Next Article in Journal
Bilberry and Sea Buckthorn Leaves and Their Subcritical Water Extracts Prevent Lipid Oxidation in Meat Products
Previous Article in Journal
Production of Milk Phospholipid-Enriched Dairy Ingredients
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 9
Issue 3
10.3390/foods9030264
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Three-Year Longitudinal Study: Prevalence of Salmonella Enterica in Chicken Meat is Higher in Supermarkets than Wet Markets from Mexico

by
Iván D. Regalado-Pineda
1,
Rene Rodarte-Medina
1,
Carolina N. Resendiz-Nava
1,
Cinthia E. Saenz-Garcia
1,
Pilar Castañeda-Serrano
2 and
Gerardo M. Nava
1,*
1
Departamento de Investigación y Posgrado en Alimentos. Universidad Autónoma de Querétaro, Querétaro, QRO 76010, Mexico
2
Centro de Enseñanza, Investigación y Extensión en Producción Avícola. Universidad Nacional Autónoma de Mexico, Tláhuac, CDMX 13300, Mexico
*
Author to whom correspondence should be addressed.
Foods 2020, 9(3), 264; https://doi.org/10.3390/foods9030264
Submission received: 11 January 2020 / Revised: 11 February 2020 / Accepted: 26 February 2020 / Published: 2 March 2020
(This article belongs to the Section Food Microbiology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Worldwide, chicken meat is considered one of the main sources of Salmonella enterica in humans. To protect consumers from this foodborne pathogen, international health authorities recommend the establishment of continuous Salmonella surveillance programs in meat. However, these programs are scarce in many world regions; thus, the goal of the present study was to perform a longitudinal surveillance of S. enterica in chicken meat in Mexico. A total of 1160 samples were collected and analyzed monthly from 2016 to 2018 in ten chicken meat retailers (supermarkets and wet markets) located in central Mexico. The isolation and identification of S. enterica was carried out using conventional and molecular methods. Overall, S. enterica was recovered from 18.1% (210/1160) of the chicken meat samples. Remarkably, during the three years of evaluation, S. enterica was more prevalent (p < 0.0001) in supermarkets (27.2%, 158/580) than in wet markets (9.0%, 52/580). The study was 3.8 times more likely (odds ratio = 3.8, p < 0.0001) to recover S. enterica from supermarkets than wet markets. Additionally, a higher prevalence (p < 0.05) of this pathogen was observed during the spring, summer, autumn, and winter in supermarkets compared with wet markets. Moreover, the recovery rate of S. enterica from supermarkets showed a gradual increase from 20.78% to 42% (p < 0.0001) from 2016 to 2018. Interestingly, no correlation (p > 0.05) was observed between the S. enterica recovery rate in chicken meat and reported cases of Salmonella infections in humans. Higher levels of S. enterica in chicken meat retailed in supermarkets are not unusual; this phenomenon has also been reported in some European and Asian countries. Together, these results uncover an important health threat that needs to be urgently addressed by poultry meat producers and retailers.

1. Introduction

Infections caused by Salmonella remain an important threat for human health. It has been estimated that, worldwide, this pathogen causes ~20 million human cases and ~140,000 deaths per year [1]. In Mexico, the National Epidemiological Surveillance System reports more than 110,000 Salmonella infections in humans every year [2]. Importantly, raw chicken meat is considered to be one of the main sources of Salmonella for humans [3,4,5], and it was estimated that ~30% of foodborne Salmonellosis worldwide could be linked to poultry meat [6].
In some countries, it is of particular interest to perform analysis of S. enterica in supermarkets and wet markets (places dedicated to sell fresh meat, fish, and produce, aka public markets) due to the significant differences in sanitary conditions between these two retail places [7,8,9,10,11]. Wet markets are an important source of affordable food; unfortunately, these places have been linked to major outbreaks of diseases due to poor hygiene conditions [12,13,14,15]. In fact, a higher prevalence of foodborne pathogens in wet markets compared to supermarkets has been documented in many countries [16,17,18,19]. Importantly, various studies have identified wet markets as an important source of S. enterica, where prevalence in chicken meat ranged between 20% and 75% [20,21,22,23]. In fact, some studies have reported higher levels of Salmonella contamination in poultry meat sold in wet markets compared to supermarkets [18,20,24,25]; however, a few studies have also reported opposite trends [26,27,28,29]. Unfortunately, these types of analyses are scarce in Mexico; thus, the aim of the present study was to analyze the prevalence of S. enterica in chicken meat retailers (wet markets and supermarkets) located in central Mexico.

