Next Article in Journal
Antioxidant Activity, Physicochemical and Sensory Properties of Stingless Bee Honey from Australia
Previous Article in Journal
Development and Validation of Near-Infrared Reflectance Spectroscopy Prediction Modeling for the Rapid Estimation of Biochemical Traits in Potato
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence and Antimicrobial Resistance of Listeria monocytogenes in Different Raw Food from Reynosa, Tamaulipas, Mexico

by
Paulina Guel-García
1,
Francisco Javier García De León
2,
Guadalupe Aguilera-Arreola
3,
Antonio Mandujano
1,
Maribel Mireles-Martínez
1,
Amanda Oliva-Hernández
1,
María Antonia Cruz-Hernández
1,
Jose Vasquez-Villanueva
4,
Gildardo Rivera
1,
Virgilio Bocanegra-García
1 and
Ana Verónica Martínez-Vázquez
1,*
1
Centro de Biotecnología Genómica, Instituto Politécnico Nacional, Reynosa C.P. 88710, Tamaulipas, Mexico
2
Laboratorio de Genética para la Conservación, Centro de Investigaciones Biológicas del Noroeste, S.C., La Paz C.P. 23090, Baja California Sur, Mexico
3
Laboratorio de Bacteriología Medica, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, México City C.P. 11340, Mexico
4
Facultad de Medicina Veterinaria y Zootecnia, Universidad Autónoma de Tamaulipas, Ciudad Victoria C.P. 87274, Tamaulipas, Mexico
*
Author to whom correspondence should be addressed.
Foods 2024, 13(11), 1656; https://doi.org/10.3390/foods13111656
Submission received: 24 April 2024 / Revised: 17 May 2024 / Accepted: 22 May 2024 / Published: 25 May 2024
(This article belongs to the Section Food Microbiology)

Abstract

Listeria (L.) monocytogenes is an opportunistic foodborne pathogen that causes listeriosis in humans and animals, reaching up to 30% case mortality. There are only a few reports in Mexico about the L. monocytogenes strains found in various foods. The aim of this study was to determine the prevalence of L. monocytogenes, serogroups, virulence genes, and antimicrobial resistance in different foods from Reynosa, Tamaulipas, Mexico. L. monocytogenes strains were characterized by microbiological and molecular methods. Susceptibility to 12 antibiotics was determined according to CLSI and EUCAST. A total of 300 samples of seafood, pasteurized and raw milk, cheese, beef, and chicken were collected from supermarkets and retail markets. The presence of L. monocytogenes was detected in 5.6% of the samples. Most strains belonged to serogroups 4b, 4d, and 4e (68.4%). All strains presented a minimum of four virulence genes; the most common were actA, hly, and plcB (92.1%). A high percentage of antimicrobial susceptibility was observed, with resistance only to STX-TMP (78.9%), STR (26.3%), MEM (21.0%), and E (2.6%). These results show that the foods in Reynosa, Tamaulipas, are a reservoir of L. monocytogenes and represent a potential health risk.

1. Introduction

Listeria (L.) monocytogenes is an opportunistic bacterium that can produce listeriosis in humans and animals, with a significant mortality rate of 20–30% worldwide [1,2]. These bacteria are characterized by their ability to survive and multiply in adverse environmental conditions that allow them to be present in different reservoirs, such as animals, water, soil, surfaces, and food [3].
The Centers for Disease Control and Prevention (CDC) estimates that Listeria is the third leading cause of death from foodborne illness in the United States [4]. In that country alone, the CDC estimates, 1600 people become sick from listeriosis each year and about 260 die [4]. The difference between infections with mild and severe symptoms depends on the age of the infected person, their immune status, the number of bacterial cells ingested, and the virulence properties of the strain [2]. As an invasive intracellular pathogen, L. monocytogenes depends on an arsenal of virulence factors to facilitate its colonization of the gastrointestinal tract, survival, and spread of infection [5].
L. monocytogenes consists of four major evolutionary lineages (I, II, III and rare lineage IV), including 14 recognized serotypes that are grouped into four PCR serogroups [6].
Lineages I and II include most of the isolates linked to clinical cases of listeriosis. The lineage I group contains serotypes 1/2b, 3b, and 4b and has greater pathogenic potential than lineage II, which is composed of serotypes 1/2a, 1/2c, 3a, and 3c. Lineage IV groups serotypes 4a and 4c and an atypical 4b [6,7].
In listeriosis, four pathogenicity islands have been identified; LIPI-1 (actA, prfA, hlyA, mpl, plcA, plcB) and LIPI-2 (inlA, inlB, inlC, inlJ) promote adhesion, invasion, and the spread from cell to cell within the host organism, LIPI-3 (llsA, llG, llsH, llsX, llsB, llsY, llsD, llsP) deregulates host activity during infection, and LIPI-4 (licC, licB, licA, lm 900558-70012, lm 900558-70013 and maltose-60-phosphate-glucosidase (glvA)) is strongly related to neural and placental infections [8,9,10].
The standard treatment of severe L. monocytogenes infections is based on amoxicillin, aminopenicillin, or ampicillin alone or in combination with an aminoglycoside (frequently gentamicin) [5,11,12]. The treatment may also include penicillin, sulfamethoxazole/trimethoprim, vancomycin, and erythromycin [4,13,14,15]. These choices are based on antimicrobial agents that are not influenced by the natural (intrinsic) resistance of L. monocytogenes. Some factors, such as variance in geographical environments and differences in the application of antibiotics, can influence the resistance or susceptibility patterns of L. monocytogenes isolates [16]. Several studies have detected strains of L. monocytogenes (obtained from food sources) that are resistant to one or several antibiotics, even those used for treatment [17,18,19]. This complicates its treatment and has generated concern in the health sector.
In Mexico, reporting cases of listeriosis is not mandatory, and since there are no epidemiological statistics, the risk it represents to public health is unknown [19,20]. Although the transmission of listeriosis is mainly associated with food, only a few studies have been published on the prevalence or resistance to antibiotics; for example, Cruz-Pulido et al. [19] reported a 1.4% prevalence of L. monocytogenes in frozen chicken from Reynosa, Tamaulipas (which shares a border with the United States). Subsequently, Rubio et al. [21] detected L. monocytogenes in 27.7% of strains isolated from beef samples obtained from cities in the north, center, and south of the country (Monterrey, Mexico City, and Tabasco). Then, in Jalisco in 2014, Rosas et al. [22] reported L. monocytogenes in 17.4% of cheese samples. In recent years, Chávez-Martínez et al. [23] have reported a 2.2% prevalence of L. monocytogenes in cheese from Chihuahua. All these studies have shown the presence of L. monocytogenes in different foods, with variable prevalence percentages based on geographical area. However, it is important to highlight that although the presence of L. monocytogenes in food already represents a potential risk to the consumer’s health, the published information is limited; therefore, this also limits the reaction capacity for the health sector in Mexico.
Therefore, to carry out a more efficient risk assessment and establish control strategies for this bacterium, it is necessary to understand its adaptive mechanisms.
For these reasons, we are interested in evaluating the prevalence levels of L. monocytogenes in a border city of the United States and Mexico and defining the serogroups, presence of virulence genes, and antimicrobial resistance in raw food.

2. Materials and Methods

2.1. Sample Collection

A total of 300 samples were collected from supermarkets and retail markets in Reynosa, Tamaulipas. The samples collected were raw poultry (n = 60), ground beef (n = 60), seafood (n = 20 fish, n = 20 shrimp, and n = 20 crabs), cheese (n = 30 fresh cheese and n = 30 mature cheese), and milk (n = 30 pasteurized milk and n = 30 raw milk).
The samples were placed individually in sterile bags, labeled, and stored in a cooler for cold transport to the laboratory.

