. J. Food Sci. Nutr. 2020, 72, 485–498. [Google Scholar] [CrossRef]
- Stone, W.L.; Krishnan, K.; Campbell, S.E.; Palau, V.E. The role of antioxidants and pro-oxidants in colon cancer. World J. Gastrointest. Oncol. 2014, 6, 55–66. [Google Scholar] [CrossRef]
- Zeng, H.; Umar, S.; Rust, B.; Lazarova, D.; Bordonaro, M. Secondary bile acids and short chain fatty acids in the colon: A focus on colonic microbiome, cell proliferation, inflammation, and cancer. Int. J. Mol. Sci. 2019, 20, 1214. [Google Scholar] [CrossRef]
PSRB | NERB | |
---|---|---|
Water | 32.7 ± 1.0 | 26.14 ± 0.02 |
Lipids | 2.76 ± 0.02 | 1.16 ± 0.02 |
Carbohydrates | 44.3 ± 0.4 | 51.5 ± 1.3 |
Soluble fiber | 3.4 ± 0.1 | 4.0 ± 1.3 |
Insoluble fiber | 10.3 ± 1.4 | 10.7 ± 0.16 |
Proteins | 5.16 ± 0.03 | 5.85 ± 0.11 |
Ash | 1.37 ± 0.04 | 1.47 ± 0.02 |
Plant sterols | 1.6 ± 0.04 | 0.05 ± 0.001 |
Gene | Primer Sequence (5′→3′) | Efficiency (%) | |
---|---|---|---|
Forward | Reverse | ||
BAX | GGGCCCACCAGCTCTGA | CCTGCTCGATCCTGGATGA | 108 |
BCL2 | GGATTGTGGCCTTCTTTGAG | GCCGGTTCAGGTACTCAGTC | 121 |
CASP3 | CCTGGTTATTATTCTTGGCGAAA | GCACAAAGCGACTGGATGAA | 125 |
CASP8 | CAGGCAGGGCTCAAATTTCT | TCTGCTCACTTCTTCTGAAATCTGA | 121 |
CASP9 | TGCTGAGCAGCGAGCTGTT | AGCCTGCCCGCTGGAT | 130 |
CDKN1A | GATGAGTTGGGAGGAGGCAG | GAGCGAGGCACAAGGGTACA | 140 |
TP53 | CCACCATCCACTACAACTACAT | CACAAACACGCACCTCAAA | 135 |
CCND1 | CCCTCGGTGTCCTACTTCAA | AGGAAGCGGTCCAGGTAGTT | 107 |
CCNE1 | CTCCAGGAAGAGGAAGGCAA | TCGATTTTGGCCATTTCTTCA | 127 |
ACTB | CTGGAACGGTGAAGGTGACA | AAGGGACTTCCTGTAACAATGCA | 112 |
Viability (% of Control) | ||||||
---|---|---|---|---|---|---|
CCD-18Co | Caco-2 | |||||
Treatment | 1/5 | 1/10 | 1/20 | 1/5 | 1/10 | 1/20 |
SB | 97.79 ± 8.09 aA | 98.90 ± 7.41 aA | 88.56 ± 4.02 aA | 73.36 ± 2.49 aB | 82.02 ± 12.42 aB | 119.75 ± 17.65 aA |
FL0 | 102.70 ± 6.96 aA | 181.36 ± 17.18 bA | 175.96 ± 20.90 bA | 62.25 ± 2.54 bB | 100.33 ± 1.01bA | 109.53 ± 7.92 aA |
WB | 104.34 ± 6.35 aA | 104.22 ± 6.66 aA | 101.62 ± 5.78 aA | 98.17 ± 11.09 cA | 96.89 ± 7.44 abA | 106.35 ± 14.38 aA |
FLPS | 105.16 ± 8.77 aA | 103.05 ± 11.10 aA | 102.32 ± 18.04 aA | 65.00 ± 1.72 bB | 97.90 ± 0.61 bA | 104.78 ± 20.12 aA |
5-FU (25µM) | 96.39 ± 19.01 | 84.96 ± 4.91 |
Acetate | Propionate | Butyrate | Valerate | Total | |
---|---|---|---|---|---|
SB | 30.99 ± 0.22 a | 12.58 ± 0.30 a | 4.03 ± 0.00 a | 3.35 ± 0.00 a | 55.66 ± 0.54 a |
FL0 | 31.84 ± 1.84 a | 2.25 ± 0.01 b | 29.09 ± 0.60 b | 0.67 ± 0.02 b | 65.30 ± 1.19 b |
WB | 40.29 ± 0.59 b | 15.42 ± 0.22c | 3.79 ± 0.11 c | 3.54 ± 0.03 c | 67.34 ± 0.99 b |
FLPS | 12.65 ± 12.65 c | 1.38 ± 0.01 d | 3.75 ± 0.05 c | 0.37 ± 0.00 d | 18.49 ± 0.06 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miedes, D.; Cilla, A.; Alegría, A. Chemopreventive Effect of an In Vitro Digested and Fermented Plant Sterol-Enriched Wholemeal Rye Bread in Colon Cancer Cells. Foods 2024, 13, 112. https://doi.org/10.3390/foods13010112
Miedes D, Cilla A, Alegría A. Chemopreventive Effect of an In Vitro Digested and Fermented Plant Sterol-Enriched Wholemeal Rye Bread in Colon Cancer Cells. Foods. 2024; 13(1):112. https://doi.org/10.3390/foods13010112
Chicago/Turabian StyleMiedes, Diego, Antonio Cilla, and Amparo Alegría. 2024. "Chemopreventive Effect of an In Vitro Digested and Fermented Plant Sterol-Enriched Wholemeal Rye Bread in Colon Cancer Cells" Foods 13, no. 1: 112. https://doi.org/10.3390/foods13010112