2. Materials and Methods

2.1. Sample Collection and Microbiological Analysis

The analysis was carried out in chicken meat retailers, five wet markets, and five supermarkets, located in Central Mexico (Queretaro State, Lat Long = 20.588793, −100.389885). Every month for three years, from January 2016 to December 2018, a total of 1160 meat samples were collected from wet markets and supermarkets. These meat retailers distribute defeathered and eviscerated chicken carcasses obtained from commercial poultry processing plants. Samples were transported on ice to the laboratory for processing within 4 h. The number of samples per type of market are described with detail in Supplementary Table S1. Briefly, in 2016, a total of 680 samples were collected and analyzed. In 2017 and 2018, 240 samples per year were collected and analyzed.
The isolation of S. enterica was performed as described elsewhere [12]. Briefly, each sample consisted of 25 g of skin, obtained from one leg and one thigh, homogenized in 225 mL of buffered peptone water (BPW) and incubated at 37 °C for 24 h. For Salmonella enrichment, 0.1 and 1.0 mL aliquots of incubated-BPW were transferred to 10 mL of Rappaport-Vassiliadis and Tetrathionate plus iodine solution broth and incubated at 42 and 37 °C for 24 h, respectively. A loopful of the culture was streaked onto xylose lysine deoxycholate agar (XLD) supplemented with sodium novobiocin (0.001% w/v) and incubated at 37 °C for 24 h [30,31]. At least three presumptive Salmonella colonies were streaked on Trypticase Soy agar to obtain pure cultures and then subjected to a urease test. The identification of Salmonella isolates was performed using PCR assays.

2.2. Identification of S. enterica by PCR Assays

The DNA samples from presumptive Salmonella isolates were subjected to PCR amplification using two Salmonella-specific assays targeting invA (primer forward: CTGTTGAACAACCCATTTGT and reverse: CGGATCTCATTAATCAACAAT) [32] and 16S rRNA genes (primer forward: ACGGTAACAGGAAGMAG and reverse: TATTAACCACAACACCT) [33]. PCR invA amplification (~437 bp.) consisted of an initial denaturation step of 3 min at 94 °C and 35 cycles of 45 s at 94 °C, 30 s at 57.4 °C, and 30 s at 72 °C, followed by a final extension of 5 min at 72 °C. The protocol for 16S rRNA amplification (~402 bp.) was similar, except that 32 cycles of 20 s at 94 °C, 30 s at 53 °C, and 30 s at 72 °C were used. PCR products were analyzed on 1.5% agarose gels stained with ethidium bromide.

2.3. Temperature, Precipitation, Chicken Meat Production, and Human Cases Correlation Analysis

To uncover relationships between local weather conditions, amounts of chicken produced, and reported human Salmonellosis cases, official databases were consulted and data from 2016 to 2018 were retrieved, archived and analyzed. Monthly local temperatures were obtained from the National Meteorological Service (SMN, for its acronym in Spanish) [34]. Monthly chicken meat production was obtained from the National Service of Health, Food Safety (SENASICA, for its acronym in Spanish) [35], and monthly Salmonella human cases from the Weekly Epidemiological Bulletin—Secretary of Health (SSA, for its acronym in Spanish) [2].

2.4. Statistical Analysis

The results of S. enterica prevalence between years, seasons, and retailers were compared by the Chi-square test [19,36] using XLSTAT software. Confidence intervals (95%) for proportions were calculated using the Wilson procedure with a correction for continuity as described elsewhere [37]. Odds ratios (OR) and 95% confidence intervals were calculated using MedCalc Software. The Pearson correlation coefficient and ANOVA (Tukey post hoc test) using temperature, precipitation, chicken meat production and human Salmonellosis cases data were also performed with the XLSTAT software. Differences were considered significant at p < 0.05. Combined odds ratios (Synergy Factor) were estimated as described elsewhere [38].
To corroborate that sample number differences between years do not generate different outcomes, additional analyses were performed using a comparable number of samples (n = 240) per year. Briefly, a subset of samples (n = 20 per month) was selected from the whole 2016 sample collection using a random number generator (XLSTAT software). Statistical analyses were performed as described above.