2.2. Isolation and Identification of Listeria monocytogenes

Each sample of 25 g was mixed in 225 mL of peptone water (Becton Dickson & Co., Cuautitlán Izcalli, Mexico) to obtain a 1:9 proportion and incubated for 24 h at 37 °C. After incubation, plates with CHROMagar™ Listeria (CHROMagar Company, Paris, France) were inoculated and incubated at 37 °C for 24 h. Consider a typical appearance of the L. monocytogenes colony: blue in color, diameter less than 3 mm, and regular white halo (manufacturer’s manual).
Identification was made via MALDI-TOF mass spectrophotometry and polymerase chain reaction (PCR), using L. monocytogenes CCM5577 as a positive control.
The mass spectrum ranged from 2000 to 20,000 Da, and it was generated with the VITEK MS Plus mass spectrometer (bioMerieux, Marcy l’Etoile, France). For each bacterial sample, mass fingerprints were processed by Compute Engine and the advanced spectrum classifier (ASC) algorithm of the VITEK MS system, which automatically identifies a species by comparing the obtained spectrum (presence or absence of specific peaks) with the spectra typical of each claimed species (VITEK MS IVD version 3.0.0). In line with the manufacturer’s instructions, a confidence interval of 60–99% was considered acceptable for species level identification (ID).
For species identification by PCR, bacterial DNA extraction is first obtained from a pure culture on tryptic soy agar (BD Becton Dickinson & Co., Cuautitlán Izcalli, Mexico) by lysis of a bacterial cell suspension at 95 °C for 15 min, followed by centrifugation at 13,000× g for 3 min [24].
A PCR was performed to identify the isolates as L. monocytogenes by using the amplification of gene lmo224 at the 420 base pair (bp) (F-TGTCCAGTTCCATTTTTAACT and R-TTGTTGTTCTGCTGTACGA) [25]. The reaction mixture contained 5× buffer (5X Colorless GoTaq® Flexi Buffer, Promega, Madison, WI, USA), 25 mM MgCl2 (Magnesium Chloride Solution, 25 mM, Promega, USA), 10 µM dNTPs (Bioline, Taunton, MA, USA), 10 µM primers, 5 U/µL Taq DNA polymerase (Promega, USA), and sterile water in a final volume of 25 mL.
Amplification conditions were as follows: denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C for 40 s, 52 °C for 1.15 min, and 72 °C for 1.15 min, and finally one cycle at 72 °C for 7 min in a thermocycler VeritiTM 60 well Thermal Cycler (Applied BiosystemsTM, Waltham, MA, USA). PCR products were evaluated in 2.5% agarose gels with TBE 0.5X at 1.5% (w/v), with SYBR Gold (Invitrogen, Paisley, UK) and molecular marker (100 pb Promega, WI, USA) at 100 V for 45 min.

2.3. Classification of L. monocytogenes Serogroups

Strains confirmed as L. monocytogenes were further analyzed for serogroup identification by PCR, as described by Doumith et al. [26]. The serotypes of L. monocytogenes are grouped into four PCR serogroups:
Serogroup 1—Comprising strains of serovars 1/2a and 3a (amplification of only the lmo0737 DNA fragment).
Serogroup 2—Comprising strains of serovars 1/2c and 3c (amplification of both the lmo0737 and lmo1118 DNA fragments).
Serogroup 3—Comprising strains of serovars 1/2b, 3b, and 7 (amplification of only an ORF2819 DNA fragment).
Serogroup 4—Comprising strains of serovars 4b, 4d, and 4e (amplification of both ORF2819 and ORF2110 DNA fragments).
The marker genes selected for the multiplex PCR assay were lmo0737 and lmo1118, identified in L. monocytogenes serovar 1/2a, and ORF2819 and ORF2110, identified in L. monocytogenes 4b. The prs gene, specific for strains of the genus Listeria, was targeted for an internal amplification control (Table 1) [26].
The PCR mixture contained 5X buffer, 25 mM MgCl2, 10 mM dNTPs, 10 mM of each primer, and 5 U Taq DNA polymerase. The PCR amplification conditions were as follows: initial denaturation at 95 °C for 1 min, followed by 30 cycles of denaturation at 95 °C for 45 s, annealing at 53 °C for 45 s, extension at 72 °C for 45 s, and a final cycle of amplification at 72 °C for 7 min. Verification of the PCR products was performed using 2% agarose gel at 100 V for 45 min. L. monocytogenes 4b ATCC 13932 was used as positive control, and nuclease-free water was used as negative control.
The classification of the serogroups was carried out as described by the protocol of Doumith et al. [26], considering the presence/absence of the genes (Table 2).

2.4. Virulence Factors

PCR was carried out using target gene-specific primers, including those for genes encoded in LIPI-1 (actA, hly, mpl, plcA, plcB and prfA), LIPI-2 (inlA, inlB and inlC), and LIPI-3 (llsX) (Table 3) [27,28,29,30,31,32,33].
PCR mix was prepared in a total reaction volume of 20 μL, as follows: buffer 5X, MgCl2 25 mM, dNTPs 10 mM, primer 10 mM, Taq DNA polymerase 5 U. The PCR cycling conditions were as follows: the initial denaturation step at 1 min at 95 °C, 30 cycles of 95 °C for 45 s, variable alignment temperature depending on the primers (Table 3) for 45 s, 72 °C for 45 s, and a final extension at 72 °C for 7 min.
Verification of PCR products was performed in electrophoresis using 2% agarose gel.

2.5. Antimicrobial Susceptibility Testing

This test was performed according to the Clinical & Laboratory Standards Institute (CLSI) and the European Committee on Antimicrobial Susceptibility Testing (EUCAST) manual [34,35], by using the Kirby–Bauer method. The strains at a concentration of 0.5 McFarland were inoculated on a Mueller–Hinton agar plate (Becton Dickinson & Co., Franklin Lakes, NJ, USA). The antimicrobial disks were individually firmly placed on the inoculated plate. The plates were incubated at 37 °C for 24 h. The antimicrobials tested in this study were ampicillin (AM; 10 µg), chloramphenicol (C; 30 µg), ciprofloxacin (CIP; 5 µg), erythromycin (E; 15 µg), gentamicin (GM; 10 µg), levofloxacin (LEV; 5 µg), meropenem (MEM; 10 µg), penicillin (P; 10 µg), streptomycin (STR; 10 µg), sulfamethoxazole/trimethoprim (STX/TMP; 23.75/1.15 µg), tetracycline (TE; 30 µg), and vancomycin (VAN; 30 µg) (Sensi-DiskTM, Becton Dickson & Co., USA). After incubation, the diameter of the clear zone of inhibition around each antimicrobial disk was measured in millimeters and the results were interpreted according to interpretative criteria provided by the CLSI and EUCAST.
A multiple antibiotic resistance (MAR) index was determined by using the number of antibiotics to which each isolate was resistant, along with the total number of antibiotics that were evaluated. Results over or equal to 0.2 indicate an intensive and inappropriate use of resistant antibiotics and represent a high risk of promoting antibiotic resistance [36,37].

2.6. Statistical Analysis

Analysis of the positive and negative samples was carried out with the chi-square test in the GraphPad Prism version 5.03 software.
A matrix was constructed using the data belonging to the virulence factors, which were evaluated in a dichotomic fashion, where 1 represented the presence of a gene and 0 represented its absence. As for the antimicrobials, resistance was represented with 1, the intermediate with 0.5, and susceptibility with 0. This matrix was used for the construction of the heatmap and the correlation matrix, both performed in R Studio [38]. A heatmap graph was plotted with the package “ComplexHeatmap” [39]. The optimal number of clusters in the dendrograms used in the heatmap was calculated with the package “factoextra” with the function “fviz_nbclust” and the “wss” and “silhouette” methods. The correlation matrix was constructed with the “metan” package with the functions “corr_coef” and “plot”, using Spearman’s correlation [40].

3. Results

3.1. Sample Collection

A total of 300 samples were collected.

3.2. Isolation and Identification of Listeria monocytogenes

A total of 300 samples were analyzed for L. monocytogenes, of which 5.6% (17/300) were positive to L. monocytogenes according to the specific characteristics of CHROMagar™ Listeria. Positive samples were only identified in ground beef, chicken, and cheese; in the rest of the foods (seafood and milk), it was not present. In the ground beef, 10% (6/60) positive samples were detected; for chicken, this was only 5% (3/60), and for fresh cheese, it was 26.6% (8/30). From each positive sample, one to five strains were isolated and identified as L. monocytogenes, making a total of 66 strains. All strains were analyzed by PCR, considering only those that presented the lmo224 gene positive for L. monocytogenes. To confirm the identification of the species, the strains were also analyzed using MALDI-TOF, considering only those that presented a confidence interval greater than 98% for the identification of L. monocytogenes as positive. Afterward, tests were carried out to rule out possible clones, leaving only 38 strains in the end (11 ground beef strains, 4 chicken strains, and 23 cheese strains).

3.3. Classification of Serogroups

Three out of four possible PCR serogroups were identified in the 38 evaluated strains. Most of the strains were serogroup 4b, 4d, 4e (68.4%; 26/38), followed by 1/2a, 3a (23.7%; 9/38) and 1/2b, 3b (7.9%; 3/38). No strains were detected for serogroup 1/2c, 3c (0.0%; 0/38) (Table 4).

