Integrative Transcriptomics and Proteomics Analysis Reveals Immune Response Process in Bovine Viral Diarrhea Virus-1-Infected Peripheral Blood Mononuclear Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval
2.2. Virus and Cells
2.3. Dairy Cow, PBMC Culture, and Viral Infection
2.4. RNA Extraction, Sequencing, and Bioinformatics Analyses
2.5. Validation of RNA-Seq Results by RT-qPCR
2.6. Protein Extraction and iTRAQ Labelling
2.7. High pH Prefractionation and Nano-LC-MS/MS Analysis
2.8. Protein Bioinformatics Analysis
2.9. Validation of iTRAQ Results by Parallel Reaction Monitoring
2.10. Statistical Analysis
3. Results
3.1. Determination of BVDV-1 Replication in Cow PBMCs
3.2. Quality Evaluation of the Transcriptome and Differentially Expressed Gene Analysis
3.3. Quality Evaluation of the Proteome and Analysis of Different Proteins
3.4. Verification of DEGs by qRT-PCR and DEPs by Parallel Reaction Monitoring
3.5. Combined Analysis of Transcriptome and Proteome Data
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smith, D.B.; Meyers, G.; Bukh, J.; Gould, E.A.; Monath, T.; Scott, M.A.; Pletnev, A.; Rico-Hesse, R.; Stapleton, J.T.; Simmonds, P.; et al. Proposed revision to the taxonomy of the genus Pestivirus, family Flaviviridae. J. Gen. Virol. 2017, 98, 8. [Google Scholar] [CrossRef]
- Yesilbag, K.; Alpay, G.; Becher, P. Variability and Global Distribution of Subgenotypes of Bovine Viral Diarrhea Virus. Viruses 2017, 9, 128. [Google Scholar] [CrossRef]
- Bauermann, F.V.; Ridpath, J.F. HoBi-like viruses—The typical ’atypical bovine pestivirus’. Anim. Health Res. Rev. 2015, 16, 64–69. [Google Scholar] [CrossRef]
- Pinior, B.; Firth, C.L.; Richter, V.; Lebl, K.; Trauffler, M.; Dzieciol, M.; Hutter, S.E.; Burgstaller, J.; Obritzhauser, W.; Winter, P.; et al. A systematic review of financial and economic assessments of bovine viral diarrhea virus (BVDV) prevention and mitigation activities worldwide. Prev. Vet. Med. 2017, 137, 77–92. [Google Scholar] [CrossRef] [PubMed]
- Wolff, P.L.; Schroeder, C.; McAdoo, C.; Cox, M.; Nelson, D.D.; Evermann, J.F.; Ridpath, J.F. Evidence of Bovine viral diarrhea virus Infection in Three Species of Sympatric Wild Ungulates in Nevada: Life History Strategies May Maintain Endemic Infections in Wild Populations. Front. Microbiol. 2016, 7, 292. [Google Scholar] [CrossRef] [PubMed]
- Benavides, B.; Casal, J.; Dieguez, J.F.; Yus, E.; Moya, S.J.; Armengol, R.; Allepuz, A. Development of a quantitative risk assessment of bovine viral diarrhea virus and bovine herpesvirus-1 introduction in dairy cattle herds to improve biosecurity. J. Dairy Sci. 2020, 103, 6454–6472. [Google Scholar] [CrossRef] [PubMed]
- Ran, X.; Chen, X.; Ma, L.; Wen, X.; Zhai, J.; Wang, M.; Tong, X.; Hou, G.; Ni, H. A systematic review and meta-analysis of the epidemiology of bovine viral diarrhea virus (BVDV) infection in dairy cattle in China. Acta Trop. 2019, 190, 296–303. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Sun, C.Q.; Cao, S.J.; Lin, T.; Yuan, S.S.; Zhang, H.B.; Zhai, S.L.; Huang, L.; Shan, T.L.; Zheng, H.; et al. High prevalence of bovine viral diarrhea virus 1 in Chinese swine herds. Vet. Microbiol. 2012, 159, 490–493. [Google Scholar] [CrossRef] [PubMed]
- Mao, L.; Li, W.; Yang, L.; Wang, J.; Cheng, S.; Wei, Y.; Wang, Q.; Zhang, W.; Hao, F.; Ding, Y.; et al. Primary surveys on molecular epidemiology of bovine viral diarrhea virus 1 infecting goats in Jiangsu province, China. BMC Vet. Res. 2016, 12, 181. [Google Scholar] [CrossRef]
- Zhang, K.; Zhang, J.; Qiu, Z.; Zhang, K.; Liang, F.; Zhou, Q.; Wang, L.; Li, J. Prevalence characteristic of BVDV in some large scale dairy farms in Western China. Front. Vet. Sci. 2022, 9, 961337. [Google Scholar] [CrossRef]
- Iqbal, M.; Flick-Smith, H.; McCauley, J.W. Interactions of bovine viral diarrhoea virus glycoprotein E(rns) with cell surface glycosaminoglycans. J. Gen. Virol. 2000, 81, 451–459. [Google Scholar] [CrossRef] [PubMed]
- Krey, T.; Himmelreich, A.; Heimann, M.; Menge, C.; Thiel, H.J.; Maurer, K.; Rumenapf, T. Function of bovine CD46 as a cellular receptor for bovine viral diarrhea virus is determined by complement control protein 1. J. Virol. 2006, 80, 3912–3922. [Google Scholar] [CrossRef] [PubMed]
- Peterhans, E.; Schweizer, M. Pestiviruses: How to outmaneuver your hosts. Vet. Microbiol. 2010, 142, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Ridpath, J.F.; Bendfeldt, S.; Neill, J.D.; Liebler-Tenorio, E. Lymphocytopathogenic activity in vitro correlates with high virulence in vivo for BVDV type 2 strains: Criteria for a third biotype of BVDV. Virus Res. 2006, 118, 62–69. [Google Scholar] [CrossRef]
- Chase, C.C. The impact of BVDV infection on adaptive immunity. Biologicals 2013, 41, 52–60. [Google Scholar] [CrossRef]
- Archambault, D.; Beliveau, C.; Couture, Y.; Carman, S. Clinical response and immunomodulation following experimental challenge of calves with type 2 noncytopathogenic bovine viral diarrhea virus. Vet. Res. 2000, 31, 215–227. [Google Scholar] [CrossRef]
- Peterhans, E.; Jungi, T.W.; Schweizer, M. BVDV and innate immunity. Biologicals 2003, 31, 107–112. [Google Scholar] [CrossRef]
- Fredericksen, F.; Carrasco, G.; Villalba, M.; Olavarria, V.H. Cytopathic BVDV-1 strain induces immune marker production in bovine cells through the NF-kappaB signaling pathway. Mol. Immunol. 2015, 68, 213–222. [Google Scholar] [CrossRef]
- Villalba, M.; Fredericksen, F.; Otth, C.; Olavarria, V. Transcriptomic analysis of responses to cytopathic bovine viral diarrhea virus-1 (BVDV-1) infection in MDBK cells. Mol. Immunol. 2016, 71, 192–202. [Google Scholar] [CrossRef]
- Villalba, M.; Canales, N.; Maldonado, N.; Otth, C.; Fredericksen, F.; Garces, P.; Stepke, C.; Arriagada, V.; Olavarria, V.H. Bovine A20 gene overexpression during bovine viral diarrhea virus-1 infection blocks NF-kappaB pathway in MDBK cells. Dev. Comp. Immunol. 2017, 77, 23–29. [Google Scholar] [CrossRef]
- Yang, T.; Zhang, F.; Zhai, L.; He, W.; Tan, Z.; Sun, Y.; Wang, Y.; Liu, L.; Ning, C.; Zhou, W.; et al. Transcriptome of Porcine PBMCs over Two Generations Reveals Key Genes and Pathways Associated with Variable Antibody Responses post PRRSV Vaccination. Sci. Rep. 2018, 8, 2460. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Liu, Q.; Su, W.; Wang, J.; Sun, Y.; Zhang, J.; Shang, K.; Chen, Z.; Cheng, S.; Wu, H. Genome-wide analysis of differentially expressed genes and the modulation of PEDV infection in Vero E6 cells. Microb. Pathog. 2018, 117, 247–254. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Liu, Y.; Liang, L.; Cui, S.; Zhang, Y. RNA-Seq based transcriptome analysis during bovine viral diarrhoea virus (BVDV) infection. BMC Genom. 2019, 20, 774. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Mao, L.; Shu, X.; Liu, R.; Hao, F.; Li, J.; Liu, M.; Yang, L.; Zhang, W.; Sun, M.; et al. Transcriptome analysis reveals differential immune related genes expression in bovine viral diarrhea virus-2 infected goat peripheral blood mononuclear cells (PBMCs). BMC Genom. 2019, 20, 516. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, S.; He, B.; Wang, T.; Zhao, S.; Wu, C.; Yue, S.; Zhang, S.; He, M.; Wang, L.; et al. PD-1 blockade inhibits lymphocyte apoptosis and restores proliferation and anti-viral immune functions of lymphocyte after CP and NCP BVDV infection in vitro. Vet. Microbiol. 2018, 226, 74–80. [Google Scholar] [CrossRef]
- Song, Q.J.; Weng, X.G.; Cai, D.J.; Zhang, W.; Wang, J.F. Forsythoside A Inhibits BVDV Replication via TRAF2-Dependent CD28-4-1BB Signaling in Bovine PBMCs. PLoS ONE 2016, 11, e162791. [Google Scholar] [CrossRef]
- Casas, E.; Falkenberg, S.M.; Dassanayake, R.P.; Register, K.B.; Neill, J.D. MicroRNA profiles for different tissues from calves challenged with Mycoplasma bovis or challenged with Mycoplasma bovis and bovine viral diarrhea virus. PLoS ONE 2022, 17, e271581. [Google Scholar] [CrossRef]
- Adler, B.; Adler, H.; Pfister, H.; Jungi, T.W.; Peterhans, E. Macrophages infected with cytopathic bovine viral diarrhea virus release a factor(s) capable of priming uninfected macrophages for activation-induced apoptosis. J. Virol. 1997, 71, 3255–3258. [Google Scholar] [CrossRef]
- Ma, Y.; Wang, L.; Jiang, X.; Yao, X.; Huang, X.; Zhou, K.; Yang, Y.; Wang, Y.; Sun, X.; Guan, X.; et al. Integrative Transcriptomics and Proteomics Analysis Provide a Deep Insight into Bovine Viral Diarrhea Virus-Host Interactions During BVDV Infection. Front. Immunol. 2022, 13, 862828. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef]
- Urcuqui-Inchima, S.; Cabrera, J.; Haenni, A.L. Interplay between dengue virus and Toll-like receptors, RIG-I/MDA5 and microRNAs: Implications for pathogenesis. Antivir. Res. 2017, 147, 47–57. [Google Scholar] [CrossRef] [PubMed]
- Colavita, F.; Bordoni, V.; Caglioti, C.; Biava, M.; Castilletti, C.; Bordi, L.; Quartu, S.; Iannetta, M.; Ippolito, G.; Agrati, C.; et al. ZIKV Infection Induces an Inflammatory Response but Fails to Activate Types I, II, and III IFN Response in Human PBMC. Mediat. Inflamm. 2018, 2018, 2450540. [Google Scholar] [CrossRef] [PubMed]
- Hao, Q.; Jiao, S.; Shi, Z.; Li, C.; Meng, X.; Zhang, Z.; Wang, Y.; Song, X.; Wang, W.; Zhang, R.; et al. A non-canonical role of the p97 complex in RIG-I antiviral signaling. Embo J. 2015, 34, 2903–2920. [Google Scholar] [CrossRef] [PubMed]
- Dao, C.T.; Zhang, D.E. ISG15: A ubiquitin-like enigma. Front. Biosci. 2005, 10, 2701–2722. [Google Scholar] [CrossRef] [PubMed]
- Xiao, J.; Li, W.; Zheng, X.; Qi, L.; Wang, H.; Zhang, C.; Wan, X.; Zheng, Y.; Zhong, R.; Zhou, X.; et al. Targeting 7-Dehydrocholesterol Reductase Integrates Cholesterol Metabolism and IRF3 Activation to Eliminate Infection. Immunity 2020, 52, 109–122. [Google Scholar] [CrossRef]
- Santer, D.M.; Minty, G.; Golec, D.P.; Lu, J.; May, J.; Namdar, A.; Shah, J.; Elahi, S.; Proud, D.; Joyce, M.; et al. Differential expression of interferon-lambda receptor 1 splice variants determines the magnitude of the antiviral response induced by interferon-lambda 3 in human immune cells. PLoS Pathog. 2020, 16, e1008515. [Google Scholar] [CrossRef]
- Quintana, M.E.; Barone, L.J.; Trotta, M.V.; Turco, C.; Mansilla, F.C.; Capozzo, A.V.; Cardoso, N.P. In-vivo Activity of IFN-lambda and IFN-alpha Against Bovine-Viral-Diarrhea Virus in a Mouse Model. Front. Vet. Sci. 2020, 7, 45. [Google Scholar] [CrossRef]
- Quintana, M.E.; Cardoso, N.P.; Pereyra, R.; Barone, L.J.; Barrionuevo, F.M.; Mansilla, F.C.; Turco, C.S.; Capozzo, A.V. Interferon lambda protects cattle against bovine viral diarrhea virus infection. Vet. Immunol. Immunopathol. 2020, 230, 110145. [Google Scholar] [CrossRef]
- Saco, A.; Rey-Campos, M.; Rosani, U.; Novoa, B.; Figueras, A. The Evolution and Diversity of Interleukin-17 Highlight an Expansion in Marine Invertebrates and Its Conserved Role in Mucosal Immunity. Front. Immunol. 2021, 12, 692997. [Google Scholar] [CrossRef]
- Nilesh, A.; Abhishek, V.G.; Sarah, L.G. IL-17 Signaling: The Yin and the Yang. Trends Immunol. 2017, 38, 310–322. [Google Scholar] [CrossRef]
- Park, C.; Bae, H.; Bazer, F.W.; Song, G.; Lim, W. Activation of CCL20 and its receptor CCR6 promotes endometrium preparation for implantation and placenta development during the early pregnancy period in pigs. Dev. Comp. Immunol. 2019, 92, 35–42. [Google Scholar] [CrossRef] [PubMed]
- Zlotnik, A.; Yoshie, O. The chemokine superfamily revisited. Immunity 2012, 36, 705–716. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Jiang, Z. The essential adaptors of innate immune signaling. Protein Cell 2013, 4, 27–39. [Google Scholar] [CrossRef] [PubMed]
- Weckmann, M.; Collison, A.; Simpson, J.L.; Kopp, M.V.; Wark, P.A.; Smyth, M.J.; Yagita, H.; Matthaei, K.I.; Hansbro, N.; Whitehead, B.; et al. Critical link between TRAIL and CCL20 for the activation of TH2 cells and the expression of allergic airway disease. Nat. Med. 2007, 13, 1308–1315. [Google Scholar] [CrossRef] [PubMed]
- Bule, P.; Aguiar, S.I.; Aires-Da-Silva, F.; Dias, J. Chemokine-Directed Tumor Microenvironment Modulation in Cancer Immunotherapy. Int. J. Mol. Sci. 2021, 22, 9804. [Google Scholar] [CrossRef]
- Barksby, H.E.; Lea, S.R.; Preshaw, P.M.; Taylor, J.J. The expanding family of interleukin-1 cytokines and their role in destructive inflammatory disorders. Clin. Exp. Immunol. 2007, 149, 217–225. [Google Scholar] [CrossRef]
- Dimitriadis, E.; Salamonsen, L.A.; Robb, L. Expression of interleukin-11 during the human menstrual cycle: Coincidence with stromal cell decidualization and relationship to leukaemia inhibitory factor and prolactin. Mol. Hum. Reprod. 2000, 6, 907–914. [Google Scholar] [CrossRef]
- Yeganegi, M.; Leung, C.G.; Martins, A.; Kim, S.O.; Reid, G.; Challis, J.R.; Bocking, A.D. Lactobacillus rhamnosus GR-1 stimulates colony-stimulating factor 3 (granulocyte) (CSF3) output in placental trophoblast cells in a fetal sex-dependent manner. Biol. Reprod. 2011, 84, 18–25. [Google Scholar] [CrossRef]
- Wang, H.; FitzPatrick, M.; Wilson, N.J.; Anthony, D.; Reading, P.C.; Satzke, C.; Dunne, E.M.; Licciardi, P.V.; Seow, H.J.; Nichol, K.; et al. CSF3R/CD114 mediates infection-dependent transition to severe asthma. J. Allergy Clin. Immunol. 2019, 143, 785–788. [Google Scholar] [CrossRef]
- Weiner, C.M.; Smirnova, N.P.; Webb, B.T.; Van Campen, H.; Hansen, T.R. Interferon stimulated genes, CXCR4 and immune cell responses in peripheral blood mononuclear cells infected with bovine viral diarrhea virus. Res. Vet. Sci. 2012, 93, 1081–1088. [Google Scholar] [CrossRef]
- Burr, S.; Thomas, C.; Brownlie, J.; Offord, V.; Coffey, T.J.; Werling, D. Potential evidence for biotype-specific chemokine profile following BVDV infection of bovine macrophages. Vet. Immunol. Immunopathol. 2012, 150, 123–127. [Google Scholar] [CrossRef] [PubMed]
- Cekic, S.; Cicek, F.; Karali, Y.; Gorukmez, O.; Eren, E.; Kilic, S.S. Three different faces of TACI mutations. Scand. J. Immunol. 2020, 91, e12879. [Google Scholar] [CrossRef] [PubMed]
- Sazzini, M.; Zuntini, R.; Farjadian, S.; Quinti, I.; Ricci, G.; Romeo, G.; Ferrari, S.; Calafell, F.; Luiselli, D. An evolutionary approach to the medical implications of the tumor necrosis factor receptor superfamily member 13B (TNFRSF13B) gene. Genes. Immun. 2009, 10, 566–578. [Google Scholar] [CrossRef]
- Nice, T.J.; Baldridge, M.T.; McCune, B.T.; Norman, J.M.; Lazear, H.M.; Artyomov, M.; Diamond, M.S.; Virgin, H.W. Interferon-lambda cures persistent murine norovirus infection in the absence of adaptive immunity. Science 2015, 347, 269–273. [Google Scholar] [CrossRef] [PubMed]
- Stoermer, K.A.; Morrison, T.E. Complement and viral pathogenesis. Virology 2011, 411, 362–373. [Google Scholar] [CrossRef] [PubMed]
- Ricklin, D.; Hajishengallis, G.; Yang, K.; Lambris, J.D. Complement: A key system for immune surveillance and homeostasis. Nat. Immunol. 2010, 11, 785–797. [Google Scholar] [CrossRef] [PubMed]
Genes | Primer Sequences (5′-3′) | PCR Product (bp) |
---|---|---|
n.ACTB | F: TCTGGCACCACACCTTCTACAAC | 168 bp |
R: GATACCCATCTCCGTGCTCTCTAAC | ||
MMP9-F | F: GACGCCGCTCACCTTCACTC | 86 bp |
R: GATACCCATCTCCGTGCTCTCTAAC | ||
CXCR2-F | F: CATGCTGTTCTGCTACGGATTCAC | 142 bp |
R: CACGATCAGGACCAGGTTGTAGG | ||
PTX3-F | F: GTGGGTGGTGGCTTTGATGAAAC | 168 bp |
R: GTGGGGCTGAATCTCTGTGACTC | ||
CTSL-F | F: CAGGCACACGATGAATGGCTTTC | 156 bp |
R: GCCCAACAAGAACCACATTTACCC | ||
TNFAIP3-F | F: ACAATGAGCAGGGACGGAGAG | 112 bp |
R: ATGAAGAATGGGCAGTTAGGTGTC | ||
CSF3-F | F: ACGAGCTGCCTGAACCAACTAC | 140 bp |
R: CAGATGTTCGTGGCAAAGTCAGTG | ||
IL1R2-F | F: CATGGAGGACGCAGGCTACTATAC | 155 bp |
R: GTGAGGCTGAGATGGTCTGGTG | ||
CCL20-F | F: ACTTCGACTGCTGTCTCCGATATAC | 104 bp |
R: AACTGCATTGATGTCACAGGCTTC | ||
SF13B-F | F: CCAAGAGCAAGGCAGGTATTATGAC | 114 bp |
R: CTCCTCAGCGTCTTCTCACAGTAG | ||
F3-F | F: GGCTCTTCTATTCGGCTTAGTCCTC | 142 bp |
R: GACATGATTGATGGGTTTGGGTTCC | ||
NOS2-F | F: GGTACGAATGGTTCCGGGAG | 121 bp |
R: CCCATGTACCACCCGTTGAA |
Sample | Raw Data | Valid Data | Mapped Reads | Valid Ratio (Reads) | Q20% | Q30% | GC Content% |
---|---|---|---|---|---|---|---|
NC_R1 | 43,792,662 | 42,534,790 | 40,081,237 (94.23%) | 97.13 | 99.97 | 97.04 | 45.50 |
NC_R2 | 44,614,414 | 43,345,270 | 40,999,375 (94.59%) | 97.16 | 99.97 | 97.11 | 45.50 |
NC_R3 | 37,510,276 | 36,461,870 | 34,464,721 (94.52%) | 97.21 | 99.97 | 97.25 | 45.50 |
NC_R4 | 44,255,242 | 43,030,338 | 40,800,479 (94.82%) | 97.23 | 99.97 | 97.23 | 45.50 |
V_R1 | 37,922,494 | 36,873,992 | 34,804,716 (94.39%) | 97.24 | 99.97 | 97.13 | 47.00 |
V_R2 | 36,932,852 | 35,938,950 | 33,921,839 (94.39%) | 97.31 | 99.97 | 97.08 | 47.00 |
V_R3 | 37,957,180 | 36,945,006 | 34,816,947 (94.24%) | 97.33 | 99.97 | 97.06 | 47.00 |
V_R4 | 40,911,136 | 39,776,768 | 37,639,683 (94.63%) | 97.23 | 99.97 | 97.13 | 47.00 |
Gene_id | Gene_name | FC log2(V/NC) | Regulation | |
---|---|---|---|---|
RNA-Seq | qRT-PCR | |||
ENSBTAG00000006894 | NOS2 | 1.00 | 1.50 | up |
ENSBTAG00000000436 | TNFAIP3 | −0.43 | −0.19 | down |
ENSBTAG00000000720 | CTSL | 1.06 | 0.85 | up |
ENSBTAG00000020676 | MMP9 | −1.00 | −0.68 | down |
ENSBTAG00000021462 | CSF3 | −1.03 | −1.06 | down |
ENSBTAG00000006343 | IL1R2 | −1.87 | −1.48 | down |
ENSBTAG00000021326 | CCL20 | −1.43 | −1.64 | down |
ENSBTAG00000015298 | TNFRSF13B | 1.35 | 1.15 | up |
ENSBTAG00000007101 | F3 | −1.23 | −1.04 | down |
ENSBTAG00000038042 | CXCR2 | −1.52 | −0.99 | down |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, K.; Zhang, J.; Wang, L.; Liang, Q.; Niu, Y.; Gu, L.; Wei, Y.; Li, J. Integrative Transcriptomics and Proteomics Analysis Reveals Immune Response Process in Bovine Viral Diarrhea Virus-1-Infected Peripheral Blood Mononuclear Cells. Vet. Sci. 2023, 10, 596. https://doi.org/10.3390/vetsci10100596
Zhang K, Zhang J, Wang L, Liang Q, Niu Y, Gu L, Wei Y, Li J. Integrative Transcriptomics and Proteomics Analysis Reveals Immune Response Process in Bovine Viral Diarrhea Virus-1-Infected Peripheral Blood Mononuclear Cells. Veterinary Sciences. 2023; 10(10):596. https://doi.org/10.3390/vetsci10100596
Chicago/Turabian StyleZhang, Kang, Jingyan Zhang, Lei Wang, Qiang Liang, Yuhui Niu, Linlin Gu, Yanming Wei, and Jianxi Li. 2023. "Integrative Transcriptomics and Proteomics Analysis Reveals Immune Response Process in Bovine Viral Diarrhea Virus-1-Infected Peripheral Blood Mononuclear Cells" Veterinary Sciences 10, no. 10: 596. https://doi.org/10.3390/vetsci10100596