3. Results and Discussion

Overall, S. enterica was recovered from 18.1% of the 1160 raw chicken meat samples analyzed. The prevalence of this pathogen increased (p < 0.001) over the three-year period evaluated, from 13.7% in 2016 to 27.1% in 2018 (Table 1). Comparable levels of S. enterica contamination (21.3%) in chicken meat retailers have been observed in cross-sectional studies performed in the North, Central, and South regions of Mexico [39,40]. Additionally, this S. enterica prevalence in chicken meat has been observed in other world regions such as Australia, Belgium, Brazil, Canada, China, Colombia, Ecuador, Portugal, Spain, USA, Venezuela, and Wales, where contamination levels ranged between 9.5% and 65.0%, [19,26,27,41,42,43,44]. These results indicate that chicken meat retailed in markets could represent an important risk factor for Salmonella infections in humans.
The longitudinal design allowed us to perform a robust statistical assessment [45] of Salmonella contamination levels over different seasons. A few studies, from different world regions, have examined the presence of this pathogen in chicken meat retailers over one year period or longer, and some of them have reported discordant results regarding seasonal trends [8,23,27,29,44]; therefore, it is fundamental to perform multi-year analyses to corroborate temporal patterns of S. enterica contamination in chicken meat. After three years of microbiological examination, Salmonella isolation rates ranged from 8.7% to 30.0% per month and 15.1% to 20.9% per season. Nevertheless, statistical assessment revealed no significant (p > 0.05; odds ratio >1.5, 95% CI: 1.0–2.3) differences in the prevalence of S. enterica between months or seasons (Table 1). Interestingly, analysis of a single-year showed a higher (p < 0.01) isolation rate (20.3%) in winter 2016 compared with the rest of the seasons; however, this tendency was not observed in 2017 (15.0%) and 2018 (28.3%) (Table 2), suggesting that seasonal trends may depend on other factors rather than seasonal conditions solely. To corroborate this idea, local seasonal conditions and poultry meat production were analyzed. No statistical relationships (p > 0.05) between temperature, precipitation, chicken meat production, and Salmonella prevalence in chicken meat were observed (data not shown). Moreover, another multi-year study revealed that seasonal differences in S. enterica prevalence are year-dependent [46]. Overall, these results support the lack of seasonal trends in S. enterica meat contamination and could help to explain the discordant seasonal trends reported in the literature [8,28,29,36,44]. Moreover, these results highlight the importance of performing a multi-year analysis for S. enterica seasonality assessment.
Remarkably, the present multi-year study also revealed repeatable higher S. enterica contamination levels in chicken meat retailed at supermarkets than in wet markets. Overall, the recovery rate of S. enterica was higher (p < 0.0001) in supermarkets (27.2%, 158 / 580) compared to wet markets (9.0%, 52/580) (Figure 1A). The study showed that it was 3.8 times more likely (odds ratio = 3.8, p < 0.0001) to recover S. enterica from supermarkets than wet markets (Table 3). In the majority (9/12) of the months analyzed, it was 3.7 to 29.4 times more likely (p < 0.019) to recover S. enterica from supermarkets than wet markets (Table 3). Additionally, in every year analyzed, from 2016 to 2018, the prevalence of this pathogen was higher (p < 0.001) in supermarkets (20.8%, 30.8%, and 41.7%, respectively) than wet markets (6.4%, 12.5%, and 12.5%, respectively) (Figure 1B); it was, at least, 3.1 times more likely (p < 0.019) to recover S. enterica from supermarkets than wet markets in the analyzed period (Table 3). Moreover, higher (p < 0.05) Salmonella contamination levels were observed in spring, summer, autumn, and winter in supermarkets (ranging from 23.1% to 36.6%) compared with wet markets (ranging from 7.1% to 13.5%) (Figure 1C); the analysis showed that it was between 1.9 and 10.5 times more likely (p < 0.05) to recover S. enterica from supermarkets than wet markets during each of the four seasons evaluated (Table 3). Interestingly, analysis of combined factors revealed a higher risk (combined odds ratio = 2.8, 95% CI: 4.5–24.2, p = 0.028) of Salmonella contamination when chicken meat was acquired in supermarkets during winter season compared to meat from wet markets (Table 4). Finally, to corroborate that results obtained in the present study were not influenced by differences in sample number per year (2016, 2017, and 2018), all statistical assessments were repeated using a similar number of samples (n = 240) per year. No significant differences between the two analyses were observed (Supplementary Tables and Figures). After three years of microbiological examination, it was observed that the prevalence of S. enterica in chicken meat retailed at supermarkets increased (p < 0.0001) 20.9% from 2016 to 2018. Importantly, our research group detected comparable contamination trends in markets from five other Mexican states, in which Salmonella recovery rates were higher (p = 0.009) in supermarkets (9.9%, 17/171) and wet markets (3.6%, 9/247) (unpublished results). Together, these results indicate that higher levels of Salmonella contamination in supermarkets were not a year-dependent phenomenon.
Higher rates of Salmonella contamination in chicken meat retailed in supermarkets is a surprising result because superior sanitary and quality standards are expected at these types of stores [7,8]. However, numerous reports from European and Asian countries have showed higher or comparable Salmonella contamination levels in meat samples from supermarkets when compared with wet markets samples [8,23,26,27,28,29,44]. For example, studies performed in Spain and Russia showed a higher (p > 0.05) Salmonella recovery rate (75.0% and 60%, respectively) in supermarkets than wet markets (25.0% and 7.7%, respectively) [26,47]. Additionally, studies from other world regions have reported no difference (p > 0.05) in Salmonella contamination levels in meat between these two types of retail markets [23,27,28,29]. The high frequency of Salmonella in chicken meat from supermarkets could be explained, in part, by the extended shelf life (~6 days) in these types of stores [48], compared with the few hours (>16 h) in which the product is traded in wet markets [26]. Nonetheless, further studies are required to identify the cause of this phenomenon. Taken together, these results uncover an important health threat that needs to be urgently addressed by poultry meat producers and retailers.
To gain insights into the contribution of chicken meat contaminated with Salmonella to human Salmonellosis in Mexico, we performed regression analysis using monthly prevalence results (present study), and the monthly number of human Salmonellosis cases reported from 2016 to 2018 by the Weekly Epidemiological Bulletin – SSA. According to this epidemiological report, the monthly prevalence rate of human Salmonellosis was higher (p > 0.05) in 2016 (average = 1.6 cases per 100,000 people), followed by 2017 (1.1 cases per 100,000 people), and 2018 (0.6 cases per 100,000 people). Interestingly, no statistical relationships (p > 0.05, R2 < 0.13) were observed between overall Salmonella prevalence in chicken meat and human Salmonellosis cases reported between 2016 and 2018 (Figure 2A). Likewise, no relationships (p > 0.05, R2 < 0.33) were observed between Salmonella prevalence in chicken meat retailed at supermarkets or wet markets and human Salmonellosis cases reported during the evaluated period (Figure 2B,C). Other reports have documented this lack of association between Salmonella contamination in chicken meat and human cases [41,46]; however, we believe that there is not enough evidence to rule out chicken meat as an important source of Salmonella for humans in Mexico [4]. Salmonella foodborne transmission is a complex biological trait and Salmonella meat prevalence data may not be enough to establish epidemiological links [4]. Thus, further and comprehensive studies, such as virulence or genomic profiling, are required to elucidate the contribution of chicken meat to the Salmonellosis cases in humans.