3.4. Virulence Factors

Of the ten virulence factors evaluated, all strains (38/38) showed a minimum of 4 and a maximum of 8. None of the assessed strains harbored all virulence genes.
In 21.0% (8/38) of the strains, four virulence factors were detected; in 7.8% (3/38), there were five; in 23.6% (9/38), six were detected; in 18.4% (7/38), there were seven; and in 28.9% (11/38), eight virulence factors were identified. The genes found most frequently in the strains were actA, hly, and plcB, at 92.1% (35/38). On the contrary, the virulence factors with the least frequency were mpl and prfA, in 21.0% (8/38) of the strains (Table 5).

3.5. Antimicrobial Susceptibility Test

In total, 78.9% (30/38) of the strains showed resistance to at least one antibiotic tested, and 21.0% (8/38) were susceptible to all antibiotics. All strains (38/38) were susceptible to AM, C, GM, LEV, P, TE, and VAN. The strains were mostly resistant to STX-TMP, at 78.9% (30/38); STR, at 26.3% (10/38); MEM, at 21.0% (8/38); and E, at 2.6% (1/38) (Table 6). Multidrug resistance was detected in 13.1% (5/38) of the strains, showing resistance to at least three different antimicrobials from different classes.
The multiple antibiotic resistance index (MARI) values ranged from 0.083 to 0.250. Only 13.1% (5/38) of the strains analyzed had values greater than 0.2 (Table 7).
The results of the correlation analysis of the virulence factors revealed a strong positive correlation between the llsX and prfA genes (−0.76 ***), the llsX and mpl genes (−0.76 ***), and the plcA and prfA genes (−0.52 ***), thus also the plcA and mpl genes (−0.52 ***) (Figure 1). A moderate positive correlation between the llsX and inlA genes (−0.43 **) was obtained.
The heatmap in Figure 2 shows the presence or absence of the virulence factors. We found two main clusters, in which 29 strains belonged to cluster 1, and 9 to cluster 2; along with this, 16 subclusters were identified. Clade 1 englobes all strains of serogroups 4b, 4d, 4e and 1/2b, 3b; interestingly, all belong to lineage I. All nine strains in clade 2 were represented by serogroup 1/2a, 3a from lineage II. We could not observe the presence of the mpl and prfA genes in clade 1, but that was not the case for gene llsX, which was only present in the strains of lineage I. This is corroborated by the findings of Figure 1, where these genes exhibit a higher negative correlation, signifying their absence relative to other genes.

4. Discussion

L. monocytogenes is the bacterium responsible for a foodborne disease named listeriosis, which is not mandatory to be reported by national authorities in Mexico. The absence of official reports about this disease in that country has led to an undetermined potential risk to public health via the consumption of diverse foods that may be contaminated.
In this study, we found an overall prevalence of 5.6% (17/300) in different raw foods from Reynosa, Tamaulipas, Mexico. No strains of L. monocytogenes were detected in the seafood and milk (raw or pasteurized) samples included in this study. However, despite these results, it is important to note that its presence has been reported in a range of 0.5 to 15.5% in studies carried out in other countries [41,42,43,44,45]. The fact that L. monocytogenes was absent in the raw milk (n = 30) and pasteurized milk (n = 30) samples might seem like an expected result since pasteurized milk should prevent bacteria growth. However, several authors have reported the presence of L. monocytogenes in pasteurized milk, showing an average prevalence of 12.5% (0.1–20.0%) [46,47,48], while in the same studies, for raw milk, the prevalence of L. monocytogenes was 4.9% (2.0–7.6%) [46,47,48]. This led us to assume that the presence of L. monocytogenes in pasteurized milk could be due to a deficient process or poor hygienic handling practices. For Mexico, Ríos-Muñiz et al. [49] and Silva et al. [50] have described the absence of L. monocytogenes strains in raw milk (pasteurized milk samples were not included in these studies).
Among the food samples positive for L. monocytogenes, fresh cheese showed a prevalence of 26.6% (8/30), but the bacteria were absent in all the mature cheeses (0/30). This level of prevalence in fresh cheeses (26.6%) might seem high compared with what has been published for various countries, at less than 9.3% [51,52,53,54,55,56,57], and a few studies have reported a higher prevalence range of 17.6 to 60% [45,47,58]. The variation in the prevalence of L. monocytogenes may be due to several factors. For example, the raw or pasteurized milk with which cheeses are prepared can be contaminated due to inadequate pasteurization or post-pasteurization contamination [59]. Furthermore, it should be considered that contamination can occur at different stages during cheese production since processing plants can harbor L. monocytogenes in the environment and on equipment [60].
Raw chicken samples are known to be one of the main foods susceptible to L. monocytogenes contamination [56,57]. This study had a prevalence of 5% (3/60), similar to the 3.5% reported by Zhang et al. in China [61]. However, this can be considered a low percentage compared with the results obtained in other similar studies, of 8.5 to 53.3% [57,62,63,64,65,66,67]. In contrast to the findings reported by Mamber et al. [68], our results showed a higher percentage. In their study, 0.46% of chicken samples collected from the USA were tested positive for L. monocytogenes. It is important to consider that L. monocytogenes contamination of poultry meat may occur during production, processing, and storage [62,65]. Therefore, good thermic treatment, personnel hygiene, cleaning applications, and processing and storage conditions may prevent L. monocytogenes contamination during food processing [65,67].
The ground beef samples included in the current study had an L. monocytogenes prevalence of 10% (6/60). These results are similar to those reported in other studies, like 7.3% in South Africa [69], 8.9% in India [64], 9.0% in the United States [70], 9.1% in China [71], 14% in Brazil [72], and 14% in Egypt [44]. According to these comparisons, beef appears to be treated in the same way and with the same hygiene handling processes. Although the percentage of L. monocytogenes in the samples seems low, its presence still represents a risk to the consumer’s health. Therefore, it is necessary to improve meat handling practices throughout the production chain, as well as how to handle the meat once purchased, avoid cross-contamination in the kitchen, and ensure correct cooking.
From the 38 strains positive for L. monocytogenes in the current study, three of the four possible PCR serogroups were identified (present: serogroup 1/2a, 3a, serogroup 1/2b, 3c and serogroup 4b, 4d, 4c; absent: serogroup 1/2c, 3c). The multiplex PCR profiles did not distinguish serovar 1/2a from 3a, 1/2c from 3b, and 7 or 4b from 4d and 4e within L. monocytogenes. However, serovars 3a, 3b, 3c, 4a, 4c, 4e, 4d, and 7 are very infrequent in food and rarely reported as implicated in human listeriosis [73].
Serotypes 4b, 1/2a, and 1/2b have been related to listeriosis cases in humans and are responsible for 95% of the cases reported worldwide [74,75,76]. Still, among these serotypes, 4b stands out for being associated with more than half of human clinical cases, while strains of serotypes 1/2a or 1/2b have only been associated with sporadic cases of listeriosis in Europe and North America [73,74,76,77,78]. In previous studies, serotype 1/2a has been predominant while serotype 4b has usually been underrepresented [73,74,75]. In the current results, serotype 4b was dominant in foods. Locatelli et al. [75] have suggested that strain competition among L. monocytogenes serotypes 1/2a, 1/2b, 1/2c, and 4b is merely the result of bacterial interactions on the meat product among strains of the same species with almost the same growth potential.
These serotypes are further bifurcated into four major genetic diversity lineages: lineage I, lineage II, lineage III, and lineage IV. Each lineage possesses specific serotypes. The strains included in the current study were classified into only two lineages: serotypes 4b, 4d, 4c and 1/2b, 3b within lineage I and serotype 1/2a, 3a in lineage II. None of the strains was identified as lineage III or IV. Serotypes 1/2b and 4b within lineage I are encoded for the virulence factor called listeriolysin S, which is not found in other lineages [8,73]. Lineage II harbors 1/2a, 3a, which has numerous plasmids that are resistant to heavy metals and antibiotics [8]. Most strains isolated in this study exhibited serotypes associated with listeriosis (4b and 1/2a = 92.1%, 35/38), which can represent a potential risk to public health.
The ability of L. monocytogenes to infect a human host and cross the intestinal barrier, reaching other pivotal parts of the body, is highly related to the presence of pathogenic islands (LIPI-1, LIPI-3 and LIPI-4) [79,80]. Current investigations indicate that virulence factors are key for the adaptation of L. monocytogenes to its host and its optimal spread in the environment [81]. Internalin A is a major factor in inducing the internalization of L. monocytogenes in epithelial cells, and internalin B is important in placental invasion [80]. For this use, two internalins, A (InlA) and B (InlB), present in the genome, with a minor contribution by the toxin listeriolysin O (LLO), induce the uptake of the bacterium [82]. In this study, a moderate correlation was obtained between inlA and llsX (0.43). The internalins inlA, inlB, and inlC were found at 71.1% (27/38), 63.2% (24/38), and 55.3% (21/38), respectively. The presence of these internalins indicates the ability of these strains to cause listeriosis.
For its part, prfA prepares L. monocytogenes for internalization and intracellular life, inducing the transcription of LIPI-1, the main virulence regulon [82]. LIPI-1 includes prfA itself and genes encoding listeriolysin O (hly), phospholipase A (plcA), phospholipase B (plcB), actin assembly inducing-protein (actA), a zinc metalloproteinase (mpl), and orfX (orfX) [80]. This explains the correlation existing in the current results between the virulence factors prfA and plcA (0.52), as well as between plcA and mpl (0.52). The presence of prfA in these strains tells us their ability to form biofilms that may provide selective pressure to maintain this critical virulence regulation when L. monocytogenes is outside of host cells in the environment.
L. monocytogenes infections are commonly treated with antibiotics such as ampicillin, gentamicin, penicillin, trimethoprim/sulfamethoxazole, vancomycin, and erythromycin [4,8,9,10]. The most common antibiotic regimen prescribed for listeriosis includes penicillin/ampicillin alone or in combination with aminoglycosides (gentamicin) [70]. In our results, the L. monocytogenes strains analyzed were shown to be 100% sensitive to ampicillin and 97.2% to gentamicin, indicating that these continue to be effective treatments.
The strains isolated in this study were tested with a panel of 12 antibiotics, showing resistance to only 4 of these: sulfamethoxazole/trimethoprim, at 78.9%; streptomycin, at 26.3%; meropenem, at 21.1%; and gentamycin, at 2.6%. Most of the strains were resistant to sulfamethoxazole/trimethoprim (78.9%), which serves as a critical warning, as sulfamethoxazole/trimethoprim is an alternative or secondary treatment for listeriosis in meningoencephalitis caused by L. monocytogenes [83,84]. Except for the sulfamethoxazole/trimethoprim combination (78.9%), which showed high resistance against L. monocytogenes isolates, the strains showed high susceptibility to most of the antibiotics tested, coinciding with the susceptibility pattern commonly reported in other studies.

5. Conclusions

The results obtained in this study revealed a low prevalence of L. monocytogenes in foods marketed in Reynosa, Tamaulipas. The bacteria were identified only in fresh cheese, beef, and chicken, with mainly the strains of serogroup 4b, 4d, 4e associated with listeriosis. All strains presented at least four virulence genes; the most common were actA, hly, and plcB, which indicates their pathogenic capacity and potential risk for consumers. The strains exhibited a high percentage of antimicrobial susceptibility, showing that common treatments remain effective in most cases. However, the resistance observed relative to STX-TMP and STR deserves attention as to whether it will continue to increase until it represents a problem of ineffectiveness in the treatments. The need to improve measures against policies regarding and surveillance of L. monocytogenes in Reynosa, Tamaulipas, is emphasized. Likewise, the monitoring of antibiotic susceptibility patterns is recommended, considering that a change in these patterns could occur depending on management practices in the productive chain.

Author Contributions

Conceptualization, A.V.M.-V. and P.G.-G.; methodology, P.G.-G., A.M., M.M.-M., A.O.-H., J.V.-V. and G.A.-A.; formal analysis, P.G.-G., M.A.C.-H., G.R., F.J.G.D.L. and A.V.M.-V.; writing—original draft preparation, P.G.-G. and A.M.; writing—review and editing, G.A.-A., M.M.-M., A.O.-H., M.A.C.-H., G.R., F.J.G.D.L., V.B.-G. and A.V.M.-V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Instituto Politécnico Nacional.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wiktorczyk-Kapischke, N.; Skowron, K.; Grudlewska-Buda, K.; Wałecka-Zacharska, E.; Korkus, J.; Gospodarek-Komkowska, E. Adaptive Response of Listeria monocytogenes to the Stress Factors in the Food Processing Environment. Front. Microbiol. 2021, 12, 710085. [Google Scholar] [CrossRef] [Scilit]
  2. Osek, J.; Lachtara, B.; Wieczorek, K. Listeria monocytogenes—How This Pathogen Survives in Food-Production Environments? Front. Microbiol. 2022, 13, 866462. [Google Scholar] [CrossRef] [Scilit]
  3. Kayode, A.J.; Semerjian, L.; Osaili, T.; Olapade, O.; Okoh, A.I. Occurrence of Multidrug-Resistant Listeria monocytogenes in Environmental Waters: A Menace of Environmental and Public Health Concern. Front. Environ. Sci. 2021, 9, 737435. [Google Scholar] [CrossRef] [Scilit]
  4. Quereda, J.J.; Morón-García, A.; Palacios-Gorba, C.; Dessaux, C.; García-del Portillo, F.; Pucciarelli, M.G.; Ortega, A.D. Pathogenicity and Virulence of Listeria monocytogenes: A Trip from Environmental to Medical Microbiology. Virulence 2021, 12, 2509–2545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Sibanda, T.; Buys, E.M. Listeria monocytogenes Pathogenesis: The Role of Stress Adaptation. Microorganisms 2022, 10, 1522. [Google Scholar] [CrossRef] [Scilit]
  6. Avila-Novoa, M.G.; Navarrete-Sahagún, V.; González-Gómez, J.P.; Novoa-Valdovinos, C.; Guerrero-Medina, P.J.; García-Frutos, R.; Martínez-Chávez, L.; Martínez-Gonzáles, N.E.; Gutiérrez-Lomelí, M. Conditions of in Vitro Biofilm Formation by Serogroups of Listeria monocytogenes Isolated from Hass Avocados Sold at Markets in Mexico. Foods 2021, 10, 2097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Pirone-Davies, C.; Chen, Y.; Pightling, A.; Ryan, G.; Wang, Y.; Yao, K.; Hoffmann, M.; Allard, M.W. Genes Significantly Associated with Lineage II Food Isolates of Listeria monocytogenes. BMC Genom. 2018, 19, 708. [Google Scholar] [CrossRef] [Scilit]
  8. Ravindhiran, R.; Sivarajan, K.; Sekar, J.N.; Murugesan, R.; Dhandapani, K. Listeria monocytogenes an Emerging Pathogen: A Comprehensive Overview on Listeriosis, Virulence Determinants, Detection, and Anti-Listerial Interventions. Microb. Ecol. 2023, 86, 2231–2251. [Google Scholar] [CrossRef] [Scilit]
  9. Chen, Y.; Chen, M.; Wang, J.; Wu, Q.; Cheng, J.; Zhang, J.; Sun, Q.; Xue, L.; Zeng, H.; Lei, T.; et al. Heterogeneity, Characteristics, and Public Health Implications of Listeria monocytogenes in Ready-to-Eat Foods and Pasteurized Milk in China. Front. Microbiol. 2020, 11, 642. [Google Scholar] [CrossRef] [Scilit]
  10. Anwar, T.M.; Pan, H.; Chai, W.; Ed-Dra, A.; Fang, W.; Li, Y.; Yue, M. Genetic Diversity, Virulence Factors, and Antimicrobial Resistance of Listeria monocytogenes from Food, Livestock, and Clinical Samples between 2002 and 2019 in China. Int. J. Food Microbiol. 2022, 366, 109572. [Google Scholar] [CrossRef] [Scilit]
  11. Grosboillot, V.; Keller, I.; Ernst, C.; Loessner, M.J.; Schuppler, M. Ampicillin Treatment of Intracellular Listeria monocytogenes Triggers Formation of Persistent, Drug-Resistant L-Form Cells. Front. Cell. Infect. Microbiol. 2022, 12, 869339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Thønnings, S.; Knudsen, J.D.; Schønheyder, H.C.; Søgaard, M.; Arpi, M.; Gradel, K.O.; Østergaard, C.; Danish Collaborative Bacteraemia Network (DACOBAN). Antibiotic Treatment and Mortality in Patients with Listeria monocytogenes Meningitis or Bacteraemia. Clin. Microbiol. Infect. 2016, 22, 725–730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Amaya-Villar, R.; García-Cabrera, E.; Sulleiro-Igual, E.; Fernández-Viladrich, P.; Fontanals-Aymerich, D.; Catalán-Alonso, P.; Rodrigo-Gonzalo de Liria, C.; Coloma-Conde, A.; Grill-Díaz, F.; Guerrero-Espejo, A.; et al. Three-Year Multicenter Surveillance of Community-Acquired Listeria monocytogenes Meningitis in Adults. BMC Infect. Dis. 2010, 10, 324. [Google Scholar] [CrossRef] [Scilit]
  14. Torres, K.; Sierra, S.; Potou, R.; Carrascal, A.; Mercado, M. Patogénesis de Listeria monocytogenes, Microorganismo Zoonótico Emergente. Rev. MVZ Córdoba 2005, 10, 511–543. [Google Scholar] [CrossRef] [Scilit]
  15. Baquero, F.; Lanza, V.F.; Duval, M.; Coque, T.M. Ecogenetics of Antibiotic Resistance in Listeria monocytogenes. Mol. Microbiol. 2020, 113, 570–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Akrami-Mohajeri, F.; Derakhshan, Z.; Ferrante, M.; Hamidiyan, N.; Soleymani, M.; Conti, G.O.; Tafti, R.D. The Prevalence and Antimicrobial Resistance of Listeria Spp in Raw Milk and Traditional Dairy Products Delivered in Yazd, Central Iran (2016). Food Chem. Toxicol. 2018, 114, 141–144. [Google Scholar] [CrossRef] [Scilit]
  17. Bouymajane, A.; Rhazi Filali, F.; Oulghazi, S.; Lafkih, N.; Ed-Dra, A.; Aboulkacem, A.; El Allaoui, A.; Ouhmidou, B.; Moumni, M. Occurrence, Antimicrobial Resistance, Serotyping and Virulence Genes of Listeria monocytogenes Isolated from Foods. Heliyon 2021, 7, e06169. [Google Scholar] [CrossRef] [Scilit]
  18. Maćkiw, E.; Korsak, D.; Kowalska, J.; Felix, B.; Stasiak, M.; Kucharek, K.; Antoszewska, A.; Postupolski, J. Genetic Diversity of Listeria monocytogenes Isolated from Ready-to-Eat Food Products in Retail in Poland. Int. J. Food Microbiol. 2021, 358, 109397. [Google Scholar] [CrossRef] [Scilit]
  19. Cruz-Pulido, W.L.; Téllez-Luis, S.J.; Rivera-Sánchez, G.; Ávila-Aguilar, S.; Cantú-Ramírez, R.; Garza-González, E.; Sierra-Juárez, G.; Bocanegra-García, V. Listeria sp. y Listeria monocytogenes En Pollo Congelado: Detección Por NOM-143-SSA1-1995 y PCR de Expendios Comerciales de Matamoros y Reynosa, Tamaulipas, México. CienciaUAT 2012, 6, 41. [Google Scholar] [CrossRef] [Scilit]
  20. Castañeda-Ruelas, G.; Eslava-Campos, C.; Castro-del-Campo, N.; León-Félix, J.; Chaidez-Quiroz, C. Listeriosis En México: Importancia Clínica y Epidemiológica. Salud Publica Mex. 2014, 56, 654–659. [Google Scholar]
  21. Salud Rubio Lozano, M.; Fernando Martínez Bruno, J.; Hernández Castro, R.; Bonilla Contreras, C.; Danilo Méndez Medina, R.; Fernando Núñez Espinosa, J.; Echeverry, A.; Brashears, M.M. Detection of Listeria monocytogenes, Salmonella and Yersinia Enterocolitica in Beef at Points of Sale in Mexico. RES Rev Mex Cienc Pecu 2013, 4, 107–115. [Google Scholar]
  22. Rosas-Barbosa, B.T.; Morales, A.L.-J.; Alaniz, R.; Ramírez-Álvarez, A.; Soltero-Ramos, J.P.; de la Mora-Quiroz, R.; Martin, P.; Jacquet, C. Presencia y Persistencia de Listeria En Cuatro Queserías Artesanales de Jalisco, México. e-CUCBA 2014, 2, 3–37. [Google Scholar]
  23. Chávez-Martínez, A.; Paredes-Montoya, P.; Rentería-Monterrubio, A.L.; Corral-Luna, A.; Lechuga-Valles, R.; Dominguez-Viveros, J.; Sánchez-Vega, R.; Santellano-Estrada, E. Microbial Quality and Prevalence of Foodborne Pathogens of Cheeses Commercialized at Different Retail Points in Mexico. Food Sci. Technol. 2019, 39, 703–710. [Google Scholar] [CrossRef] [Scilit]
  24. Güssow, D.; Clackson, T. Direct Clone Characterization from Plaques and Colonies by the Polymerase Chain Reaction. Nucleic Acids Res. 1989, 17, 4000. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Chen, Y.; Knabel, S.J. Multiplex PCR for Simultaneous Detection of Bacteria of the Genus Listeria, Listeria monocytogenes, and Major Serotypes and Epidemic Clones of L. monocytogenes. Appl. Environ. Microbiol. 2007, 73, 6299–6304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Doumith, M.; Buchrieser, C.; Glaser, P.; Jacquet, C.; Martin, P. Differentiation of the Major Listeria monocytogenes Serovars by Multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Suárez, M.; González-Zorn, B.; Vega, Y.; Chico-Calero, I.; Vázquez-Boland, J.A. A Role for ActA in Epithelial Cell Invasion by Listeria monocytogenes. Cell. Microbiol. 2001, 3, 853–864. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Xu, X.K.; Wu, Q.P.; Zhang, J.M.; Deng, M.Q.; Zhou, Y.H. Studies on Specific Detection of Listeria monocytogenes in Foods by Duplex PCR. Chin. J. Heal. Lab. Technol. 2009, 19, 1199–1201. [Google Scholar]
  29. Chen, M.; Wu, Q.; Zhang, J.; Wang, J. Prevalence and Characterization of Listeria monocytogenes Isolated from Retail-Level Ready-to-Eat Foods in South China. Food Control 2014, 38, 1–7. [Google Scholar] [CrossRef] [Scilit]
  30. Liu, D.; Lawrence, M.L.; Austin, F.W.; Ainsworth, A.J. A Multiplex PCR for Species-and Virulence-Specific Determination of Listeria monocytogenes. J. Microbiol. Methods 2007, 71, 133–140. [Google Scholar] [CrossRef] [Scilit]
  31. Clayton, E.M.; Hill, C.; Cotter, P.D.; Ross, R.P. Real-Time PCR Assay to Differentiate Listeriolysin S-Positive and-Negative Strains of Listeria monocytogenes. Appl. Environ. Microbiol. 2011, 77, 163–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Notermans, S.H.; Dufrenne, J.; Leimeister-Wächter, M.; Domann, E.; Chakraborty, T. Phosphatidylinositol-Specific Phospholipase C Activity as a Marker to Distinguish between Pathogenic and Nonpathogenic Listeria Species. Appl. Environ. Microbiol. 1991, 57, 2666–2670. [Google Scholar] [CrossRef] [Scilit]
  33. Zhang, W.; Jayarao, B.M.; Knabel, S.J. Multi-Virulence-Locus Sequence Typing of Listeria monocytogenes. Appl. Environ. Microbiol. 2004, 70, 913–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. EUCAST The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters 2020. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_criteria/Validation_2024/L._monocytogenes_v_2.2_January_2020.pdf (accessed on 20 January 2020).
  35. Wayne, P.A. CLSI Clinical and Laboratory Standards Institute. M100 Performance Standards for Antimicrobial Susceptibility Testing 2020. Inform Suppl. 2011, 31, 100–121. [Google Scholar]
  36. Elbar, S.; Elkenany, R.; Elhadidy, M.; Younis, G. Prevalence, Virulence and Antibiotic Susceptibility of Listeria monocytogenes Isolated from Sheep. Mansoura Vet. Med. J. 2020, 21, 48–52. [Google Scholar] [CrossRef] [Scilit]
  37. Elsayed, M.M.; Elkenany, R.M.; Zakaria, A.I.; Badawy, B.M. Epidemiological Study on Listeria monocytogenes in Egyptian Dairy Cattle Farms’ Insights into Genetic Diversity of Multi-Antibiotic-Resistant Strains by ERIC-PCR. Environ. Sci. Pollut. Res. 2022, 29, 54359–54377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Allaire, J. RStudio: Integrated Development Environment for R. Boston MA 2012, 770, 165–171. [Google Scholar]
  39. Gu, Z.; Eils, R.; Schlesner, M. Complex Heatmaps Reveal Patterns and Correlations in Multidimensional Genomic Data. Bioinformatics 2016, 32, 2847–2849. [Google Scholar] [CrossRef] [Scilit]
  40. Olivoto, T.; Lúcio, A.D. Metan: An R Package for Multi-environment Trial Analysis. Methods Ecol. Evol. 2020, 11, 783–789. [Google Scholar] [CrossRef] [Scilit]
  41. Zhang, Y.; Dong, S.; Chen, H.; Chen, J.; Zhang, J.; Zhang, Z.; Yang, Y.; Xu, Z.; Zhan, L.; Mei, L. Prevalence, Genotypic Characteristics and Antibiotic Resistance of Listeria monocytogenes from Retail Foods in Bulk in Zhejiang Province, China. Front. Microbiol. 2019, 10, 1710. [Google Scholar] [CrossRef] [Scilit]
  42. Mashak, Z.; Banisharif, F.; Banisharif, G.; Reza Pourian, M.; Eskandari, S.; Seif, A.; Safarpoor Dehkordi, F.; Alavi, I. Prevalence of Listeria Species and Serotyping of Listeria monocytogenes Bacteria Isolated from Seafood Samples. Egypt. J. Vet. Sci. 2021, 52, 1–9. [Google Scholar] [CrossRef] [Scilit]
  43. Menon, K.V.; Sunil, B.; Latha, C. Prevalence and Antibiotic Resistance Profile of Listeria Spp. Associated with Seafoods from Fish Catchment Areas in Kerala, India. Vet. World 2021, 14, 777–783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Abdeen, E.E.; Mousa, W.S.; Harb, O.H.; Fath-Elbab, G.A.; Nooruzzaman, M.; Gaber, A.; Alsanie, W.F.; Abdeen, A. Prevalence, Antibiogram and Genetic Characterization of Listeria monocytogenes from Food Products in Egypt. Foods 2021, 10, 1381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Zakrzewski, A.J.; Gajewska, J.; Chajęcka-Wierzchowska, W.; Załuski, D.; Zadernowska, A. Prevalence of Listeria monocytogenes and Other Listeria Species in Fish, Fish Products and Fish Processing Environment: A Systematic Review and Meta-Analysis. Sci. Total Environ. 2023, 907, 167912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Kayode, A.J.; Okoh, A.I. Assessment of Multidrug-Resistant Listeria monocytogenes in Milk and Milk Product and One Health Perspective. PLoS ONE 2022, 17, e0270993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Oluwafemi, Y.D.; Igere, B.E.; Ekundayo, T.C.; Ijabadeniyi, O.A. Prevalence of Listeria monocytogenes in Milk in Africa: A Generalized Logistic Mixed-Effects and Meta-Regression Modelling. Sci. Rep. 2023, 13, 12646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Seyoum, E.T.; Woldetsadik, D.A.; Mekonen, T.K.; Gezahegn, H.A.; Gebreyes, W.A. Prevalence of Listeria monocytogenes in Raw Bovine Milk and Milk Products from Central Highlands of Ethiopia. J. Infect. Dev. Ctries. 2015, 9, 1204–1209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Rios-Muñiz, D.; Cerna-Cortes, J.F.; Lopez-Saucedo, C.; Angeles-Morales, E.; Bobadilla-Del Valle, M.; Ponce-De Leon, A.; Estrada-Garcia, T. Longitudinal Analysis of the Microbiological Quality of Raw Cow’s Milk Samples Collected from Three Small Family Dairy Farms in Mexico over a 2-Year Period. J. Food Prot. 2019, 82, 2194–2200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Silva-Paz, L.E.; Medina-Basulto, G.E.; López-Valencia, G.; Montaño-Gómez, M.F.; Villa-Angulo, R.; Herrera Ramírez, J.C.; González-Silva, A.L.; Monge-Navarro, F.; Cueto-González, S.A.; Felipe-García, G. Characterization of the Milk and Artisanal Cheese of the Region of Ojos Negros, Baja California, México. Rev. Mex. ciencias Pecu. 2020, 11, 553–564. [Google Scholar] [CrossRef] [Scilit]
  51. Lee, J.; Seo, Y.; Ha, J.; Kim, S.; Choi, Y.; Oh, H.; Lee, Y.; Kim, Y.; Kang, J.; Park, E.; et al. Influence of Milk Microbiota on Listeria monocytogenes Survival during Cheese Ripening. Food Sci. Nutr. 2020, 8, 5071–5076. [Google Scholar] [CrossRef] [Scilit]
  52. EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control). The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSA J. 2018, 16, 5500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Pyz-łukasik, R.; Gondek, M.; Winiarczyk, D.; Michalak, K.; Paszkiewicz, W.; Piróg-Komorowska, A.; Policht, A.; Ziomek, M. Occurrence of Listeria monocytogenes in Artisanal Cheeses from Poland and Its Identification by Maldi-Tof Ms. Pathogens 2021, 10, 632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Costanzo, N.; Ceniti, C.; Santoro, A.; Clausi, M.T.; Casalinuovo, F. Foodborne Pathogen Assessment in Raw Milk Cheeses. Int. J. Food Sci. 2020, 2020, 3616713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Merchán, N.; Zurymar, T.S.; Niño, L.; Urbano, E. Determinación de la Inocuidad Microbiológica de Quesos Artesanales Según Las Normas Técnicas Colombianas. Rev. Chil. Nutr. 2019, 46, 288–294. [Google Scholar] [CrossRef] [Scilit]
  56. Cufaoglu, G.; Ambarcioglu, P.; Ayaz, N.D. Meta-Analysis of the Prevalence of Listeria Spp. and Antibiotic Resistant, L. monocytogenes Isolates from Foods in Turkey. LWT 2021, 144, 111210. [Google Scholar] [CrossRef] [Scilit]
  57. Shourav, A.H.; Salma, K.P.; Ahmed, S.; Khan, R. Listeria monocytogenes in Ready-to-Eat Chicken Products, Their Antibiotic Resistance and Virulence Genes. Biores. Commun. 2023, 9, 1160–1169. [Google Scholar] [CrossRef] [Scilit]
  58. Benavides-Sánchez, D.A.; Pena-Serna, C. Approaching the Sensory Profile of Paipa Cheese, the Colombian Ripened Cheese with Protected Designation of Origin. Braz. J. Food Technol. 2022, 25, e2022121. [Google Scholar] [CrossRef] [Scilit]
  59. Martinez-Rios, V.; Dalgaard, P. Prevalence of Listeria monocytogenes in European Cheeses: A Systematic Review and Meta-Analysis. Food Control 2018, 84, 205–214. [Google Scholar] [CrossRef] [Scilit]
  60. Campagnollo, F.B.; Gonzales-Barron, U.; Pilão Cadavez, V.A.; Sant’Ana, A.S.; Schaffner, D.W. Quantitative Risk Assessment of Listeria monocytogenes in Traditional Minas Cheeses: The Cases of Artisanal Semi-Hard and Fresh Soft Cheeses. Food Control 2018, 92, 370–379. [Google Scholar] [CrossRef] [Scilit]
  61. Zhang, Y.; Zhang, J.; Chang, X.; Qin, S.; Song, Y.; Tian, J.; Ma, A. Analysis of 90 Listeria monocytogenes Contaminated in Poultry and Livestock Meat through Whole-Genome Sequencing. Food Res. Int. 2022, 159, 111641. [Google Scholar] [CrossRef] [Scilit]
  62. Oliveira, T.S.; Varjão, L.M.; da Silva, L.N.N.; de Castro Lisboa Pereira, R.; Hofer, E.; Vallim, D.C.; de Castro Almeida, R.C. Listeria monocytogenes at Chicken Slaughterhouse: Occurrence, Genetic Relationship among Isolates and Evaluation of Antimicrobial Susceptibility. Food Control 2018, 88, 131–138. [Google Scholar] [CrossRef] [Scilit]
  63. Aziz, S.A.A.A.; Mohamed, M.B.E.D. Prevalence, Virulence Genes, and Antimicrobial Resistance Profile of Listeria monocytogenes Isolated from Retail Poultry Shops in Beni-Suef City, Egypt. J. Adv. Vet. Anim. Res. 2020, 7, 710–717. [Google Scholar] [CrossRef] [Scilit]
  64. Shakuntala, I.; Das, S.; Ghatak, S.; Milton, A.A.P.; Sanjukta, R.; Puro, K.-U.U.; Pegu, R.K.; Duarah, A.; Barbuddhe, S.B.; Sen, A. Prevalence, Characterization, and Genetic Diversity of Listeria monocytogenes Isolated from Foods of Animal Origin in North East India. Food Biotechnol. 2019, 33, 237–250. [Google Scholar] [CrossRef] [Scilit]
  65. Aksono, E.B.; Riwu, K.H.P.; Estoepangestie, A.T.S.; Pertiwi, H. Phylogenetic Analysis and Antibiotics Resistance of Listeria monocytogenes Contaminating Chicken Meat in Surabaya, Indonesia. Vet. Med. Int. 2020, 2020, 9761812. [Google Scholar] [CrossRef] [Scilit]
  66. Arslan, S.; Baytur, S. Prevalence and Antimicrobial Resistance of Listeria Species and Subtyping and Virulence Factors of Listeria monocytogenes from Retail Meat. J. Food Saf. 2019, 39, e12578. [Google Scholar] [CrossRef] [Scilit]
  67. Coban, A.; Pennone, V.; Sudagidan, M.; Molva, C.; Jordan, K.; Aydin, A. Prevalence, Virulence Characterization, and Genetic Relatedness of Listeria monocytogenes Isolated from Chicken Retail Points and Poultry Slaughterhouses in Turkey. Braz. J. Microbiol. 2019, 50, 1063–1073. [Google Scholar] [CrossRef] [Scilit]
  68. Mamber, S.W.; Mohr, T.B.; Leathers, C.; Mbandi, E.; Bronstein, P.A.; Barlow, K.; Silverman, M.; Aston, C.; Izsak, Y.; Saini, N.S.; et al. Occurrence of Listeria Monocytogenes in Ready-to-Eat Meat and Poultry Product Verification Testing Samples from U.S. Department of Agriculture-Regulated Producing Establishments, 2005 through 2017. J. Food Prot. 2020, 83, 1598–1606. [Google Scholar] [CrossRef] [Scilit]
  69. Moabelo, K.C.; Gcebe, N.; Gana, J.; Ngoshe, Y.B.; Adesiyun, A.A. Contamination of Beef and Beef Products by Listeria Spp. and Molecular Characterization of L. Monocytogenes in Mpumalanga, South Africa. J. Food Saf. 2023, 43, e13055. [Google Scholar] [CrossRef] [Scilit]
  70. Zhang, H.; Luo, X.; Aspridou, Z.; Misiou, O.; Dong, P.; Zhang, Y. The Prevalence and Antibiotic-Resistant of Listeria Monocytogenes in Livestock and Poultry Meat in China and the EU from 2001 to 2022: A Systematic Review and Meta-Analysis. Foods 2023, 12, 769. [Google Scholar] [CrossRef] [Scilit]
  71. Liu, Y.; Sun, W.; Sun, T.; Gorris, L.G.M.; Wang, X.; Liu, B.; Dong, Q. The Prevalence of Listeria Monocytogenes in Meat Products in China: A Systematic Literature Review and Novel Meta-Analysis Approach. Int. J. Food Microbiol. 2020, 312, 108358. [Google Scholar] [CrossRef] [Scilit]
  72. Cavalcanti, A.A.C.; Limeira, C.H.; de Siqueira, I.N.; de Lima, A.C.; Medeiros, F.J.P.d.; de Souza, J.G.; de Araújo Medeiros, N.G.; de Oliveira Filho, A.A.; de Melo, M.A. The Prevalence of Listeria Monocytogenes in Meat Products in Brazil: A Systematic Literature Review and Meta-Analysis. Res. Vet. Sci. 2022, 145, 169–176. [Google Scholar] [CrossRef] [Scilit]
  73. Datta, A.R.; Burall, L.S. Serotype to Genotype: The Changing Landscape of Listeriosis Outbreak Investigations. Food Microbiol. 2018, 75, 18–27. [Google Scholar] [CrossRef] [Scilit]
  74. Capita, R.; Felices-Mercado, A.; García-Fernández, C.; Alonso-Calleja, C. Characterization of Listeria Monocytogenes Originating from the Spanish Meat-Processing Chain. Foods 2019, 8, 542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Locatelli, A.; Lewis, M.A.; Rothrock, M.J. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria Innocua over Listeria Monocytogenes. Front. Vet. Sci. 2017, 4, 227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Orsi, R.H.; den Bakker, H.C.; Wiedmann, M. Listeria Monocytogenes Lineages: Genomics, Evolution, Ecology, and Phenotypic Characteristics. Int. J. Med. Microbiol. 2011, 301, 79–96. [Google Scholar] [CrossRef] [Scilit]
  77. Andritsos, N.D.; Paramithiotis, S.; Mataragas, M.; Drosinos, E.H. Listeria Monocytogenes Serogroup 1/2 Strains Have a Competitive Growth Advantage over Serotype 4b during Refrigerated Storage of an Artificially Contaminated Ready-to-Eat Pork Meat Product. Appl. Sci. 2021, 11, 6096. [Google Scholar] [CrossRef] [Scilit]
  78. Ricci, A.; Allende, A.; Bolton, D.; Chemaly, M.; Davies, R.; Fernández Escámez, P.S.; Girones, R.; Herman, L.; Koutsoumanis, K.; Nørrung, B.; et al. Listeria Monocytogenes Contamination of Ready-to-Eat Foods and the Risk for Human Health in the EU. EFSA J. 2018, 16, e5134. [Google Scholar] [CrossRef] [Scilit]
  79. Shamloo, E.; Hosseini, H.; Moghadam, A.Z.; Larsen, H.M.; Haslberger, A.; Alebouyeh, M. Importance of Listeria Monocytogenes in Food Safety: A Review of Its Prevalence, Detection, and Antibiotic Resistance. Iran. J. Vet. Res. 2019, 20, 241–254. [Google Scholar] [PubMed]
  80. Radoshevich, L.; Cossart, P. Listeria Monocytogenes: Towards a Complete Picture of Its Physiology and Pathogenesis. Nat. Rev. Microbiol. 2018, 16, 32–46. [Google Scholar] [CrossRef] [Scilit]
  81. Disson, O.; Moura, A.; Lecuit, M. Making Sense of the Biodiversity and Virulence of Listeria Monocytogenes. Trends Microbiol. 2021, 29, 811–822. [Google Scholar] [CrossRef] [Scilit]
  82. Coelho, C.; Brown, L.; Maryam, M.; Vij, R.; Smith, D.F.Q.; Burnet, M.C.; Kyle, J.E.; Heyman, H.M.; Ramirez, J.; Prados-Rosales, R.; et al. Listeria Monocytogenes Virulence Factors, Including Listeriolysin O, Are Secreted in Biologically Active Extracellular Vesicles. J. Biol. Chem. 2019, 294, 1202–1217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Lan, Z.-W.; Xiao, M.-J.; Guan, Y.; Zhan, Y.-J.; Tang, X.-Q. Detection of Listeria Monocytogenes in a Patient with Meningoencephalitis Using Next-Generation Sequencing: A Case Report. BMC Infect. Dis. 2020, 20, 721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Adjei, P.C. Listeria Monocytogenes Meningoencephalitis and Cerebral Abscess in a Heart Transplant Recipient. Case Rep. Infect. Dis. 2020, 2020, 8496216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Correlation matrix of virulence factors (n = 10) and only the four antibiotics to which the strains showed resistance. Values indicating significant correlation (p < 0.05) are visualized. (Virulence factors: prfA, inlA, inlB, inlC, actA, plcB, hly, plcA; antibiotics: ERY—erythromycin, MEM—meropenem, STX-TMP—sulfamethoxazole/trimethoprim, CIP—ciprofloxacin, STR—streptomycin).
Figure 1. Correlation matrix of virulence factors (n = 10) and only the four antibiotics to which the strains showed resistance. Values indicating significant correlation (p < 0.05) are visualized. (Virulence factors: prfA, inlA, inlB, inlC, actA, plcB, hly, plcA; antibiotics: ERY—erythromycin, MEM—meropenem, STX-TMP—sulfamethoxazole/trimethoprim, CIP—ciprofloxacin, STR—streptomycin).
Foods 13 01656 g001
Figure 2. Clustering analysis relation of L. monocytogenes strains isolated in this study. The presence or absence of virulence factors and resistance or susceptibility of antimicrobials are shown in dichotomic values. Additionally, scales of MARIs, serotypes, and sample types are shown.
Figure 2. Clustering analysis relation of L. monocytogenes strains isolated in this study. The presence or absence of virulence factors and resistance or susceptibility of antimicrobials are shown in dichotomic values. Additionally, scales of MARIs, serotypes, and sample types are shown.
Foods 13 01656 g002
Table 1. Primers used in the study and their sequences.
Table 1. Primers used in the study and their sequences.
Primer’s NamePrimers Sequences (5’→3’)Product Size (pb)
lmo0737AGGGCTTCAAGGACTTACCC
ACGATTTCTGCTTGCCATTC
691
lmo1118AGGGGTCTTAAATCCTGGAA
CGGCTTGTTCGGCATACTTA
906
ORF2819AGCAAAATGCCAAAACTCGT
CATCACTAAAGCCTCCCATTG
471
ORF2110AGTGGACAATTGATTGGTGAA
CATCCATCCCTTACTTTGGAC
597
prsGCTGAAGAGATTGCGAAAGAAG
CAAAGAAACCTTGGATTTGCGG
370
Table 2. Interpretation of results of amplified genes for the identification of molecular serogroups.
Table 2. Interpretation of results of amplified genes for the identification of molecular serogroups.
GenebpSerogroups
1/2a3a1/2c3c4b4d4e1/2b3b
lmo1118906
lmo0737691
ORF2110597
ORF2819471
prs370
Table 3. Primers used for detection of virulence genes of L. monocytogenes.
Table 3. Primers used for detection of virulence genes of L. monocytogenes.
Prime’s NamePrimers Sequences (5’→3’)T/A (°C)
actACGCCGCGGAAATTAAAAAAAGA
ACGAAGGAACCGGGCTGCTAG
60
hlyGTTAATGAACCTACAAGACCTTCC
ACCGTTCTCCACCATTCCCA
60
llsXTTATTGCATCAATTGTTCTA
CCCCTATAAACATCATGCTAGTG
52
mplGCTTTGCCGGATTCCTGCG
CTTCTTATTCGCCCATCTCGCG
55
plcACTGCTTGAGCGTTCATGTCTCATCCCCC
CATGGGTTTCACTCTCCTTCTAC
60
plcBATGTGCTTGACCGCAAGTGT
CTTCTCGGTAATCAGCCACC
60
prfAAACGGGATAAAACCAAAACCA
TGCGATGCCACTTGAATATC
60
inlACGGATGCAGGAGAAAATCC
CTTTCACACTATCCTCTCC
60
inlBGATATTGTGCCACTTTCAGGT
CCTCTTTCAGTGGTTGGGT
60
inlCAATTCCCACAGGACACAACC
CGGGAATGCAATTTTTCACTA
55
Table 4. PCR serogroups for L. monocytogenes strains per sample type.
Table 4. PCR serogroups for L. monocytogenes strains per sample type.
Type of Sample % (n)
4b, 4d, 4e1/2b, 3b1/2a, 3a
Cheese
(n = 23)
100%
(23/23)
0.0%
(0/23)
0.0%
(0/23)
Chicken
(n = 4)
0.0%
(0/4)
25.0%
(1/4)
75.0%
(3/4)
Ground beef
(n = 11)
27.3%
(3/11)
18.2%
(2/11)
54.5%
(6/11)
Table 5. Prevalence of virulence factors in L. monocytogenes strains.
Table 5. Prevalence of virulence factors in L. monocytogenes strains.
Pathogenicity
Islands
Virulence
Factors
Serogroups
1/2a, 3a1/2b, 3b4b, 4d, 4e
LIPI-1actA88.8% (8/9)66.6% (2/3)96.1% (25/26)
hly88.8% (8/9)100.0% (3/3)92.3% (24/26)
mpl88.8% (8/9)0.0% (0/3)0.0% (0/26)
plcA0.0% (0/9)100.0% (3/3)61.5% (16/26)
plcB77.7% (7/9)100.0% (3/3)96.1% (25/26)
prfA88.8% (8/9)0.0% (0/3)0.0% (0/26)
LIPI-2inlA100.0 (9/9)100.0% (3/3)57.6% (15/26)
inlB77.7% (7/9)100.0% (3/3)53.8% (14/26)
inlC88.8% (8/9)0.0% (0/3)50.0% (13/26)
LIPI-3llsX0.0% (0/9)0.0% (0/3)100.0% (26/26)
Table 6. Antimicrobial susceptibility test results of L. monocytogenes strains.
Table 6. Antimicrobial susceptibility test results of L. monocytogenes strains.
AntimicrobialsLineage ILineage II
4b, 4d, 4e1/2b, 3b1/2a, 3a
SIRSIRSIR
Ampicillin100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Chloramphenicol100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Ciprofloxacin53.8%
(14/26)
46.1%
(12/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
66.6%
(6/9)
33.3%
(3/9)
0.0%
(0/9)
Erythromycin100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
88.8%
(8/9)
0.0
(0/9)
11.1%
(8/9)
Gentamicin100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Levofloxacin100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Meropenem69.7%
(20/26)
0.0%
(0/26)
30.7%
(8/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Penicillin100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Streptomycin69.7%
(20/26)
0.0%
(0/26)
30.7%
(8/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
77.7%
(7/9)
0.0%
(0/9)
22.2%
(2/9)
Sulfamethoxazole/trimethoprim11.5%
(3/26)
0.0%
(0/26)
88.4%
(3/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
22.2%
(2/9)
0.0%
(0/9)
77.7%
(7/9)
Tetracycline100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
Vancomycin100%
(26/26)
0.0%
(0/26)
0.0%
(0/26)
100%
(3/3)
0.0%
(0/3)
0.0%
(0/3)
100%
(9/9)
0.0%
(0/9)
0.0%
(0/9)
S = susceptible, I = intermediate, R = resistant.
Table 7. Multiple antibiotic resistance indexes (MARIs) of L. monocytogenes strains.
Table 7. Multiple antibiotic resistance indexes (MARIs) of L. monocytogenes strains.
MARIPatternnTotal%
0.083STX-TMP1616/3842.1
0.167STX-TMP + STR
STX-TMP + MEM
5
4
9/3823.6
0.250STX-TMP + STR + MEM
STX-TMP + STR + ERY
4
1
5/3813.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guel-García, P.; García De León, F.J.; Aguilera-Arreola, G.; Mandujano, A.; Mireles-Martínez, M.; Oliva-Hernández, A.; Cruz-Hernández, M.A.; Vasquez-Villanueva, J.; Rivera, G.; Bocanegra-García, V.; et al. Prevalence and Antimicrobial Resistance of Listeria monocytogenes in Different Raw Food from Reynosa, Tamaulipas, Mexico. Foods 2024, 13, 1656. https://doi.org/10.3390/foods13111656

AMA Style

Guel-García P, García De León FJ, Aguilera-Arreola G, Mandujano A, Mireles-Martínez M, Oliva-Hernández A, Cruz-Hernández MA, Vasquez-Villanueva J, Rivera G, Bocanegra-García V, et al. Prevalence and Antimicrobial Resistance of Listeria monocytogenes in Different Raw Food from Reynosa, Tamaulipas, Mexico. Foods. 2024; 13(11):1656. https://doi.org/10.3390/foods13111656

Chicago/Turabian Style

Guel-García, Paulina, Francisco Javier García De León, Guadalupe Aguilera-Arreola, Antonio Mandujano, Maribel Mireles-Martínez, Amanda Oliva-Hernández, María Antonia Cruz-Hernández, Jose Vasquez-Villanueva, Gildardo Rivera, Virgilio Bocanegra-García, and et al. 2024. "Prevalence and Antimicrobial Resistance of Listeria monocytogenes in Different Raw Food from Reynosa, Tamaulipas, Mexico" Foods 13, no. 11: 1656. https://doi.org/10.3390/foods13111656

APA Style

Guel-García, P., García De León, F. J., Aguilera-Arreola, G., Mandujano, A., Mireles-Martínez, M., Oliva-Hernández, A., Cruz-Hernández, M. A., Vasquez-Villanueva, J., Rivera, G., Bocanegra-García, V., & Martínez-Vázquez, A. V. (2024). Prevalence and Antimicrobial Resistance of Listeria monocytogenes in Different Raw Food from Reynosa, Tamaulipas, Mexico. Foods, 13(11), 1656. https://doi.org/10.3390/foods13111656

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop