Prevalence of Vibrio spp. in Seafood from German Supermarkets and Fish Markets
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation of Vibrio spp.
2.3. DNA Preparation
2.4. Multiplex PCR
3. Results
4. Discussion
4.1. Total Prevalence
4.2. Prevalence of V. parahaemolyticus
4.3. Prevalence of V. alginolyticus
4.4. Prevalence of V. cholerae and V. vulnificus
4.5. Differences Between Supermarkets and Seafood Markets
4.6. Methods Used and Their Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Huehn, S.; Eichhorn, C.; Urmersbach, S.; Breidenbach, J.; Bechlars, S.; Bier, N.; Alter, T.; Bartelt, E.; Frank, C.; Oberheitmann, B.; et al. Pathogenic vibrios in environmental, seafood and clinical sources in Germany. Int. J. Med. Microbiol. 2014, 304, 843–850. [Google Scholar] [CrossRef] [PubMed]
- Brehm, T.T.; Berneking, L.; Sena Martins, M.; Dupke, S.; Jacob, D.; Drechsel, O.; Bohnert, J.; Becker, K.; Kramer, A.; Christner, M.; et al. Heatwave-associated Vibrio infections in Germany, 2018 and 2019. Euro Surveill. 2021, 26, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Fleischmann, S.; Herrig, I.; Wesp, J.; Stiedl, J.; Reifferscheid, G.; Strauch, E.; Alter, T.; Brennholt, N. Prevalence and Distribution of Potentially Human Pathogenic Vibrio spp. on German North and Baltic Sea Coasts. Front. Cell. Infect. Microbiol. 2022, 12, 846819. [Google Scholar] [CrossRef]
- Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 8. [Google Scholar] [CrossRef]
- Baker-Austin, C.; Triñanes, J.; Taylor, N.; Hartnell, R.; Siitonen, A.; Martinez-Urtaza, J. Emerging Vibrio risk at high latitudes in response to ocean warming. Nat. Rep. Clim. Change 2012, 3, 73–77. [Google Scholar] [CrossRef]
- Froelich, B.A.; Daines, D.A. In hot water: Effects of climate change on Vibrio–human interactions. Environ. Microbiol. 2020, 22, 4101–4111. [Google Scholar] [CrossRef]
- EFSA Panel on Biological Hazards (BIOHAZ); Koutsoumanis, K.; Allende, A.; Alvarez-Ordonez, A.; Bolton, D.; Bover-Cid, S.; Chemaly, M.; De Cesare, A.; Herman, L.; Hilbert, F.; et al. Public health aspects of Vibrio spp. related to the consumption of seafood in the EU. EFSA J. 2024, 22, e8896. [Google Scholar] [CrossRef]
- Vu, T.T.T.; Alter, T.; Huehn, S. Prevalence of Vibrio spp. in Retail Seafood in Berlin, Germany. J. Food Prot. 2018, 81, 593–597. [Google Scholar] [CrossRef] [PubMed]
- Álvarez-Contreras, A.K.; Quiñones-Ramírez, E.I.; Vázquez-Salinas, C. Prevalence, detection of virulence genes and antimicrobial susceptibility of pathogen Vibrio species isolated from different types of seafood samples at “La Nueva Viga” market in Mexico City. Antonie Van Leeuwenhoek 2021, 114, 1417–1429. [Google Scholar] [CrossRef]
- Robert-Pillot, A.; Copin, S.; Himber, C.; Gay, M.; Quilici, M.L. Occurrence of the three major Vibrio species pathogenic for human in seafood products consumed in France using real-time PCR. Int. J. Food Microbiol. 2014, 189, 75–81. [Google Scholar] [CrossRef]
- Reilly, G.D.; Reilly, C.A.; Smith, E.G.; Baker-Austin, C. Vibrio alginolyticus-associated wound infection acquired in British waters, Guernsey, July 2011. Eurosurveillance 2011, 16, 19994. [Google Scholar] [CrossRef] [PubMed]
- Bundesinstitut für Risikobewertung. Bacterial foodborne Vibrio infections: Health risk assessment of the occurrence of Vibrio spp. (non-cholera vibrios) in food: BfR Opinion No 011/2022 of 13 April 2022. In BfR-Stellungnahmen; Bundesinst. für Risikobewertung: Berlin, Germany, 2022; Volume 2022. [Google Scholar]
- Abdalla, T.; Al-Rumaithi, H.; Osaili, T.M.; Hasan, F.; Obaid, R.S.; Abushelaibi, A.; Ayyash, M.M. Prevalence, Antibiotic-Resistance, and Growth Profile of Vibrio spp. Isolated from Fish and Shellfish in Subtropical-Arid Area. Front. Microbiol. 2022, 13, 861547. [Google Scholar] [CrossRef] [PubMed]
- Kriem, M.R.; Banni, B.; El Bouchtaoui, H.; Hamama, A.; El Marrakchi, A.; Chaouqy, N.; Robert-Pillot, A.; Quilici, M.L. Prevalence of Vibrio spp. in raw shrimps (Parapenaeus longirostris) and performance of a chromogenic medium for the isolation of Vibrio strains. Lett. Appl. Microbiol. 2015, 61, 224–230. [Google Scholar] [CrossRef]
- Risk Assessment of Vibrio Parahaemolyticus in Seafood; FAO: Rome, Italy; WHO: Geneva, Switzerland, 2011.
- Sadat, A.; El-Sherbiny, H.; Zakaria, A.; Ramadan, H.; Awad, A. Prevalence, antibiogram and virulence characterization of Vibrio isolates from fish and shellfish in Egypt: A possible zoonotic hazard to humans. J. Appl. Microbiol. 2021, 131, 485–498. [Google Scholar] [CrossRef]
- Li, Y.; Xie, T.; Pang, R.; Wu, Q.; Zhang, J.; Lei, T.; Xue, L.; Wu, H.; Wang, J.; Ding, Y.; et al. Food-Borne Vibrio parahaemolyticus in China: Prevalence, Antibiotic Susceptibility, and Genetic Characterization. Front. Microbiol. 2020, 11, 1670. [Google Scholar] [CrossRef]
- Lei, T.; Jiang, F.; He, M.; Zhang, J.; Zeng, H.; Chen, M.; Pang, R.; Wu, S.; Wei, L.; Wang, J.; et al. Prevalence, virulence, antimicrobial resistance, and molecular characterization of fluoroquinolone resistance of Vibrio parahaemolyticus from different types of food samples in China. Int. J. Food Microbiol. 2020, 317, 108461. [Google Scholar] [CrossRef]
- Guardiola-Avila, I.; Martínez-Vázquez, V.; Juárez-Rendón, K.; Alvarez-Ainza, M.; Paz-González, A.; Rivera, G. Prevalence and virulence of Vibrio species isolated from raw shrimp from retail markets in Reynosa, Mexico. Lett. Appl. Microbiol. 2020, 71, 280–286. [Google Scholar] [CrossRef]
- EN ISO 21872-1:2017; Microbiology of the food chain—Horizontal method for the determination of Vibrio spp.—Part 1: Detection of potentially enteropathogenic Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Beuth Verlag GmbH: Berlin, Germany, 2017.
- ISO/TS 21872-2:2020-10; Microbiology of the food chain—Horizontal method for the determination of Vibrio spp.—Part 2: Enumeration of total and potentially enteropathogenic Vibrio parahaemolyticus in seafood using nucleic acid hybridization. International Organization for Standardization: Geneva, Switzerland, 2020.
- Bauer, A.; Rørvik, L.M. A novel multiplex PCR for the identification of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Lett. Appl. Microbiol. 2007, 45, 371–375. [Google Scholar] [CrossRef] [PubMed]
- Di Pinto, A.; Ciccarese, G.; Tantillo, G.; Catalano, D.; Forte, V.T. A collagenase-targeted multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus. J. Food Prot. 2005, 68, 150–153. [Google Scholar] [CrossRef]
- Shirai, H.; Nishibuchi, M.; Ramamurthy, T.; Bhattacharya, S.K.; Pal, S.C.; Takeda, Y. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae. J. Clin. Microbiol. 1991, 29, 2517–2521. [Google Scholar] [CrossRef]
- Hossain, M.T.; Kim, Y.O.; Kong, I.S. Multiplex PCR for the detection and differentiation of Vibrio parahaemolyticus strains using the groEL, tdh and trh genes. Mol. Cell. Probes 2013, 27, 171–175. [Google Scholar] [CrossRef]
- Hirshfeld, B.; Lavelle, K.; Lee, K.Y.; Atwill, E.R.; Kiang, D.; Bolkenov, B.; Gaa, M.; Li, Z.; Yu, A.; Li, X.; et al. Prevalence and antimicrobial resistance profiles of Vibrio spp. and Enterococcus spp. in retail shrimp in Northern California. Front. Microbiol. 2023, 14, 1192769. [Google Scholar] [CrossRef]
- Nandi, B.; Nandy, R.K.; Mukhopadhyay, S.; Nair, G.B.; Shimada, T.; Ghose, A.C. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J. Clin. Microbiol. 2000, 38, 4145–4151. [Google Scholar] [CrossRef]
- Lorenzoni, G.; Tedde, G.; Mara, L.; Bazzoni, A.M.; Esposito, G.; Salza, S.; Piras, G.; Tedde, T.; Bazzardi, R.; Arras, I.; et al. Presence, Seasonal Distribution, and Biomolecular Characterization of Vibrio parahaemolyticus and Vibrio vulnificus in Shellfish Harvested and Marketed in Sardinia (Italy) between 2017 and 2018. J. Food Prot. 2021, 84, 1549–1554. [Google Scholar] [CrossRef]
- Koralage, M.S.; Alter, T.; Pichpol, D.; Strauch, E.; Zessin, K.H.; Huehn, S. Prevalence and molecular characteristics of Vibrio spp. isolated from preharvest shrimp of the North Western Province of Sri Lanka. J. Food Prot. 2012, 75, 1846–1850. [Google Scholar] [CrossRef]
- Sperling, L.; Alter, T.; Huehn, S. Prevalence and Antimicrobial Resistance of Vibrio spp. in Retail and Farm Shrimps in Ecuador. J. Food Prot. 2015, 78, 2089–2092. [Google Scholar] [CrossRef]
- Velez, K.E.C.; Leighton, R.E.; Decho, A.W.; Pinckney, J.L.; Norman, R.S. Modeling pH and Temperature Effects as Climatic Hazards in Vibrio vulnificus and Vibrio parahaemolyticus Planktonic Growth and Biofilm Formation. Geohealth 2023, 7, e2022GH000769. [Google Scholar] [CrossRef]
- Tan, C.W.; Rukayadi, Y.; Hasan, H.; Thung, T.Y.; Lee, E.; Rollon, W.D.; Hara, H.; Kayali, A.Y.; Nishibuchi, M.; Radu, S. Prevalence and antibiotic resistance patterns of Vibrio parahaemolyticus isolated from different types of seafood in Selangor, Malaysia. Saudi J. Biol. Sci. 2020, 27, 1602–1608. [Google Scholar] [CrossRef]
- Zarei, M.; Borujeni, M.P.; Jamnejad, A.; Khezrzadeh, M. Seasonal prevalence of Vibrio species in retail shrimps with an emphasis on Vibrio parahaemolyticus. Food Control 2012, 25, 107–109. [Google Scholar] [CrossRef]
- Xu, X.; Cheng, J.; Wu, Q.; Zhang, J.; Xie, T. Prevalence, characterization, and antibiotic susceptibility of Vibrio parahaemolyticus isolated from retail aquatic products in North China. BMC Microbiol. 2016, 16, 32. [Google Scholar] [CrossRef]
- Ye, L.; Zheng, Z.; Xu, Y.; Yang, C.; Heng, H.; Li, F.; Chan, E.W.C.; Chen, S. Prevalence and genetic basis of tetracycline resistance in Vibrio parahaemolyticus isolates recovered from food products in Shenzhen, China during 2013 to 2021. Sci. Total Environ. 2023, 902, 166026. [Google Scholar] [CrossRef]
- Xie, T.; Wu, Q.; Xu, X.; Zhang, J.; Guo, W. Prevalence and population analysis of Vibrio parahaemolyticus in aquatic products from South China markets. FEMS Microbiol. Lett. 2015, 362, fnv178. [Google Scholar] [CrossRef]
- Xie, T.; Yu, Q.; Tang, X.; Zhao, J.; He, X. Prevalence, antibiotic susceptibility and characterization of Vibrio parahaemolyticus isolates in China. FEMS Microbiol. Lett. 2020, 367, fnaa136. [Google Scholar] [CrossRef]
- Zhou, H.; Liu, X.; Hu, W.; Yang, J.; Jiang, H.; Sun, X.; Bie, X.; Lu, Z.; Xue, F.; Zeng, D.; et al. Prevalence, antimicrobial resistance and genetic characterization of Vibrio parahaemolyticus isolated from retail aquatic products in Nanjing, China. Food Res. Int. 2022, 162, 112026. [Google Scholar] [CrossRef]
- Sterk, A.; Schets, F.M.; de Roda Husman, A.M.; de Nijs, T.; Schijven, J.F. Effect of Climate Change on the Concentration and Associated Risks of Vibrio spp. in Dutch Recreational Waters. Risk Anal. 2015, 35, 1717–1729. [Google Scholar] [CrossRef]
- Bechlars, S.; Jäckel, C.; Diescher, S.; Wüstenhagen, D.A.; Kubick, S.; Dieckmann, R.; Strauch, E. Characterization of trh2 harbouring Vibrio parahaemolyticus strains isolated in Germany. PLoS ONE 2015, 10, e0118559. [Google Scholar] [CrossRef]
- Kang, C.-H.; Shin, Y.; Kim, W.; Kim, Y.; Song, K.; Oh, E.-G.; Kim, S.; Yu, H.; So, J.-S. Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus isolated from oysters in Korea. Environ. Sci. Pollut. Res. 2016, 23, 918–926. [Google Scholar] [CrossRef]
- Vongxay, K.; Wang, S.; Zhang, X.; Wu, B.; Hu, H.; Pan, Z.; Chen, S.; Fang, W. Pathogenetic characterization of Vibrio parahaemolyticus isolates from clinical and seafood sources. Int. J. Food Microbiol. 2008, 126, 71–75. [Google Scholar] [CrossRef]
- Tran, T.H.T.; Yanagawa, H.; Nguyen, K.T.; Hara-Kudo, Y.; Taniguchi, T.; Hayashidani, H. Prevalence of Vibrio parahaemolyticus in seafood and water environment in the Mekong Delta, Vietnam. J. Vet. Med. Sci. 2018, 80, 1737–1742. [Google Scholar] [CrossRef]
- Lhafi, S.K.; Kühne, M. Occurrence of Vibrio spp. in blue mussels (Mytilus edulis) from the German Wadden Sea. Int. J. Food Microbiol. 2007, 116, 297–300. [Google Scholar] [CrossRef]
- Coly, I.; Gassama Sow, A.; Seydi, M.; Martinez-Urtaza, J. Vibrio cholerae and Vibrio parahaemolyticus Detected in Seafood Products from Senegal. Foodborne Pathog. Dis. 2013, 10, 1050–1058. [Google Scholar] [CrossRef]
- Paydar, M.; Thong, K.L. Prevalence and genetic characterization of Vibrio vulnificus in raw seafood and seawater in Malaysia. J. Food Prot. 2013, 76, 1797–1800. [Google Scholar] [CrossRef]
- Bonny, S.Q.; Hossain, M.A.M.; Uddin, S.M.K.; Pulingam, T.; Sagadevan, S.; Johan, M.R. Current trends in polymerase chain reaction based detection of three major human pathogenic vibrios. Crit. Rev. Food Sci. Nutr. 2022, 62, 1317–1335. [Google Scholar] [CrossRef]
Target Gene | 5′-3′ Primer Sequence | Reference | Amplicon Size (bp) |
---|---|---|---|
V. parahaemolyticus UtoxF | GASTTTGTTTGGCGYGARCAAGGTT | [22] | 297 |
V. parahaemolyticus vptoxR | GGTTCAACGATTGCGTCAGAAG | ||
V. cholerae UtoxF | GASTTTGTTTGGCGYGARCAAGGTT | s.a. | 640 |
V. cholerae vctoxR | GGTTAGCAACGATGCGTAAG | ||
V. vulnificus UtoxF | GASTTTGTTTGGCGYGARCAAGGTT | s.a. | 435 |
V. vulnificus vvtoxR | AACGGAACTTAGACTCCGAC | ||
V. alginolyticus VA-F | CGAGTACAGTCACTTGAA AGCC | [23] | 737 |
V. alginolyticus VA-R | CACAACAGAACTCGCGTTACC | ||
V. cholerae ompW1-F | CACCAAGAAGGTGACTTTATTGTG | [26] | 588 |
V. cholerae ompW2-R | CTCAGACGGGATTTGTTAGGCACG | ||
V. cholerae ctxA1-F | CTCAGACGGGATTTGTTAGGCACG | [24] | 301 |
V. cholerae ctxA2-R | TCTATCTCTGTAGCCCCTATTACG | ||
V. parahaemolyticus GRO-1-F | AGGTCAGGCTAAGCGCGTAAGC | [25] | 510 |
V. parahaemolyticus GRO-2-R | GTCACCGTATTCACCCGTCGCT | ||
V. parahaemolyticus TDH-1-F | TATCCATGTTGGCTGCATTCAAAAC | s.a. | 171 |
V. parahaemolyticus TDH-2-R | TCTTCACCAACAAAGTTAGCTACA | ||
V. parahaemolyticus TRH-1-F | TTCAACGGTCTTCACAAAATCAGA | s.a. | 382 |
V. parahaemolyticus TRH-2-R | AAACATATGTCCATTTCCGCTCTC |
Vibrio Species a | Prevalence | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Prevalence of Samples in Total (%)/No. b (n = 170) | Prevalence in Shrimps (%)/No. b (n = 144) | Prevalence in Mussels (%)/No. b (n = 26) | Prevalence in Supermarkets (%)/No. b (n = 130) | Prevalence in Fish Markets (%)/No. b (n = 40) | ||||||
V. parahaemolyticus | 58 | (99) | 68 | (98) | 3.8 | (1) | 71 | (92) | 18 | (7) |
V. alginolyticus | 25 | (42) | 14 | (20) | 85 | (22) | 11 | (14) | 70 | (28) |
V. cholerae | 15 | (25) | 15 | (22) | 12 | (3) | 16 | (21) | 11 | (5) |
V. vulnificus | 2.2 | (4) | 2.6 | (4) | 0 | (0) | 2.5 | (3) | 1.3 | (1) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeidler, C.; Szott, V.; Alter, T.; Huehn-Lindenbein, S.; Fleischmann, S. Prevalence of Vibrio spp. in Seafood from German Supermarkets and Fish Markets. Foods 2024, 13, 3987. https://doi.org/10.3390/foods13243987
Zeidler C, Szott V, Alter T, Huehn-Lindenbein S, Fleischmann S. Prevalence of Vibrio spp. in Seafood from German Supermarkets and Fish Markets. Foods. 2024; 13(24):3987. https://doi.org/10.3390/foods13243987
Chicago/Turabian StyleZeidler, Christopher, Vanessa Szott, Thomas Alter, Stephan Huehn-Lindenbein, and Susanne Fleischmann. 2024. "Prevalence of Vibrio spp. in Seafood from German Supermarkets and Fish Markets" Foods 13, no. 24: 3987. https://doi.org/10.3390/foods13243987
APA StyleZeidler, C., Szott, V., Alter, T., Huehn-Lindenbein, S., & Fleischmann, S. (2024). Prevalence of Vibrio spp. in Seafood from German Supermarkets and Fish Markets. Foods, 13(24), 3987. https://doi.org/10.3390/foods13243987