4. Conclusions

The overall prevalence of S. enterica was 18% in chicken meat retailed in markets from central Mexico. Interestingly, Salmonella contamination levels were consistently higher in supermarkets than in wet markets. Additionally, it was revealed that the prevalence of this pathogen in chicken meat has increased in the last three years in this Mexican region. Together, these results uncover an important health threat that needs to be urgently addressed by poultry meat producers and retailers. We hope that these data serve as a framework for the poultry industry, policy makers, and health authorities to establish effective Salmonella control programs.

Supplementary Materials

The following are available online at https://www.mdpi.com/2304-8158/9/3/264/s1, Figure S1: Influence by market type (A), over time (B) and season effect (C) on Salmonella prevalence in chicken meat. Figure S2: Correlation between Salmonella prevalence in retail chicken meat and human salmonellosis cases. Table S1: Salmonella Prevalence over time. Table S2: Seasonal effect on Salmonella prevalence per year. Table S3: Odds ratio analysis of the Salmonella prevalence over time.

Author Contributions

I.D.R.-P., P.C.-S. and G.M.N. conceptualized the study, I.D.R.-P., R.R.-M., C.N.R.-N., C.E.S.-G., and G.M.N. preformed experiments and analyzed the data, I.D.R.-P., R.R.-M., C.N.R.-N., C.E.S.-G., P.C.-S., and G.M.N. interpreted results, wrote and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by grant FOFIUAQ-2018 number FAC2018XX from the Universidad Autonoma de Queretaro.

Acknowledgments

We would like to thank all members of the Molecular Microbiology Laboratory, UAQ-FQ for their technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kirk, M.D.; Pires, S.M.; Black, R.E.; Caipo, M.; Crump, J.A.; Devleesschauwer, B.; Döpfer, D.; Fazil, A.; Fischer-Walker, C.L.; Hald, T.; et al. World Health Organization Estimates of the Global and Regional Disease Burden of 22 Foodborne Bacterial, Protozoal, and Viral Diseases, 2010: A Data Synthesis. PLoS Med. 2015, 12, e1001921. [Google Scholar]
  2. NESS. National Epidemiological Surveillance System. 2017. Available online: https://www.gob.mx/salud/acciones-y-programas/direccion-general-de-epidemiologia-boletin-epidemiologico (accessed on 26 August 2019).
  3. Antunes, P.; Mourão, J.; Campos, J.; Peixe, L. Salmonellosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 110–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Cox, N.A.; Cason, J.A.; Richardson, L.J. Minimization of Salmonella contamination on raw poultry. Annu. Rev. Food Sci. Technol. 2011, 2, 75–95. [Google Scholar] [CrossRef] [PubMed]
  5. Shah, D.H.; Paul, N.C.; Sischo, W.C.; Crespo, R.; Guard, J. Population dynamics and antimicrobial resistance of the most prevalent poultry-associated Salmonella serotypes. Poult. Sci. 2017, 96, 687–702. [Google Scholar] [CrossRef] [PubMed]
  6. Hoffmann, S.; Devleesschauwer, B.; Aspinall, W.; Cooke, R.; Corrigan, T.; Havelaar, A.; Angulo, F.; Gibb, H.; Kirk, M.; Lake, R.; et al. Attribution of global foodborne disease to specific foods: Findings from a World Health Organization structured expert elicitation. PLoS ONE 2017, 12, e0183641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Villalpando-Guzmán, S.; Vázquez-Quiñones, C.R.; Natividad-Bonifacio, I.; Curiel-Quesada, E.; Quiñones-Ramírez, E.I.; Vázquez-Salinas, C. Frequency, antimicrobial susceptibility and adherence patterns of Salmonella enterica isolated from chicken meat, beef and pork from Mexico City. Rev. Chil. Infectol. 2017, 34, 458–466. [Google Scholar] [CrossRef] [Green Version]
  8. Zhu, J.; Wang, Y.; Song, X.; Cui, S.; Xu, H.; Yang, B.; Huang, J.; Liu, G.; Chen, Q.; Zhou, G.; et al. Prevalence and quantification of Salmonella contamination in raw chicken carcasses at the retail in China. Food Control 2014, 44, 198–202. [Google Scholar] [CrossRef]
  9. Mele, C.; Ng, M.; Chim, M.B. Urban markets as a ‘corrective’ to advanced urbanism: The social space of wet markets in contemporary Singapore. Urban Stud. 2014, 52, 103–120. [Google Scholar] [CrossRef]
  10. Lazaro, J.; Kapute, F.; Holm, R.H. Food safety policies and practices in public spaces: The urban water, sanitation, and hygiene environment for fresh fish sold from individual vendors in Mzuzu, Malawi. Food Sci. Nutr. 2019, 7, 2986–2994. [Google Scholar] [CrossRef] [Green Version]
  11. Lo, M.Y.; Ngan, W.Y.; Tsun, S.M.; Hsing, H.-L.; Lau, K.T.; Hung, H.P.; Chan, S.L.; Lai, Y.Y.; Yao, Y.; Pu, Y.; et al. A Field Study into Hong Kong’s Wet Markets: Raised Questions into the Hygienic Maintenance of Meat Contact Surfaces and the Dissemination of Microorganisms Associated With Nosocomial Infections. Front. Microbiol. 2019, 10, 2618. [Google Scholar] [CrossRef]
  12. Nidaullah, H.; Abirami, N.; Shamila-Syuhada, A.K.; Chuah, L.-O.; Nurul, H.; Tan, T.P.; Abidin, F.W.Z.; Rusul, G. Prevalence of Salmonella in poultry processing environments in wet markets in Penang and Perlis, Malaysia. Vet. World 2017, 10, 286–292. [Google Scholar] [CrossRef] [Green Version]
  13. Wu, T.; Perrings, C.; Kinzig, A.; Collins, J.P.; Minteer, B.A.; Daszak, P. Economic growth, urbanization, globalization, and the risks of emerging infectious diseases in China: A review. Ambio 2017, 46, 18–29. [Google Scholar] [CrossRef]
  14. Chomel, B.B.; Belotto, A.; Meslin, F.-X. Wildlife, Exotic Pets, and Emerging Zoonoses. Emerg. Infect. Dis. 2007, 13, 6–11. [Google Scholar] [CrossRef]
  15. Lynteris, C. The Prophetic Faculty of Epidemic Photography: Chinese Wet Markets and the Imagination of the Next Pandemic. Vis. Anthropol. 2016, 29, 118–132. [Google Scholar] [CrossRef]
  16. Fang, J.; Shen, Y.; Qu, D.; Han, J. Antimicrobial resistance profiles and characteristics of integrons in Escherichia coli strains isolated from a large-scale centralized swine slaughterhouse and its downstream markets in Zhejiang, China. Food Control 2019, 95, 215–222. [Google Scholar] [CrossRef]
  17. Odwar, J.A.; Kikuvi, G.; Kariuki, J.N.; Kariuki, S. A cross-sectional study on the microbiological quality and safety of raw chicken meats sold in Nairobi, Kenya. BMC Res. Notes 2014, 7, 627. [Google Scholar] [CrossRef] [Green Version]
  18. Scheinberg, J.; Doores, S.; Cutter, C.N. A Microbiological Comparison of Poultry Products Obtained from Farmers’ Markets and Supermarkets in Pennsylvania. J. Food Saf. 2013, 33, 259–264. [Google Scholar] [CrossRef]
  19. Ghafir, Y.; China, B.; Korsak, N.; Dierick, K.; Collard, J.-M.; Godard, C.; De Zutter, L.; Daube, G. Belgian Surveillance Plans To Assess Changes in Salmonella Prevalence in Meat at Different Production Stages. J. Food Prot. 2005, 68, 2269–2277. [Google Scholar] [CrossRef] [Green Version]
  20. Khan, A.S.; Georges, K.; Rahaman, S.; Abdela, W.; Adesiyun, A.A. Prevalence and serotypes of Salmonella spp. on chickens sold at retail outlets in Trinidad. PLoS ONE 2018, 13, e0202108. [Google Scholar]
  21. Saiyudthong, S.; Trevanich, S. An Optimized EMA-RAPD-PCR for a Reliable Detection of Viable Salmonella spp. in Chicken Products. J. Food Saf. 2013, 33, 247–258. [Google Scholar]
  22. Donado-Godoy, P.; Clavijo, V.; León, M.; Tafur, M.A.; Gonzales, S.; Hume, M.; Alali, W.; Walls, I.; Lo Fo Wong, D.M.A.; Doyle, M.P. Prevalence of Salmonella on Retail Broiler Chicken Meat Carcasses in Colombia. J. Food Prot. 2012, 75, 1134–1138. [Google Scholar] [CrossRef] [Green Version]
  23. abu bakar, S.; Son, R.; Mahyudin, N.A.; Rukayadi, Y.; Tuan Chilek, T.Z. Prevalence of Salmonella spp. in chicken and beef from retail outlets in Malaysia. Int. Food Res. J. 2017, 24, 437–449. [Google Scholar]
  24. Donado-Godoy, P.; Clavijo, V.; León, M.; Arevalo, A.; Castellanos, R.; Bernal, J.; Tafur, M.A.; Ovalle, M.V.; Alali, W.Q.; Hume, M.; et al. Counts, Serovars, and Antimicrobial Resistance Phenotypes of Salmonella on Raw Chicken Meat at Retail in Colombia. J. Food Prot. 2014, 77, 227–235. [Google Scholar] [CrossRef]
  25. Ta, Y.T.; Nguyen, T.T.; To, P.B.; Pham, D.X.; Le, H.T.H.; Alali, W.Q.; Walls, I.; Lo Fo Wong, D.M.A.; Doyle, M.P. Prevalence of Salmonella on Chicken Carcasses from Retail Markets in Vietnam. J. Food Prot. 2012, 75, 1851–1854. [Google Scholar] [CrossRef]
  26. Capita, R.; Alvarez-Astorga, M.; Alonso-Calleja, C.; Moreno, B.; del Camino García-Fernández, M. Occurrence of Salmonellae in retail chicken carcasses and their products in Spain. Int. J. Food Microbiol. 2003, 81, 169–173. [Google Scholar] [CrossRef]
  27. Harrison, W.A.; Griffith, C.J.; Tennant, D.; Peters, A.C. Incidence of Campylobacter and Salmonella isolated from retail chicken and associated packaging in South Wales. Lett. Appl. Microbiol. 2001, 33, 450–454. [Google Scholar] [CrossRef] [Green Version]
  28. Huang, J.; Zong, Q.; Zhao, F.; Zhu, J.; Jiao, X. Quantitative surveys of Salmonella and Campylobacter on retail raw chicken in Yangzhou, China. Food Control 2016, 59, 68–73. [Google Scholar] [CrossRef]
  29. Minami, A.; Chaicumpa, W.; Chongsa-Nguan, M.; Samosornsuk, S.; Monden, S.; Takeshi, K.; Makino, S.; Kawamoto, K. Prevalence of foodborne pathogens in open markets and supermarkets in Thailand. Food Control 2010, 21, 221–226. [Google Scholar] [CrossRef]
  30. Cason, J.A.; Cox, N.A.; Buhr, R.J.; Richardson, L.J. Comparison of the statistics of Salmonella testing of chilled broiler chicken carcasses by whole-carcass rinse and neck skin excision. Poult. Sci. 2010, 89, 2038–2040. [Google Scholar] [CrossRef] [Green Version]
  31. Choi, D.; Chon, J.-W.; Kim, H.-S.; Kim, D.-H.; Lim, J.-S.; Yim, J.-H.; Seo, K.-H. Incidence, Antimicrobial Resistance, and Molecular Characteristics of Nontyphoidal Salmonella Including Extended-Spectrum β-Lactamase Producers in Retail Chicken Meat. J. Food Prot. 2015, 78, 1932–1937. [Google Scholar] [CrossRef]
  32. Liu, T.; Liljebjelke, K.; Bartlett, E.; Hofacre, C.; Sanchez, S.; Maurer, J.J. Application of nested polymerase chain reaction to detection of Salmonella in poultry environment. J. Food Prot. 2002, 65, 1227–1232. [Google Scholar] [CrossRef] [PubMed]
  33. Søborg, D.A.; Hendriksen, N.B.; Kilian, M.; Kroer, N. Widespread Occurrence of Bacterial Human Virulence Determinants in Soil and Freshwater Environments. Appl. Environ. Microbiol. 2013, 79, 5488–5497. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Resúmenes Mensuales de Temperaturas y Lluvia. Available online: https://smn.conagua.gob.mx/es/climatologia/temperaturas-y-lluvias/resumenes-mensuales-de-temperaturas-y-lluvias (accessed on 7 January 2020).
  35. Servicio de Información Agroalimentaria y Pesquera. Boletín Mensual de Avance de la Producción de Carne en Canal de Ave. Available online: http://www.gob.mx/siap/documentos/boletin-mensual-de-avances-de-la-produccion-de-carne-de-ave (accessed on 7 January 2020).
  36. Ni, P.; Xu, Q.; Yin, Y.; Liu, D.; Zhang, J.; Wu, Q.; Tian, P.; Shi, X.; Wang, D. Prevalence and characterization of Salmonella serovars isolated from farm products in Shanghai. Food Control 2018, 85, 269–275. [Google Scholar] [CrossRef]
  37. Wang, L.Y.R.; Jokinen, C.C.; Laing, C.R.; Johnson, R.P.; Ziebell, K.; Gannon, V.P.J. Multi-Year Persistence of Verotoxigenic Escherichia coli (VTEC) in a Closed Canadian Beef Herd: A Cohort Study. Front. Microbiol. 2018, 9, 2040. [Google Scholar] [CrossRef]
  38. Cortina-Borja, M.; Smith, A.D.; Combarros, O.; Lehmann, D.J. The synergy factor: A statistic to measure interactions in complex diseases. BMC Res. Notes 2009, 2, 105. [Google Scholar] [CrossRef] [Green Version]
  39. Miranda, J.M.; Mondragón, A.C.; Martinez, B.; Guarddon, M.; Rodriguez, J.A. Prevalence and antimicrobial resistance patterns of Salmonella from different raw foods in Mexico. J. Food Prot. 2009, 72, 966–971. [Google Scholar] [CrossRef]
  40. Zaidi, M.B.; Calva, J.J.; Estrada-Garcia, M.T.; Leon, V.; Vazquez, G.; Figueroa, G.; Lopez, E.; Contreras, J.; Abbott, J.; Zhao, S.; et al. Integrated food chain surveillance system for Salmonella spp. in Mexico. Emerg. Infect. Dis. 2008, 14, 429–435. [Google Scholar] [CrossRef] [Green Version]
  41. Fearnley, E.; Raupach, J.; Lagala, F.; Cameron, S. Salmonella in chicken meat, eggs and humans; Adelaide, South Australia, 2008. Int. J. Food Microbiol. 2011, 146, 219–227. [Google Scholar] [CrossRef]
  42. Giombelli, A.; Gloria, M.B.A. Prevalence of Salmonella and Campylobacter on broiler chickens from farm to slaughter and efficiency of methods to remove visible fecal contamination. J. Food Prot. 2014, 77, 1851–1859. [Google Scholar] [CrossRef]
  43. Vinueza-Burgos, C.; Cevallos, M.; Ron-Garrido, L.; Bertrand, S.; De Zutter, L. Prevalence and Diversity of Salmonella Serotypes in Ecuadorian Broilers at Slaughter Age. PLoS ONE 2016, 11, e0159567. [Google Scholar] [CrossRef]
  44. Wang, Y.; Chen, Q.; Cui, S.; Xu, X.; Zhu, J.; Luo, H.; Wang, D.; Li, F. Enumeration and characterization of Salmonella isolates from retail chicken carcasses in Beijing, China. Foodborne Pathog. Dis. 2014, 11, 126–132. [Google Scholar] [CrossRef] [PubMed]
  45. Caruana, E.J.; Roman, M.; Hernández-Sánchez, J.; Solli, P. Longitudinal studies. J. Thorac. Dis. 2015, 7, E537–E540. [Google Scholar] [PubMed]
  46. Sivaramalingam, T.; McEwen, S.A.; Pearl, D.L.; Ojkic, D.; Guerin, M.T. A temporal study of Salmonella serovars from environmental samples from poultry breeder flocks in Ontario between 1998 and 2008. Can. J. Vet. Res. 2013, 77, 1–11. [Google Scholar] [PubMed]
  47. Alali, W.Q.; Gaydashov, R.; Petrova, E.; Panin, A.; Tugarinov, O.; Kulikovskii, A.; Mamleeva, D.; Walls, I.; Doyle, M.P. Prevalence of Salmonella on retail chicken meat in Russian Federation. J. Food Prot. 2012, 75, 1469–1473. [Google Scholar] [CrossRef] [PubMed]
  48. Kozačinski, L.; Cvrtila Fleck, Ž.; Kozačinski, Z.; Filipović, I.; Mitak, M.; Bratulić, M.; Mikuš, T. Evaluation of shelf life of pre-packed cut poultry meat. Vet. Arh. 2012, 82, 47–58. [Google Scholar]
Foods 09 00264 g001 550
Figure 1. Salmonella prevalence in chicken meat influence by market type (A), year (B) and season (C). Asterisks indicate statistical differences (Chi-square test; p < 0.05) between supermarkets and wet-markets.
Figure 1. Salmonella prevalence in chicken meat influence by market type (A), year (B) and season (C). Asterisks indicate statistical differences (Chi-square test; p < 0.05) between supermarkets and wet-markets.
Foods 09 00264 g001
Foods 09 00264 g002 550
Figure 2. Correlation between Salmonella prevalence in chicken meat retailers and human salmonellosis cases. Analyses were performed using overall (A), supermarkets (B), wet-markets (C) Salmonella prevalence in chicken meat versus number of Salmonellosis cases.
Figure 2. Correlation between Salmonella prevalence in chicken meat retailers and human salmonellosis cases. Analyses were performed using overall (A), supermarkets (B), wet-markets (C) Salmonella prevalence in chicken meat versus number of Salmonellosis cases.
Foods 09 00264 g002
Table
Table 1. Salmonella prevalence over time.
Table 1. Salmonella prevalence over time.
No. of SamplesPrevalence (%)95% CI
Overall
2016–2018116018.115.9–20.5
Annual
201668013.711.2–16.6
201724021.716.7–27.5
201824027.121.7–33.3
Seasonal
Spring31215.111.4–19.6
Summer31217.914.0–22.8
Autumn26819.014.6–24.4
Winter26820.916.3–26.4
Monthly
January10420.213.2–29.4
February10419.212.4–28.4
March1048.74.3–16.2
April10422.114.8–31.5
May10414.48.6–23.0
June10417.310.9–26.3
July10421.214.0–30.5
August10415.49.3–24.1
September10412.57.1–20.8
October10419.212.4–28.4
November6030.019.2–43.4
December6025.015.1–38.1
Table
Table 2. Seasonal effect on Salmonella prevalence per year.
Table 2. Seasonal effect on Salmonella prevalence per year.
Season201620172018
Spring24/192 (12.5) b10/60 (16.7) a13/60 (21.7) a
Summer25/192 (13.0) b15/60 (25.0) a16/60 (26.7) a
Autumn14/148 (9.4) b18/60 (30.0) a19/60 (31.7) a
Winter30/148 (20.3) a9/60 (15.0) a17/60 (28.3) a
Columns with different letter are statistically different (Chi-square test; p < 0.05).
Table
Table 3. Odds ratio analysis of the Salmonella prevalence in supermarkets over time.
Table 3. Odds ratio analysis of the Salmonella prevalence in supermarkets over time.
Odds Ratio *95 % Confidence Intervalp Value
Overall
2016–20183.82.7–5.3p < 0.0001
Months
January4.21.4–12.5p = 0.0104
February29.43.8–229.9p = 0.0013
March3.90.8–19.7p = 0.1008
April3.71.3–10.4p = 0.0123
May4.91.3–18.6p = 0.0194
June11.12.4–51.4p = 0.0021
July1.60.6–4.1p = 0.3390
August0.50.2–1.6p = 0.2815
September0.80.3–2.7p = 0.7670
October7.92.2–29.2p = 0.0018
November9.02.2–36.2p = 0.0020
December25.43.1–211.1p = 0.0028
Season
Spring4.01.9–8.1p = 0.0002
Summer1.91.0–3.4p = 0.0407
Autumn3.71.9–7.3p = 0.0002
Winter10.54.5–24.2p < 0.0001
Year
20163.82.3–6.3p < 0.0001
20173.11.6–6.1p = 0.0008
20185.02.6–9.6p < 0.0001
* Reference: Wet market (odds ratio = 1).
Table
Table 4. Combined odds ratio analysis of Salmonella prevalence.
Table 4. Combined odds ratio analysis of Salmonella prevalence.
Combined Odds Ratio a,*95 % Confidence Intervalp Value
Supermarket*Spring1.00.47–2.29p = 0.922
Supermarket*Summer0.50.25–0.97p = 0.040
Supermarket*Autumn1.00.45–2.08p = 0.940
Supermarket*Winter2.84.5–24.2p = 0.028
Year
Supermarket*20161.00.55–1.83p = 0.990
Supermarket*20170.80.38–1.73p = 0.604
Supermarket*20181.30.63–2.74p = 0.464
a Combined odds ratio (Synergy factor) estimated as described by [38]. * Reference: Wet-market (odds ratio = 1).

Share and Cite

MDPI and ACS Style

Regalado-Pineda, I.D.; Rodarte-Medina, R.; Resendiz-Nava, C.N.; Saenz-Garcia, C.E.; Castañeda-Serrano, P.; Nava, G.M. Three-Year Longitudinal Study: Prevalence of Salmonella Enterica in Chicken Meat is Higher in Supermarkets than Wet Markets from Mexico. Foods 2020, 9, 264. https://doi.org/10.3390/foods9030264

AMA Style

Regalado-Pineda ID, Rodarte-Medina R, Resendiz-Nava CN, Saenz-Garcia CE, Castañeda-Serrano P, Nava GM. Three-Year Longitudinal Study: Prevalence of Salmonella Enterica in Chicken Meat is Higher in Supermarkets than Wet Markets from Mexico. Foods. 2020; 9(3):264. https://doi.org/10.3390/foods9030264

Chicago/Turabian Style

Regalado-Pineda, Iván D., Rene Rodarte-Medina, Carolina N. Resendiz-Nava, Cinthia E. Saenz-Garcia, Pilar Castañeda-Serrano, and Gerardo M. Nava. 2020. "Three-Year Longitudinal Study: Prevalence of Salmonella Enterica in Chicken Meat is Higher in Supermarkets than Wet Markets from Mexico" Foods 9, no. 3: 264. https://doi.org/10.3390/foods9030264

APA Style

Regalado-Pineda, I. D., Rodarte-Medina, R., Resendiz-Nava, C. N., Saenz-Garcia, C. E., Castañeda-Serrano, P., & Nava, G. M. (2020). Three-Year Longitudinal Study: Prevalence of Salmonella Enterica in Chicken Meat is Higher in Supermarkets than Wet Markets from Mexico. Foods, 9(3), 264. https://doi.org/10.3390/foods9030264

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop