Next Article in Journal
Long Non-Coding RNA as a Potential Biomarker for Canine Tumors
Next Article in Special Issue
Histopathological Aspects of the Influence of Babesia microti on the Placentas of Infected Female Rats
Previous Article in Journal
Antimicrobial Susceptibility Profiles of Acinetobacter baumannii Strains, Isolated from Clinical Cases of Companion Animals in Greece
Previous Article in Special Issue
Histopathological Analysis of Selected Organs of Rats with Congenital Babesiosis Caused by Babesia microti
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Veterinary Sciences
Volume 10
Issue 11
10.3390/vetsci10110636
vetsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Survey of Rickettsia raoultii in Ticks Infesting Livestock from Pakistan with Notes on Pathogen Distribution in Palearctic and Oriental Regions

by
Shehla Shehla
1,
Mashal M. Almutairi
2,
Abdulaziz Alouffi
3,
Tetsuya Tanaka
4,
Shun-Chung Chang
5,*,
Chien-Chin Chen
6,7,8,9 and
Abid Ali
1,*
1
Department of Zoology, Abdul Wali Khan University Mardan, Khyber Pakhtunkhwa Pakistan, Mardan 23200, Pakistan
2
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia
3
King Abdulaziz City for Science and Technology, Riyadh 12354, Saudi Arabia
4
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
5
Department of Emergency Medicine, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi 60002, Taiwan
6
Department of Pathology, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi 60002, Taiwan
7
Department of Cosmetic Science, Chia Nan University of Pharmacy and Science, Tainan 717, Taiwan
8
Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 402, Taiwan
9
Department of Biotechnology and Bioindustry Sciences, College of Bioscience and Biotechnology, National Cheng Kung University, Tainan 701, Taiwan
*
Authors to whom correspondence should be addressed.
Vet. Sci. 2023, 10(11), 636; https://doi.org/10.3390/vetsci10110636
Submission received: 8 August 2023 / Revised: 12 October 2023 / Accepted: 27 October 2023 / Published: 29 October 2023
(This article belongs to the Special Issue Tick-Borne Diseases and Their Control)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Ticks are chelicerate arthropods that feed on blood and infest all vertebrates except fish and transmit different disease-causing agents including Rickettsia spp. to domestic and wild animals as well as humans. In the present study, we aimed to molecularly screen and genetically characterize Rickettsia spp. in various tick species infesting camels, sheep, and goats from five districts (Kohat, Dera Ismail Khan, Lower Dir, Bajaur, and Mansehra) of Khyber Pakhtunkhwa province, Pakistan. A total of 8/148 (5.4%) ticks, including four Hyalomma turanicum, two Haemaphysalis cornupunctata, one Haemaphysalis montgomeryi, and one Haemaphysalis bispinosa, were found positive for Rickettsia sp. The phylogenetic analysis of detected Rickettsia sp. based on three genetic markers (gltA, ompA, and ompB) revealed 100% identity with Rickettsia raoultii, clustered with its corresponding species reported in China, Russia, USA, Turkey, Denmark, Austria, Italy, and France. Further comprehensive studies on molecular and serosurveillance of various Rickettsia spp. in different ticks should be conducted in the region to understand the zoonotic threats due to these pathogens.

Abstract

Ticks are hematophagous ectoparasites that transmit different pathogens such as Rickettsia spp. to domestic and wild animals as well as humans. Genetic characterizations of Rickettsia spp. from different regions of Pakistan are mostly based on one or two genetic markers and are confined to small sampling areas and limited host ranges. Therefore, this study aimed to molecularly screen and genetically characterize Rickettsia spp. in various tick species infesting camels, sheep, and goats. All the collected tick specimens were morphologically identified, and randomly selected tick species (148) were screened molecularly for the detection of Rickettsia spp. by amplifying three rickettsial DNA fragments, namely, the citrate-synthase gene (gltA), outer-membrane protein A (ompA), and outer-membrane protein B (ompB). After examining 261 hosts, 161 (61.7%) hosts were found infested by 564 ticks, including 287 (50.9%) nymphs, 171 (30.3%) females, and 106 (18.8%) males in five districts (Kohat, Dera Ismail Khan, Lower Dir, Bajaur, and Mansehra). The highest occurrence was noted for Hyalomma dromedarii (number = 72, 12.8%), followed by Haemaphysalis sulcata (n = 70, 12.4%), Rhipicephalus turanicus (n = 64, 11.3%), Rhipicephalus microplus (n = 55, 9.7%), Haemaphysalis cornupunctata (n = 49, 8.7%), Hyalomma turanicum (n = 48, 8.5%), Hyalomma isaaci (n = 45, 8.0%), Haemaphysalis montgomeryi (n = 44, 7.8%), Hyalomma anatolicum (n = 42, 7.5%), Haemaphysalis bispinosa (n = 38, 6.7%), and Rhipicephalus haemaphysaloides (n = 37, 6.6%). A subset of 148 ticks were tested, in which eight (5.4%) ticks, including four Hy. turanicum, two Ha. cornupunctata, one Ha. montgomeryi, and one Ha. bispinosa, were found positive for Rickettsia sp. The gltA, ompA, and ompB sequences revealed 100% identity and were phylogenetically clustered with Rickettsia raoultii reported in China, Russia, USA, Turkey, Denmark, Austria, Italy, and France. Additionally, various reports on R. raoultii from Palearctic and Oriental regions were summarized in this study. To the best of our knowledge, this is the first report regarding genetic characterization and phylogenetic analysis of R. raoultii from Pakistan. Further studies to investigate the association between Rickettsia spp. and ticks should be encouraged to apprise effective management of zoonotic consequences.

1. Introduction

Ticks carry and transmit a wide range of pathogens comprising viruses, fungi, protozoans, and bacteria [1,2,3]. The genus Rickettsia is comprised of obligate Gram-negative bacteria, is distributed worldwide, and can cause rickettsiosis in hosts including domestic and wild animals, as well as humans [2,4]. Arthropod vectors such as ticks, fleas, mites, and lice may transmit Rickettsia spp.; however, the competent vectors for its propagation are mostly Ixodid ticks [5]. Tick-borne rickettsiosis is a known vector-borne zoonotic disease [2], and the majority of the tick-borne Rickettsiae belong to the spotted fever group (SFG) of Rickettsia [6]. So far, almost 33 different Rickettsia spp. and 19 different Candidatus (Ca) Rickettsia spp. in the SFG group have been identified globally [7,8,9,10,11].
Rickettsia raoultii was first detected in Rhipicephalus pumilio and Dermacentor nuttalli ticks from the former Soviet Union in 1999 [12]. Then, it was isolated from Dermacentor silvarum ticks in 2008 [13]. It has been detected in various tick species including Dermacentor marginatus, Dermacentor nuttalli, Dermacentor reticulatus, Dermacentor silvarum, Haemaphysalis longicornis, Haemaphysalis erinacei, Haemaphysalis concinna, Ixodes persulcatus, Ixodes canisuga, Ixodes ricinus, and Rhipicephalus sanguineus [14,15,16,17,18,19,20,21,22]. Later, R. raoultii was also isolated from embryo-derived tick cell lines originating from Rhipicephalus microplus [23] and Rhipicephalus sanguineus [24]. Additionally, various fleas including Ctenocephalides felis collected from goats have been identified as potential carriers of R. raoultii [25]. This Rickettsia sp. has been detected in the blood and various tissues of animals including heart, liver, spleen, lung, and kidney [19,26,27,28,29,30].
In humans, R. raoultii causes SENLAT (scalp eschars and neck lymphadenopathy after a tick bite) syndrome, initially named DEBONEL (Dermacentor-borne necrotic erythema and lymphadenopathy) or TIBOLA (tick-borne lymphadenopathy after a tick bite) [22,31,32]. Meningeal syndrome and neurological abnormalities such as eyelid droop and elevated cerebrospinal pressure have also been documented as clinical symptoms of R. raoultii infections [32,33]. Although generally linked with mild infections, more severe infections with leukopenia, thrombocytopenia, and septic features have also been described, indicating different degrees of virulence or susceptibility to R. raoultii [34]. The pathogenicity of R. raoultii has been reported in Spain, France, Slovakia, Poland, and China [29,32,33,34,35,36]. Globally, R. raoultii has been detected serologically and molecularly in ticks, fleas, animals, humans, and vegetation.
Pakistan is an agricultural country, and livestock play an important role in its economy, as different animals are a major source of income for rural inhabitants. However, in Pakistan, different ticks including Hyalomma spp., Rhipicephalus spp., Amblyomma spp., Ixodes spp., Ornithodoros spp., Nosomma spp., and Haemaphysalis spp. have been reported infesting livestock and wild animals, and these ticks can transmit different pathogens such as Anaplasma spp., Rickettsia spp., Babesia spp., Theileria spp., and Coxiella spp. [37,38,39,40,41,42,43,44,45]. In Pakistan, some Rickettsia spp. have been reported in ticks infesting equids, bovines, and wild animals [37,39,46,47], and these Rickettsia species were reported based on targeting only one or two rickettsial markers. Hence, there is a dearth of information regarding the genetic characterization of Rickettsia spp. in different tick species infesting camels, sheep, and goats. Novel Rickettsia species of undetermined pathogenicity are continuously detected in ticks, necessitating effective tools to infer their phylogenetic relationships. The present study aims to molecularly characterize the Rickettsia spp. in hard ticks infesting camels, sheep, and goats by using three genetic markers in Khyber Pakhtunkhwa (KP), Pakistan.

2. Materials and Methods

2.1. Ethical Approval

This study was approved by the members of graduate study committee and Advance Studies Research Board (AWKUM/CE/SC/2022/12041) of the Zoology Department, Abdul Wali Khan University Mardan, Pakistan. Verbal and written permission was obtained from livestock owners before examining their animals for the collection of ticks.

2.2. Study Area

The current study was performed in five districts of the KP province, including Kohat (33°33′36.0″ N 71°28′31.5″ E), Dera Ismail Khan (D.I Khan) (31°51′02.9″ N 70°53′28.5″ E), Lower Dir (34°54′10.6″ N 71°47′21.6″ E), Bajaur (34°48′11.0″ N 71°31′08.3″ E), and Mansehra (34°19′40.4″ N 73°11′56.1″ E). Different hosts including camels, sheep, and goats were examined for the collection of ticks from July 2020–June 2021. The latitudes and longitudes of the tick collection sites were collected via the Global Positioning System (GPS) and imported to Microsoft Excel V. 2013 for processing. The study area map (Figure 1) was designed in ArcGIS V. 10.3.1 (ESRI, Redlands, CA, USA).

2.3. Ticks Collection and Identification

Tick collection was performed on camels, sheep, and goats in the selected study area. Ticks were collected from the aforementioned hosts by examining the entire body, and they were found regardless of the specific locations and times within the targeted survey districts in various farms, open fields, and freely moving animals in pastures. Collection was performed only once for each host when tick infestation was detected. Host-based collected ticks were separately stored in micro-tubes labelled with the collection sites and specified host. Tick specimens were washed with distilled water and preserved in 100% ethanol for further processing.
Collected tick specimens were identified morphologically using a stereomicroscope (SZ61, Olympus, Japan) by following the available standard keys [39,48,49,50,51,52]; then, identified ticks were preserved in 100% ethanol until molecular analysis.

2.4. Molecular Screening of Rickettsia spp.

A total of 148 (74N, 74F) tick specimens were subjected to DNA extraction for molecular analyses. Individual ticks were crushed and their genomic DNA was extracted through a standard method of phenol-chloroform [53]. Genomic DNA was not extracted from all the morphologically identified ticks because we selected representative ticks of each tick species from their respective host in each district. The extracted DNA was quantified using Nanodrop (Nano-Q, Optizen, Daejeon, Republic of Korea) and stored at −20 °C for further molecular experimentation. The extracted DNA of each individual tick was tested for the presence of Rickettsia spp. through a conventional PCR targeting the amplification of fragments of three genes including citrate-synthase (gltA), outer-membrane protein A (ompA), and outer-membrane protein B (ompB). The PCR reaction was performed in 25 µL, having 1 µL of each primer (forward and reverse) (10 µM), 2 µL of genomic DNA (50–100 ng), 12.5 µL of DreamTaq MasterMix (2×) (Thermo Fisher Scientific, Inc., Waltham, MA, USA), and 8.5 µL of PCR water (nuclease free). The primers and PCR conditions used for the amplification of the aforementioned fragments are provided in Table 1. After PCR, the amplified products were run on 1.5% agarose gel and the results were visualized under UV light through the Gel Doc system (UVP BioDoc-It imaging system; Analytik Jena AG, Jena, Germany).

2.5. Sequences and Phylogenetic Analyses

The manufacturer’s protocol was adopted for the purification of all the amplified PCR products using the GeneClean II Kit (Qbiogene, Illkirch, France), and products were submitted for bidirectional sequencing (Macrogen Inc., Seoul, Republic of Korea) through the Sanger-based method. All the obtained bidirectional sequences were trimmed in SeqMan v. 5.0 (DNASTAR) by removing poor sequencing reads and primer contaminations. The consensus sequences for each fragment (gltA, ompA, and ompB) were obtained from all the identical trimmed sequences, which were separately subjected to the Basic Local Alignment Search Tool (BLAST) at the National Center for Biotechnology Information (NCBI). Sequences with high identity were downloaded and aligned in BioEdit alignment editor v 7.0.5 along with selected outgroups [57]. Separately, the phylogenetic trees of gltA, ompA, and ompB were constructed in Molecular Evolutionary Genetic Analysis software [58] by following the neighbor-joining method and Tamura–Nei model [59], in which 1000 bootstrap replicates were used for tree reliability [58].

2.6. Literature Search and Selection Criteria

We performed a literature search using databases including Science Direct, Web of Science, Google Scholar, and PubMed. Various keywords including tick(s), small and large ruminant(s), livestock, livestock-holder(s), farmer(s), worker(s), human(s), R. raoultii, Ca. R. raoultii, R. conorii subsp. raoultii, molecular characterization, phylogenetic analysis, and the specific country names were used in the aforementioned databases. Combinations of keywords were used to download research publications, review articles, short communications, and case-reports regarding R. raoultii. A minimum of one report of R. raoultii from each country, as well as all the previously reported human cases of R. raoultii from Palearctic and Oriental regions, were included in the current study. All this literature-based data was retrieved in July 2023 (Table 2).

3. Results

3.1. Ticks and Hosts

Overall, 261 hosts, including camels (n = 99/261, 37.9%), sheep (n = 85/261, 32.6%), and goats (n = 77/261, 29.5%), were inspected in the aforementioned five selected districts for tick collection, among which 161/261 (61.7%) hosts were found infested with ticks, among which camels were highly infested (n = 64/99, 64.6%), followed by goats (n = 49/77, 63.6%) and sheep (48/85, 56.5%). The infestation rate of various hosts was highest in Kohat (number = 40/55, 72.7%), followed by D.I. Khan (n = 30/48, 62.5%), Mansehra (n = 35/59, 59.3%), Bajaur (n = 28/50, 56.0%), and Lower Dir (n = 28/49, 57.1%). A total of 564 ticks were collected from the aforementioned hosts, and 11 different tick species belonging to three genera (Haemaphysalis, Hyalomma, and Rhipicephalus) were morphologically identified. In the current study, the highest number of ticks was collected from sheep (n = 240/564, 42.5%), followed by goats (n = 186/564, 33.0%) and the lowest number of ticks was collected from camels (n = 138/564, 24.5%). Hyalomma dromedarii ticks were recorded as having the highest occurrence (n = 72/564, 12.8%), followed by Haemaphysalis sulcata (n = 70/564, 12.4%), Rhipicephalus turanicus (n = 64/564, 11.3%), Rh. microplus (n = 55/564, 9.7%), Ha. cornupunctata (n = 49/564, 8.7%), Hyalomma turanicum (n = 48/564, 8.5%), Hyalomma isaaci (n = 45/564, 8.0%), Haemaphysalis montgomeryi (n = 44/564, 7.8%), Hyalomma anatolicum (n = 42/564, 7.5%), Haemaphysalis bispinosa (n = 38/564, 6.7%), and Rhipicephalus haemaphysaloides (n = 37/564, 6.6%) (Table 3).

3.2. Molecular Screening of Rickettsia spp.

DNA extracted from 148 (74N, 74F) identified ticks was tested for Rickettsia spp. Ticks (n = 8/148, 5.4%) were found positive for Rickettsia sp. in Kohat (n = 2/36, 5.6%), D.I Khan (n = 2/32, 6.3%), Lower Dir (n = 2/24, 8.3%), Bajaur (n = 1/28, 3.6%), and Mansehra (n = 1/28, 3.6%). Four tick species were found positive for rickettsial DNA, including Hy. turanicum, Ha. cornupunctata, Ha. montgomeryi and Ha. bispinosa. Rickettsia sp. was detected in Hy. turanicum infesting camels and sheep in the Kohat and D.I Khan districts, respectively. Additionally, Rickettsia sp. was also detected in Ha. cornupunctata, Ha. sulcata, and Ha. montgomeryi infesting sheep in district Lower Dir, Bajaur, and Mansehra, respectively. However, no rickettsial DNA was detected in Hy. dromedarii, Hy. isaaci, Hy. anatolicum, Rh. turanicus, Rh. haemaphysaloides, Rh. microplus, and Ha. sulcata (Table 3).

3.3. Sequence and Phylogenetic Analysis

In the BLAST analysis, the consensus sequence of gltA obtained for Rickettsia sp. revealed 100% identity with R. raoultii reported in China (MT178334─MT178338), Russia (DQ365804), and the USA (CP010969). The consensus sequence of ompA showed 100% identity with R. raoultii reported in Turkey (MK922656), Denmark (MF166730), Austria (KX500093), China (KX723514), and Russia (AH015609). The consensus sequence of ompB showed 100% identity with R. raoultii reported in Italy (MH532264), China (KX506744), and France (DQ365797). In the phylogenetic tree, the gltA sequence of R. raoultii clustered with corresponding species reported in China, Russia, and the USA (Figure 2). The ompA sequence of R. raoultii clustered with the corresponding species reported in Turkey, Denmark, Austria, Russia, and China (Figure 3). The ompB sequence of R. raoultii clustered with the corresponding species reported in Russia, Italy, and China (Figure 4). The obtained sequences of R. raoultii were submitted to GenBank under the accession numbers OR400635 (gltA), OR400636 (ompA), and OR400637 (ompB).

4. Discussion

Ticks pose health threats to humans and animals, as they can transmit numerous pathogens including SFG Rickettsia spp. [1,2,3]. Previously, potential health risks to humans posed by rickettsial agents have been worsened by some Rickettsia spp. including R. raoultii, which can cause rickettsiosis in humans in different regions of the world [22,32,74,91]. Camels, sheep, and goats are considered as human companions, and these animals have been identified as a notable reservoir hosts for many Rickettsia spp., which might play an important role in the natural transmission cycle and dispersal of different Rickettsia spp. [2,92,112]. Hence, a regular surveillance of various rickettsial agents carried by ticks infesting the aforementioned hosts is essential to minimize public health risks. Herein, R. raoultii was molecularly analyzed via standard genetic markers in eleven morphologically identified tick species infesting camels, sheep, and goats in five districts of KP, Pakistan, and R. raoultii was identified in four tick species including Hy. turanicum, Ha. cornupunctata, Ha. montgomeryi, and Ha. bispinosa.
Host density in the herds ultimately increases the chances of tick infestation compared to those animals kept alone due to the possibility of infestation by detached host-questing ticks in the herd area [46]. In current study, ticks of different genera including Haemaphysalis, Rhipicephalus, and Hyalomma were found infesting the aforementioned hosts, which were sharing their habitats, thus enhancing the possibilities for an available wide host range. Here, Hy. dromedarii (n = 72/564, 12.8%) was the most prevalent tick compared to other tick species because the highest number of camels (n = 99/261, 37.9%) was examined compared to other hosts. Previous reports regarding the tick abundance on camels have shown that Hy. dromedarii is the most prevalent tick species of dromedary camels because this tick is not influenced by any season, and hence shows a preponderance on camels during both dry and wet seasonal conditions [113,114]. Previous studies have shown that Hyalomma ticks can survive successfully in harsh desert regions [115,116]; therefore, the Hy. dromedarii ticks were most prevalent because the larger proportion of the study area was composed of desertic plains, arid plains, and arid hilly areas that are suitable for the survival of Hy. dromedarii ticks. Additionally, these ticks may act as vectors for the transmission of infectious agents to livestock owners [117,118]. Some Hyalomma, Rhipicephalus, and Haemaphysalis tick species infesting humans have been recorded from this region in Pakistan [119].
In Pakistan, different Rickettsia spp. have been detected in various tick species including Ix. kashmiricus, Ornithodoros sp., Rh. turanicus, Rh. haemaphysaloides, Rh. microplus, Hy. dromedarii, and Hy. anatolicum [37,39,41,46,47]. Rickettsia raoultii was detected in four tick species including Hy. turanicum, Ha. sulcata, Ha. cornupunctata, and Ha. montgomeryi, and it was previously reported in various tick genera including Hyalomma, Rhipicephalus, Dermacentor, and Ixodes in various regions of the world [14,17,81,95]. Rickettsia raoultii was detected in different tick species collected from camels, sheep, and goats in the current study. Similarly, R. raoultii has been detected in various tick species collected from the aforementioned hosts in different countries including Slovakia, Malaysia, China, Greece, Mongolia, India, Iran, and Turkey [14,25,81,89,92,99,100,108,110]. Our findings provide the first molecular evidence regarding the genetic characterization of R. raoultii in Hy. turanicum infesting camels, which suggests the possible role of this tick in the dispersal of R. raoultii in the specified region. Since adult female and nymph ticks were found positive for R. raoultii, there is a possibility that the detected R. raoultii was ingested through the blood from infected camels, as this pathogen has been previously detected in the blood of dogs in Germany [77] and Iran [30]. Hence, there is a need to conduct comprehensive serosurveillance and molecular studies on different rickettsial agents in different animals to know the factors responsible for the transmission of these bacteria in the region.
Molecular characterization of Rickettsia spp. through the ompB gene relies on its outer-membrane locality and the presence of protein epitopes that are common to both typhus and SFG Rickettsiae [7,55]. Additionally, it has been previously stated that three rickettsial genes including gltA, ompA, and ompB may be used and are known for the detection of rickettsial agents specifically to investigate the presence of SFG Rickettsiae [13,21] and to provide a significant phylogenetic relationship in the Rickettsiae [120]. Hence, R. raoultii has been previously globally detected in different ticks including De. marginatus, De. nuttalli, De. silvarum, De. reticulatus, Am. testudinarium, Am. helvolum, Ha. bispinosa, Rh. microplus, and Rh. sanguineus by using three genetic markers: gltA, ompA, and ompB [21,29,79,81,102,121]. The obtained gltA, ompA, and ompB sequences of R. raoultii in this study revealed a close evolutionary relationship and were hence phylogenetically clustered with their corresponding species reported in China, Russia, USA, Italy, Turkey, Denmark, and Austria.
Camels, sheep, and goats are considered as human companions and share their household environment, resulting in close contact with each other. R. raoultii was identified in different tick species collected from the aforementioned animals; thus, these ticks and their specified hosts may play a role as a source of human infection. Therefore, further serological and molecular studies in the region should be encouraged to understand the zoonotic threats due to these infectious agents.

5. Conclusions

Rickettsia raoultii has been previously reported in different ticks infesting camels, sheep, and goats globally. Hence, this study genetically characterized R. raoultii in four tick species including Ha. bispinosa, Ha. cornupunctata, Ha. montgomeryi, and Hy. turanicum infesting camels, sheep, and goats in Pakistan. Additionally, this is the first report regarding the detection of R. raoultii in Hy. turanicum ticks collected from camels, which suggests that camels may serve as reservoir hosts for R. raoultii in the region. Due to close contact between livestock holders and camels, sheep, and goats in the region, there are possibilities for transmission of these bacteria to humans. Thus, surveillance strategies should be adopted to properly investigate these bacteria to minimize any health threats. Further comprehensive studies on molecular and serosurveillance of Rickettsia spp. in different ticks should be conducted in the region to understand the zoonotic threats due to these pathogens.

Author Contributions

A.A. (Abid Ali) designed the study. A.A. (Abid Ali), S.S., T.T., M.M.A., A.A. (Abdulaziz Alouffi), S.-C.C. and C.-C.C. carried out the experiments. A.A. (Abid Ali), S.S., S.-C.C. and C.-C.C. analyzed the results. A.A. (Abdulaziz Alouffi), M.M.A., S.S., A.A. (Abid Ali), S.-C.C. and C.-C.C. contributed part of manuscript writing, critical revision of the manuscript for important intellectual content, study supervision, and fund support. All authors have read and agreed to the published version of the manuscript.

Funding

The researchers supporting project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

The current study was approved by the members of graduate study committee and Advance Studies Research Board (AWKUM/CE/SC/2022/12041) of the Department of Zoology, Abdul Wali Khan University Mardan, Pakistan. Verbal and written permission was obtained from livestock owners before examining their animals for the collection of ticks.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All data generated or analyzed during this study were included in this article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors acknowledge the financial support provided by the Higher Education Commission (HEC) of Pakistan, Pakistan Science Foundation (PSF). The researchers support project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest. There is no financial/personal interest or belief that could affect the objectivity of this study.

References

  1. Dantas-Torres, F.; Latrofa, M.S.; Annoscia, G.; Giannelli, A.; Parisi, A.; Otranto, D. Morphological and genetic diversity of Rhipicephalus sanguineus sensu lato from the New and Old Worlds. Parasites Vectors 2013, 6, 213. [Google Scholar] [CrossRef] [PubMed]
  2. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
  3. De la Fuente, J.; Antunes, S.; Bonnet, S.; Cabezas-Cruz, A.; Domingos, A.G.; Estrada-Peña, A.; Johnson, N.; Kocan, K.M.; Mansfield, K.L.; Nijhof, A.M.; et al. Tick-pathogen interactions and vector competence: Identification of molecular drivers for tick-borne diseases. Front. Cell. Infect. Microbiol. 2017, 7, 114. [Google Scholar] [CrossRef] [PubMed]
  4. Davison, H.R.; Pilgrim, J.; Wybouw, N.; Parker, J.; Pirro, S.; Hunter-Barnett, S.; Campbell, P.M.; Blow, F.; Darby, A.C.; Hurst, G.D.; et al. Genomic diversity across the Rickettsia and ‘Candidatus Megaira’genera and proposal of genus status for the Torix group. Nat. Commun. 2022, 13, 2630. [Google Scholar] [CrossRef] [PubMed]
  5. Chao, L.L.; Robinson, M.; Liang, Y.F.; Shih, C.M. First detection and molecular identification of Rickettsia massiliae, a human pathogen, in Rhipicephalus sanguineus ticks collected from Southern Taiwan. PLoS Negl. Trop. Dis. 2022, 16, 0010917. [Google Scholar] [CrossRef] [PubMed]
  6. Parola, P.; Paddock, C.D.; Raoult, D. Tick-borne rickettsioses around the world: Emerging diseases challenging old concepts. Clin. Microbiol. Rev. 2005, 18, 719–756. [Google Scholar] [CrossRef] [PubMed]
  7. Fournier, P.E.; Raoult, D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann. N. Y. Acad. Sci. 2009, 1166, 1–11. [Google Scholar] [CrossRef] [PubMed]
  8. Merhej, V.; Angelakis, E.; Socolovschi, C.; Raoult, D. Genotyping, evolution and epidemiological findings of Rickettsia species. Infect. Genet. Evol. 2014, 25, 122–137. [Google Scholar] [CrossRef]
  9. Elelu, N.; Ola-Fadunsin, S.D.; Bankole, A.A.; Raji, M.A.; Ogo, N.I.; Cutler, S.J. Prevalence of tick infestation and molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in north-central Nigeria. PLoS ONE 2022, 17, 0263843. [Google Scholar] [CrossRef]
  10. Lu, M.; Tian, J.; Wang, W.; Zhao, H.; Jiang, H.; Han, J.; Guo, W.; Li, K. High diversity of Rickettsia spp.; Anaplasma spp.; and Ehrlichia spp. in ticks from Yunnan Province, Southwest China. Front. Microbiol 2022, 13, 1008110. [Google Scholar] [CrossRef]
  11. Zhang, Y.Y.; Sun, Y.Q.; Chen, J.J.; Teng, A.Y.; Wang, T.; Li, H.; Hay, S.I.; Fang, L.Q.; Yang, Y.; Liu, W. Mapping the global distribution of spotted fever group rickettsiae: A systematic review with modelling analysis. Lancet Digit. Health 2022, 5, e5–e15. [Google Scholar] [CrossRef] [PubMed]
  12. Rydkina, E.; Roux, V.; Rudakov, N.; Gafarova, M.; Tarasevich, I.; Raoult, D. New Rickettsiae in ticks collected in territories of the former Soviet Union. Emerg. Infect. Dis. 1999, 5, 811. [Google Scholar] [CrossRef] [PubMed]
  13. Mediannikov, O.; Matsumoto, K.; Samoylenko, I.; Drancourt, M.; Roux, V.; Rydkina, E.; Davoust, B.; Tarasevich, I.; Brouqui, P.; Fournier, P.E. Rickettsia raoultii sp. novel, a spotted fever group Rickettsia associated with Dermacentor ticks in Europe and Russia. Int. J. Syst. Evol. 2008, 58, 1635–1639. [Google Scholar] [CrossRef] [PubMed]
  14. Špitalská, E.; Štefanidesová, K.; Kocianová, E.; Boldiš, V. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus and Dermacentor reticulatus ticks from Slovak Republic. Exp. Appl. Acarol. 2012, 57, 189–197. [Google Scholar] [CrossRef] [PubMed]
  15. Tian, Z.C.; Liu, G.Y.; Shen, H.; Xie, J.R.; Luo, J.; Tian, M.Y. First report on the occurrence of Rickettsia slovaca and Rickettsia raoultii in Dermacentor silvarum in China. Parasites Vectors 2012, 5, 19. [Google Scholar] [CrossRef] [PubMed]
  16. Guo, L.P.; Mu, L.M.; Xu, J.; Jiang, S.H.; Wang, A.D.; Chen, C.F.; Guo, G.; Zhang, W.J.; Wang, Y.Z. Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China–Kazakhstan border. Parasites Vectors 2015, 8, 461. [Google Scholar] [CrossRef] [PubMed]
  17. Cheng, C.; Fu, W.; Ju, W.; Yang, L.; Xu, N.; Wang, Y.M.; Li, H.; Wang, Y.L.; Hu, M.X.; Wen, J.; et al. Diversity of spotted fever group Rickettsia infection in hard ticks from Suifenhe, Chinese–Russian border. Ticks Tick Borne Dis. 2016, 7, 715–719. [Google Scholar] [CrossRef]
  18. Liu, X.; Yang, M.; Liu, G.; Zhao, S.; Yuan, W.; Xiao, R.; Hazihan, W.; Hornok, S.; Wang, Y. Molecular evidence of Rickettsia raoultii, “Candidatus Rickettsia barbariae” and a novel Babesia genotype in marbled polecats (Vormela peregusna) at the China-Kazakhstan border. Parasites Vectors 2018, 11, 450. [Google Scholar] [CrossRef]
  19. Liu, G.; Zhao, S.; Tan, W.; Hornok, S.; Yuan, W.; Mi, L.; Wang, S.; Liu, Z.; Zhang, Y.; Hazihan, W.; et al. Rickettsiae in red fox (Vulpes vulpes), marbled polecat (Vormela peregusna) and their ticks in northwestern China. Parasites Vectors 2021, 14, 204. [Google Scholar] [CrossRef]
  20. Chisu, V.; Foxi, C.; Masala, G. First molecular detection of the human pathogen Rickettsia raoultii and other spotted fever group rickettsiae in Ixodid ticks from wild and domestic mammals. Parasitol. Res. 2018, 117, 3421–3429. [Google Scholar] [CrossRef]
  21. Zhao, S.; Yang, M.; Jiang, M.; Yan, B.; Zhao, S.; Yuan, W.; Wang, B.; Hornok, S.; Wang, Y. Rickettsia raoultii and Rickettsia sibirica in ticks from the long-tailed ground squirrel near the China–Kazakhstan border. Exp. Appl. Acarol. 2019, 77, 425–433. [Google Scholar] [CrossRef] [PubMed]
  22. Tariq, M.; Seo, J.W.; Kim, D.Y.; Panchali, M.J.L.; Yun, N.R.; Lee, Y.M.; Kim, C.M.; Kim, D.M. First report of the molecular detection of human pathogen Rickettsia raoultii in ticks from the Republic of Korea. Parasites Vectors 2021, 14, 191. [Google Scholar] [CrossRef] [PubMed]
  23. Palomar, A.M.; Premchand-Branker, S.; Alberdi, P.; Belova, O.A.; Moniuszko-Malinowska, A.; Kahl, O.; Bell-Sakyi, L. Isolation of known and potentially pathogenic tick-borne microorganisms from European ixodid ticks using tick cell lines. Ticks Tick Borne Dis. 2019, 10, 628–638. [Google Scholar] [CrossRef] [PubMed]
  24. Santibáñez, S.; Portillo, A.; Palomar, A.M.; Bell-Sakyi, L.; Romero, L.; Oteo, J.A. Isolation and maintenance of Rickettsia raoultii in a Rhipicephalus sanguineus tick cell line. Microbes Infect. 2015, 17, 866–869. [Google Scholar] [CrossRef] [PubMed]
  25. Güvendi, M.; Can, H.; Köseoğlu, A.E.; Alak, S.E.; Kandemir, Ç.; Taşkın, T.; Sürgeç, E.; Demir, S.; Döşkaya, A.D.; Karakavuk, M. Investigation of the genetic diversity and flea-borne pathogens in Ctenocephalides felis samples collected from goats in İzmir and Şanlıurfa provinces of Turkey. Comp. Immunol. Microbiol. Infect. Dis. 2022, 90, 101896. [Google Scholar]
  26. Tay, S.T.; Mokhtar, A.S.; Low, K.C.; Mohd Zain, S.N.; Jeffery, J.; Abdul Aziz, N.; Kho, K.L. Identification of rickettsiae from wild rats and cat fleas in Malaysia. Med. Vet. Entomol. 2014, 28, 104–108. [Google Scholar] [CrossRef] [PubMed]
  27. Kuo, C.C.; Shu, P.Y.; Mu, J.J.; Wang, H.C. High prevalence of Rickettsia spp. infections in small mammals in Taiwan. Vector Borne Zoonotic Dis. 2015, 15, 13–20. [Google Scholar] [PubMed]
  28. Kho, K.L.; Koh, F.X.; Singh, H.K.L.; Zan, H.A.M.; Kukreja, A.; Ponnampalavanar, S.; Tay, S.T. Case report: Spotted fever group rickettsioses and murine typhus in a Malaysian teaching hospital. Am. J. Trop. Med. 2016, 95, 765. [Google Scholar] [CrossRef]
  29. Li, H.; Zhang, P.H.; Huang, Y.; Du, J.; Cui, N.; Yang, Z.D.; Tang, F.; Fu, F.X.; Li, X.M.; Cui, X.M.; et al. Isolation and identification of Rickettsia raoultii in human cases: A surveillance study in 3 medical centers in China. Clin. Infect. Dis. 2018, 66, 1109–1115. [Google Scholar] [CrossRef]
  30. Iatta, R.; Sazmand, A.; Nguyen, V.L.; Nemati, F.; Ayaz, M.M.; Bahiraei, Z.; Zafari, S.; Giannico, A.; Greco, G.; Dantas-Torres, F.; et al. Vector-borne pathogens in dogs of different regions of Iran and Pakistan. Parasitol. Res. 2021, 120, 4219–4228. [Google Scholar] [CrossRef]
  31. Angelakis, E.; Pulcini, C.; Waton, J.; Imbert, P.; Socolovschi, C.; Edouard, S.; Dellamonica, P.; Raoult, D. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. Clin. Infect. Dis. 2010, 50, 549–551. [Google Scholar] [CrossRef] [PubMed]
  32. Dong, Z.; Yang, Y.; Wang, Q.; Xie, S.; Zhao, S.; Tan, W.; Yuan, W.; Wang, Y. A case with neurological abnormalities caused by Rickettsia raoultii in northwestern China. BMC Infect. Dis. 2019, 19, 229. [Google Scholar] [CrossRef] [PubMed]
  33. Igolkina, Y.; Krasnova, E.; Rar, V.; Savelieva, M.; Epikhina, T.; Tikunov, A.; Khokhlova, N.; Provorova, V.; Tikunova, N. Detection of causative agents of tick-borne rickettsioses in Western Siberia, Russia: Identification of Rickettsia raoultii and Rickettsia sibirica DNA in clinical samples. Clin. Microbiol. Infect. 2018, 24, 199-e9. [Google Scholar] [CrossRef] [PubMed]
  34. Switaj, K.; Chmielewski, T.; Borkowski, P.; Tylewska-Wierzbanowska, S.; Olszynska-Krowicka, M. Spotted fever rickettsiosis caused by Rickettsia raoultii—Case report. Prz. Epidemiol. 2012, 66, 347–350. [Google Scholar]
  35. Parola, P.; Rovery, C.; Rolain, J.M.; Brouqui, P.; Davoust, B.; Raoult, D. Rickettsia slovaca and R. raoultii in tick-borne rickettsioses. Emerg. Infect. Dis. 2009, 15, 1105. [Google Scholar] [CrossRef] [PubMed]
  36. Sekeyova, Z.; Subramanian, G.; Mediannikov, O.; Diaz, M.Q.; Nyitray, A.; Blaskovicova, H.; Raoult, D. Evaluation of clinical specimens for Rickettsia, Bartonella, Borrelia, Coxiella, Anaplasma, Franciscella and Diplorickettsia positivity using serological and molecular biology methods. FEMS Microbiol. Immunol. 2012, 64, 82–91. [Google Scholar] [CrossRef] [PubMed]
  37. Karim, S.; Budachetri, K.; Mukherjee, N.; Williams, J.; Kausar, A.; Hassan, M.J.; Adamson, S.; Dowd, S.E.; Apanskevich, D.; Arijo, A.; et al. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS Negl. Trop. Dis. 2017, 11, 0005681. [Google Scholar] [CrossRef] [PubMed]
  38. Khan, Z.; Shehla, S.; Alouffi, A.; Kashif Obaid, M.; Zeb Khan, A.; Almutairi, M.M.; Numan, M.; Aiman, O.; Alam, S.; Ullah, S. Molecular survey and genetic characterization of Anaplasma marginale in ticks collected from livestock hosts in Pakistan. Animals 2022, 12, 1708. [Google Scholar] [CrossRef]
  39. Ali, A.; Shehla, S.; Zahid, H.; Ullah, F.; Zeb, I.; Ahmed, H.; Da Silva Vaz, I., Jr.; Tanaka, T. Molecular survey and spatial distribution of Rickettsia spp. in ticks infesting free-ranging wild animals in Pakistan (2017–2021). Pathogens 2022, 11, 162. [Google Scholar] [CrossRef]
  40. Aiman, O.; Ullah, S.; Chitimia-Dobler, L.; Nijhof, A.M.; Ali, A. First report of Nosomma monstrosum ticks infesting Asian water buffaloes (Bubalus bubalis) in Pakistan. Ticks Tick Borne Dis. 2022, 13, 101899. [Google Scholar] [CrossRef]
  41. Numan, M.; Islam, N.; Adnan, M.; Zaman Safi, S.; Chitimia-Dobler, L.; Labruna, M.B.; Ali, A. First genetic report of Ixodes kashmiricus and associated Rickettsia sp. Parasites Vectors 2022, 15, 378. [Google Scholar] [CrossRef] [PubMed]
  42. Khan, S.M.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Numan, M.; Ullah, S.; Obaid, M.K.; Islam, Z.U.; Ahmed, H.; Tanaka, T.; et al. Phylogenetic Position of Haemaphysalis kashmirensis and Haemaphysalis cornupunctata, with Notes on Rickettsia spp. Genes 2023, 14, 360. [Google Scholar] [CrossRef] [PubMed]
  43. Ali, A.; Obaid, M.K.; Almutairi, M.; Alouffi, A.; Numan, M.; Ullah, S.; Rehman, G.; Islam, Z.U.; Khan, S.B.; Tanaka, T. Molecular Detection of Coxiella spp. in Ticks (Ixodidae and Argasidae) Infesting Domestic and Wild Animals: With Notes on the Epidemiology of Tick-borne Coxiella burnetii in Asia. Front. Microbiol 2023, 14, 1229950. [Google Scholar] [CrossRef] [PubMed]
  44. Obaid, M.K.; Almutairi, M.M.; Alouffi, A.; Safi, S.Z.; Tanaka, T.; Ali, A. Assessment of cypermethrin and amitraz resistance and molecular profiling of voltage-gated sodium channel and octopamine tyramine genes of Rhipicephalus microplus. Front. Cell Infect. Microbiol. 2023, 13, 1176013. [Google Scholar] [CrossRef] [PubMed]
  45. Khan, M.; Islam, N.; Khan, A.; Islam, Z.U.; Muñoz-Leal, S.; Labruna, M.B.; Ali, A. New records of Amblyomma gervaisi from Pakistan, with detection of a reptile-associated Borrelia sp. Ticks. Tick. Borne. Dis. 2022, 13, 102047. [Google Scholar] [CrossRef] [PubMed]
  46. Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; Muñoz-Leal, S.; et al. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection. Parasites Vectors 2021, 14, 363. [Google Scholar] [CrossRef] [PubMed]
  47. Ali, A.; Numan, M.; Khan, M.; Aiman, O.; Muñoz-Leal, S.; Chitimia-Dobler, L.; Labruna, M.B. and Nijhof, A.M. Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan. Parasites Vectors 2022, 15, 138. [Google Scholar] [CrossRef]
  48. Hoogstraal, H.; Varma, M.G.R. Haemaphysalis cornupunctata sp. n. and H. kashmirensis sp. n. from Kashmir, with Notes on H. sundrai Sharif and H. sewelli Sharif of India and Pakistan (Ixodoidea, Ixodidae). J. Parasitol. 1962, 48, 185–194. [Google Scholar] [CrossRef]
  49. Hoogstraal, H.; Trapido, H. Redescription of the type materials of Haemaphysalis (Kaiseriana) bispinosa Neumann (India), H. (K.) neumanni Dönitz (Japan), H. (K.) lagrangei Larrousse (Vietnam), and H. (K.) yeni Toumanoff (Vietnam) (Ixodoidea, Ixodidae). J. Parasitol. 1966, 52, 1188–1198. [Google Scholar] [CrossRef]
  50. Hoogstraal, H.; Trapido, H.; Kohls, G.M. Studies on southeast Asian Haemaphysalis ticks (Ixodoidea, Ixodidae). Speciation in the H. (Kaiseriana) obesa group: H. semermis Neumann, H. obesa Larrousse, H. roubaudi Toumanoff, H. montgomeryi Nuttall, and H. hirsuta sp. n. J. Parasitol. 1966, 52, 169–191. [Google Scholar] [CrossRef]
  51. Walker, J.B.; Keirans, J.E.; Horak, I.G. The Genus Rhipicephalus (Acari, Ixodidae): A Guide to the Brown Ticks of the World; Cambridge University Press: Cambridge, UK, 2000. [Google Scholar]
  52. Apanaskevich, D.A.; Schuster, A.L.; Horak, I.G. The genus Hyalomma: VII. Redescription of all parasitic stages of H. (Euhyalomma) dromedarii and H. (E.) schulzei (Acari: Ixodidae). J. Med. Entomol. 2008, 45, 817–831. [Google Scholar] [CrossRef] [PubMed]
  53. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual (No. Ed. 2); Cold Spring Harbor Laboratory Press: Long Island, NY, USA, 1989. [Google Scholar]
  54. Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef] [PubMed]
  55. Regnery, R.L.; Spruill, C.L.; Plikaytis, B. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [PubMed]
  56. Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rompB (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [PubMed]
  57. Hall, T.; Biosciences, I.; Carlsbad, C.J.G.B.B. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  58. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef] [PubMed]
  59. Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar]
  60. Sarih, M.; Socolovschi, C.; Boudebouch, N.; Hassar, M.; Raoult, D.; Parola, P. Spotted fever group rickettsiae in ticks, Morocco. Emerg. Infect. Dis. 2008, 14, 1067. [Google Scholar] [CrossRef]
  61. Santibáñez, S.; Portillo, A.; Santibáñez, P.; Palomar, A.M.; Oteo, J.A. Usefulness of rickettsial PCR assays for the molecular diagnosis of human rickettsioses. Enferm. Infecc. Microbiol. Clin. 2013, 31, 283–288. [Google Scholar] [CrossRef]
  62. Andoh, M.; Sakata, A.; Takano, A.; Kawabata, H.; Fujita, H.; Une, Y.; Goka, K.; Kishimoto, T.; Ando, S. Detection of Rickettsia and Ehrlichia spp. in ticks associated with exotic reptiles and amphibians imported into Japan. PLoS ONE 2015, 10, 0133700. [Google Scholar] [CrossRef]
  63. Gargili, A.; Palomar, A.M.; Midilli, K.; Portillo, A.; Kar, S.; Oteo, J.A. Rickettsia species in ticks removed from humans in Istanbul, Turkey. Vector Borne Zoonotic Dis. 2012, 12, 938–941. [Google Scholar] [CrossRef] [PubMed]
  64. Milhano, N.; de Carvalho, I.L.; Alves, A.S.; Arroube, S.; Soares, J.; Rodriguez, P.; Carolino, M.; Núncio, M.S.; Piesman, J.; de Sousa, R. Co-infections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal. Ticks Tick Borne Dis. 2010, 1, 172–177. [Google Scholar] [CrossRef] [PubMed]
  65. Földvári, G.; Rigó, K.; Lakos, A. Transmission of Rickettsia slovaca and Rickettsia raoultii by male Dermacentor marginatus and Dermacentor reticulatus ticks to humans. Diagn. Microbiol. Infect. Dis. 2013, 76, 387–389. [Google Scholar] [CrossRef] [PubMed]
  66. Portillo, A.; Ibarra, V.; Santibáñez, S.; Pérez-Martínez, L.; Blanco, J.R.; Oteo, J.A. Genetic characterisation of ompA, ompB and gltA genes from Candidatus Rickettsia rioja. Clin. Microbiol. Infect. 2009, 15, 307–308. [Google Scholar] [CrossRef]
  67. Jiang, J.; You, B.J.; Liu, E.; Apte, A.; Yarina, T.R.; Myers, T.E.; Lee, J.S.; Francesconi, S.C.; O’Guinn, M.L.; Tsertsvadze, N.; et al. Development of three quantitative real-time PCR assays for the detection of Rickettsia raoultii, Rickettsia slovaca, and Rickettsia aeschlimannii and their validation with ticks from the country of Georgia and the Republic of Azerbaijan. Ticks Tick Borne Dis. 2012, 3, 327–331. [Google Scholar] [CrossRef] [PubMed]
  68. Reye, A.L.; Stegniy, V.; Mishaeva, N.P.; Velhin, S.; Hübschen, J.M.; Ignatyev, G.; Muller, C.P. Prevalence of tick-borne pathogens in Ixodes ricinus and Dermacentor reticulatus ticks from different geographical locations in Belarus. PLoS ONE 2013, 8, 54476. [Google Scholar] [CrossRef] [PubMed]
  69. Doornbos, K.; Sumrandee, C.; Ruang–Areerate, T.; Baimai, V.; Trinachartvanit, W.; Ahantarig, A. Rickettsia sp. closely related to Rickettsia raoultii (Rickettsiales: Rickettsiaceae) in an Amblyomma helvolum (Acarina: Ixodidae) tick from a Varanus salvator (Squamata: Varanidae) in Thailand. J. Med. Entomol. 2013, 50, 217–220. [Google Scholar] [CrossRef]
  70. Seo, M.G.; Kwon, O.D.; Kwak, D. High prevalence of Rickettsia raoultii and associated pathogens in canine ticks, South Korea. Emerg. Infect. Dis. 2020, 26, 2530. [Google Scholar] [CrossRef]
  71. Obiegala, A.; Oltersdorf, C.; Silaghi, C.; Kiefer, D.; Kiefer, M.; Woll, D.; Pfeffer, M. Rickettsia spp. in small mammals and their parasitizing ectoparasites from Saxony, Germany. Vet. Parasitol. Reg. Stud 2016, 5, 19–24. [Google Scholar] [CrossRef]
  72. Rudolf, I.; Venclíková, K.; Blažejová, H.; Betášová, L.; Mendel, J.; Hubálek, Z.; Parola, P. First report of Rickettsia raoultii and Rickettsia helvetica in Dermacentor reticulatus ticks from the Czech Republic. Ticks Tick Borne Dis. 2016, 7, 1222–1224. [Google Scholar] [CrossRef]
  73. Zaharia, M.; Popescu, C.P.; Florescu, S.A.; Ceausu, E.; Raoult, D.; Parola, P.; Socolovschi, C. Rickettsia massiliae infection and SENLAT syndrome in Romania. Ticks Tick Borne Dis. 2016, 7, 759–762. [Google Scholar] [CrossRef] [PubMed]
  74. Špitalská, E.; Boldišová, E.; Palkovičová, K.; Sekeyová, Z.; Škultéty, L. Case studies of rickettsiosis, anaplasmosis and Q fever in Slovak population from 2011 to 2020. Biologia 2021, 77, 1633–1640. [Google Scholar] [CrossRef]
  75. Szekeres, S.; Docters van Leeuwen, A.; Rigó, K.; Jablonszky, M.; Majoros, G.; Sprong, H.; Földvári, G. Prevalence and diversity of human pathogenic rickettsiae in urban versus rural habitats, Hungary. Exp. Appl. Acarol. 2016, 68, 223–226. [Google Scholar] [CrossRef] [PubMed]
  76. Jia, N.; Zheng, Y.C.; Ma, L.; Huo, Q.B.; Ni, X.B.; Jiang, B.G.; Chu, Y.L.; Jiang, R.R.; Jiang, J.F.; Cao, W.C. Human infections with Rickettsia raoultii, China. Emerging Infect. Dis. 2014, 20, 866. [Google Scholar] [CrossRef] [PubMed]
  77. Wächter, M.; Wölfel, S.; Pfeffer, M.; Dobler, G.; Kohn, B.; Moritz, A.; Pachnicke, S.; Silaghi, C. Serological differentiation of antibodies against Rickettsia helvetica, R. raoultii, R. slovaca, R. monacensis and R. felis in dogs from Germany by a micro-immunofluorescent antibody test. Parasites Vectors 2015, 8, 126. [Google Scholar] [CrossRef] [PubMed]
  78. Speck, S.; Derschum, H.; Damdindorj, T.; Dashdavaa, O.; Jiang, J.; Kaysser, P.; Jigjav, B.; Nyamdorj, E.; Baatar, U.; Munkhbat, E.; et al. Rickettsia raoultii, the predominant Rickettsia found in Mongolian Dermacentor nuttalli. Ticks Tick Borne Dis. 2012, 3, 227–231. [Google Scholar] [CrossRef] [PubMed]
  79. Taylor, A.J.; Vongphayloth, K.; Vongsouvath, M.; Grandadam, M.; Brey, P.T.; Newton, P.N.; Sutherland, I.W.; Dittrich, S. Large-scale survey for tickborne bacteria, Khammouan Province, Laos. Emerg. Infect. Dis. 2016, 22, 1635. [Google Scholar] [CrossRef]
  80. Del Cerro, A.; Oleaga, A.; Somoano, A.; Barandika, J.F.; García-Pérez, A.L.; Espí, A. Molecular identification of tick-borne pathogens (Rickettsia spp.; Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Coxiella burnetii and piroplasms) in questing and feeding hard ticks from North-Western Spain. Ticks Tick Borne Dis. 2022, 13, 101961. [Google Scholar] [CrossRef]
  81. Kho, K.L.; Koh, F.X.; Hasan, L.I.M.; Wong, L.P.; Kisomi, M.G.; Bulgiba, A.; Nizam, Q.N.H.; Tay, S.T. Rickettsial seropositivity in the indigenous community and animal farm workers, and vector surveillance in Peninsular Malaysia. Emerg. Microbes Infect. 2017, 6, 1–9. [Google Scholar] [CrossRef]
  82. Seo, M.G.; Kwon, O.D.; Kwak, D. Molecular detection of Rickettsia raoultii, Rickettsia tamurae, and associated pathogens from ticks parasitizing water deer (Hydropotes inermis argyropus) in South Korea. Ticks Tick Borne Dis. 2021, 12, 101712. [Google Scholar] [CrossRef]
  83. Andersson, M.O.; Marga, G.; Banu, T.; Dobler, G.; Chitimia-Dobler, L. Tick-borne pathogens in tick species infesting humans in Sibiu County, central Romania. Parasitol. Res. 2018, 117, 1591–1597. [Google Scholar] [CrossRef] [PubMed]
  84. Ionita, M.; Silaghi, C.; Mitrea, I.L.; Edouard, S.; Parola, P.; Pfister, K. Molecular detection of Rickettsia conorii and other zoonotic spotted fever group rickettsiae in ticks, Romania. Ticks Tick Borne Dis. 2016, 7, 150–153. [Google Scholar] [CrossRef]
  85. Stańczak, J.; Biernat, B.; Racewicz, M.; Zalewska, M.; Matyjasek, A. Prevalence of different Rickettsia spp. in Ixodes ricinus and Dermacentor reticulatus ticks (Acari: Ixodidae) in north-eastern Poland. Ticks Tick Borne Dis. 2018, 9, 427–434. [Google Scholar] [CrossRef]
  86. Król, N.; Obiegala, A.; Pfeffer, M.; Lonc, E.; Kiewra, D. Detection of selected pathogens in ticks collected from cats and dogs in the Wrocław Agglomeration, South-West Poland. Parasites Vectors 2016, 9, 351. [Google Scholar] [CrossRef] [PubMed]
  87. Didyk, Y.M.; Blaňárová, L.; Pogrebnyak, S.; Akimov, I.; Pet’ko, B.; Víchová, B. Emergence of tick-borne pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Ricketsia raoultii and Babesia microti) in the Kyiv urban parks, Ukraine. Ticks Tick Borne Dis. 2017, 8, 219–225. [Google Scholar] [CrossRef] [PubMed]
  88. Jumpertz, M.; Sevestre, J.; Luciani, L.; Houhamdi, L.; Fournier, P.E.; Parola, P. Bacterial Agents Detected in 418 Ticks Removed from Humans during 2014–2021, France. Emerg. Infect. Dis. 2023, 29, 701. [Google Scholar] [CrossRef] [PubMed]
  89. Moraga-Fernández, A.; Chaligiannis, Ι.; Cabezas-Cruz, A.; Papa, A.; Sotiraki, S.; de La Fuente, J.; Fernández de Mera, I.G. Molecular identification of spotted fever group Rickettsia in ticks collected from dogs and small ruminants in Greece. Exp. Appl. Acarol. 2019, 78, 421–430. [Google Scholar] [CrossRef] [PubMed]
  90. Dib, L.; Lafri, I.; Boucheikhchoukh, M.; Dendani, Z.; Bitam, I.; Benakhla, A. Seasonal distribution of Rickettsia spp. in ticks in northeast Algeria. New Microbes New Infect. 2019, 27, 48–52. [Google Scholar] [CrossRef]
  91. Hofmeester, T.R.; van der Lei, P.B.; Van Leeuwen, A.D.; Sprong, H.; van Wieren, S.E. New foci of Haemaphysalis punctata and Dermacentor reticulatus in the Netherlands. Ticks Tick Borne Dis. 2016, 7, 367–370. [Google Scholar] [CrossRef]
  92. Yin, X.; Guo, S.; Ding, C.; Cao, M.; Kawabata, H.; Sato, K.; Ando, S.; Fujita, H.; Kawamori, F.; Su, H.; et al. Spotted fever group rickettsiae in Inner Mongolia, China, 2015–2016. Emerg. Infect. Dis. 2018, 24, 2105. [Google Scholar] [CrossRef]
  93. Potkonjak, A.; Gutiérrez, R.; Savić, S.; Vračar, V.; Nachum-Biala, Y.; Jurišić, A.; Kleinerman, G.; Rojas, A.; Petrović, A.; Baneth, G.; et al. Molecular detection of emerging tick-borne pathogens in Vojvodina, Serbia. Ticks Tick Borne Dis. 2016, 7, 199–203. [Google Scholar] [CrossRef] [PubMed]
  94. Duscher, G.G.; Hodžić, A.; Weiler, M.; Vaux, A.G.; Rudolf, I.; Sixl, W.; Medlock, J.M.; Versteirt, V.; Hubálek, Z. First report of Rickettsia raoultii in field collected Dermacentor reticulatus ticks from Austria. Ticks Tick Borne Dis. 2016, 7, 720–722. [Google Scholar] [CrossRef] [PubMed]
  95. Turebekov, N.; Abdiyeva, K.; Yegemberdiyeva, R.; Dmitrovsky, A.; Yeraliyeva, L.; Shapiyeva, Z.; Amirbekov, A.; Oradova, A.; Kachiyeva, Z.; Ziyadina, L.; et al. Prevalence of Rickettsia species in ticks including identification of unknown species in two regions in Kazakhstan. Parasites Vectors 2019, 12, 197. [Google Scholar] [CrossRef] [PubMed]
  96. Igolkina, Y.; Rar, V.; Vysochina, N.; Ivanov, L.; Tikunov, A.; Pukhovskaya, N.; Epikhina, T.; Golovljova, I.; Tikunova, N. Genetic variability of Rickettsia spp. in Dermacentor and Haemaphysalis ticks from the Russian Far East. Ticks Tick Borne Dis. 2018, 9, 1594–1603. [Google Scholar] [CrossRef] [PubMed]
  97. Dwużnik-Szarek, D.; Mierzejewska, E.J.; Kiewra, D.; Czułowska, A.; Robak, A.; Bajer, A. Update on prevalence of Babesia canis and Rickettsia spp. in adult and juvenile Dermacentor reticulatus ticks in the area of Poland (2016–2018). Sci. Rep 2022, 12, 5755. [Google Scholar] [CrossRef] [PubMed]
  98. Demir, S.; Erkunt Alak, S.; Köseoğlu, A.E.; Ün, C.; Nalçacı, M.; Can, H. Molecular investigation of Rickettsia spp. and Francisella tularensis in ticks from three provinces of Turkey. Exp. Appl. Acarol. 2020, 81, 239–253. [Google Scholar] [CrossRef] [PubMed]
  99. Nimisha, M.; Devassy, J.K.; Pradeep, R.K.; Pakideery, V.; Sruthi, M.K.; Pious, A.; Kurbet, P.S.; Amrutha, B.M.; Chandrasekhar, L.; Deepa, C.K.; et al. Ticks and accompanying pathogens of domestic and wild animals of Kerala, South India. Exp. Appl. Acarol. 2019, 79, 137–155. [Google Scholar] [CrossRef] [PubMed]
  100. Ghasemi, A.; Latifian, M.; Esmaeili, S.; Naddaf, S.R.; Mostafavi, E. Molecular surveillance for Rickettsia spp. and Bartonella spp. in ticks from Northern Iran. PLoS ONE 2022, 17, 0278579. [Google Scholar] [CrossRef]
  101. Lernout, T.; De Regge, N.; Tersago, K.; Fonville, M.; Suin, V.; Sprong, H. Prevalence of pathogens in ticks collected from humans through citizen science in Belgium. Parasites Vectors 2019, 12, 550. [Google Scholar] [CrossRef]
  102. Klitgaard, K.; Chriél, M.; Isbrand, A.; Jensen, T.K.; Bødker, R. Identification of Dermacentor reticulatus ticks carrying Rickettsia raoultii on migrating jackal, Denmark. Emerg. Infect. Dis. 2017, 23, 2072. [Google Scholar] [CrossRef]
  103. Schmuck, H.M.; Chitimia-Dobler, L.; Król, N.; Kacza, J.; Pfeffer, M. Collection of immature Dermacentor reticulatus (Fabricius, 1794) ticks from vegetation and detection of Rickettsia raoultii in them. Ticks Tick Borne Dis. 2020, 11, 101543. [Google Scholar] [CrossRef]
  104. Sgroi, G.; Iatta, R.; Lia, R.P.; D’Alessio, N.; Manoj, R.R.S.; Veneziano, V.; Otranto, D. Spotted fever group rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound. Emerg. Dis. 2021, 68, 2111–2120. [Google Scholar] [CrossRef]
  105. Zhang, Y.; Jiang, L.; Yang, Y.; Xie, S.; Yuan, W.; Wang, Y. A tick bite patient with fever and meningitis co-infected with Rickettsia raoultii and Tacheng tick virus 1: A case report. BMC Infect. Dis. 2021, 21, 330. [Google Scholar] [CrossRef]
  106. Ivan, T.; Matei, I.A.; Novac, C.Ș.; Kalmár, Z.; Borșan, S.D.; Panait, L.C.; Gherman, C.M.; Ionică, A.M.; Papuc, I.; Mihalca, A.D. Spotted Fever Group Rickettsia spp. Diversity in Ticks and the First Report of Rickettsia hoogstraalii in Romania. Vet. Sci. 2022, 9, 343. [Google Scholar] [CrossRef] [PubMed]
  107. Xue, J.; Ren, Q.; Yang, X.L.; Wang, J.; Xie, G.; Du, L.; Guo, W.P. Human pathogens in ticks removed from humans in Hebei, China. Heliyon 2023, 9, e13859. [Google Scholar] [CrossRef] [PubMed]
  108. Nallan, K.; Ayyavu, V.; Ayyanar, E.; Thirupathi, B.; Gupta, B.; Devaraju, P.; Kumar, A.; Rajaiah, P. Molecular Evidence of Rickettsia conorii subsp. raoultii and Rickettsia felis in Haemaphysalis intermedia Ticks in Sirumalai, Eastern Ghats, Tamil Nadu, South India. Microorganisms 2023, 11, 1713. [Google Scholar] [CrossRef] [PubMed]
  109. Koczwarska, J.; Pawełczyk, A.; Dunaj-Małyszko, J.; Polaczyk, J.; Welc-Falęciak, R. Rickettsia species in Dermacentor reticulatus ticks feeding on human skin and clinical manifestations of tick-borne infections after tick bite. Sci. Rep. 2023, 13, 9930. [Google Scholar] [CrossRef]
  110. Cao, X.Q.; Gu, X.L.; Zhang, L.; Xu, J.; Han, H.J.; Yu, X.J. Molecular detection of Rickettsia, Anaplasma, and Bartonella in ticks from free-ranging sheep in Gansu Province, China. Ticks Tick Borne Dis. 2023, 14, 102137. [Google Scholar] [CrossRef]
  111. Rakov, A.V.; Chekanova, T.A.; Petremgvdlishvili, K.; Timonin, A.V.; Valdokhina, A.V.; Shirokostup, S.V.; Lukyanenko, N.V.; Akimkin, V.G. High Prevalence of Rickettsia raoultii Found in Dermacentor Ticks Collected in Barnaul, Altai Krai, Western Siberia. Pathogens 2023, 12, 914. [Google Scholar] [CrossRef]
  112. Belkahia, H.; Selmi, R.; Zamiti, S.; Daaloul-Jedidi, M.; Messadi, L.; Ben Said, M. Zoonotic Rickettsia species in Small ruminant ticks from Tunisia. Front. Vet. Sci. 2021, 8, 676896. [Google Scholar] [CrossRef]
  113. Onyiche, T.E.; Răileanu, C.; Tauchmann, O.; Fischer, S.; Vasić, A.; Schäfer, M.; Biu, A.A.; Ogo, N.I.; Thekisoe, O.; Silaghi, C. Prevalence and molecular characterization of ticks and tick-borne pathogens of one-humped camels (Camelus dromedarius) in Nigeria. Parasites Vectors 2020, 13, 428. [Google Scholar] [CrossRef]
  114. Alam, S.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Ullah, S.; Numan, M.; Islam, N.; Khan, Z.; Aiman, O.; Zaman Safi, S.; et al. Spatio-Temporal Patterns of Ticks and Molecular Survey of Anaplasma marginale, with Notes on Their Phylogeny. Microorganisms 2022, 10, 1663. [Google Scholar] [CrossRef]
  115. Uspensky, I. Preliminary observations on specific adaptations of exophilic ixodid ticks to forests or open country habitats. Exp. Appl. Acarol. 2002, 28, 147–154. [Google Scholar] [CrossRef]
  116. Kamran, K.; Ali, A.; Villagra, C.A.; Bazai, Z.A.; Iqbal, A.; Sajid, M.S. Hyalomma anatolicum resistance against ivermectin and fipronil is associated with indiscriminate use of acaricides in south-western Balochistan, Pakistan. Parasitol. Res. 2021, 120, 15–25. [Google Scholar] [CrossRef]
  117. Kamani, J.; Baneth, G.; Apanaskevich, D.A.; Mumcuoglu, K.Y.; Harrus, S. Molecular detection of Rickettsia aeschlimannii in Hyalomma spp. ticks from camels (Camelus dromedarius) in Nigeria, West Africa. Med. Vet. Entomol. 2015, 29, 205–209. [Google Scholar] [CrossRef]
  118. Guglielmone, A.A.; Robbins, R.G. Hard Ticks (Acari: Ixodida: Ixodidae) Parasitizing Humans; Springer: Cham, Switzerland, 2018; Volume 230. [Google Scholar]
  119. Ali, A.; Khan, M.A.; Zahid, H.; Yaseen, P.M.; Khan, M.Q.; Nawab, J.; Rehman, Z.U.; Ateeq, M.; Khan, S.; Ibrahim, M. Seasonal dynamics, record of ticks infesting humans, wild and domestic animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan. Front. Physiol. 2019, 10, 793. [Google Scholar] [CrossRef] [PubMed]
  120. Roux, V.; Rydkγna, E.; Eremeeva, M.; Raoult, D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int. J. Syst. Evol. Microbiol. 1997, 47, 252–261. [Google Scholar] [CrossRef] [PubMed]
  121. Selmi, M.; Martello, E.; Bertolotti, L.; Bisanzio, D.; Tomassone, L. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus ticks collected on wild boars in Tuscany, Italy. J. Med. Entomol. 2009, 46, 1490–1493. [Google Scholar] [CrossRef] [PubMed]
Vetsci 10 00636 g001
Figure 1. Map showing collection sites in the study area where ticks infesting camels, sheep, and goats were collected for the detection of Rickettsia spp.
Figure 1. Map showing collection sites in the study area where ticks infesting camels, sheep, and goats were collected for the detection of Rickettsia spp.
Vetsci 10 00636 g001
Vetsci 10 00636 g002
Figure 2. Phylogeny was inferred based on rickettsial gltA fragments using the neighbor-joining method. GenBank accession numbers are followed by the species and country names at each terminal taxon. Rickettsia canadensis (CP000409) was taken as an outgroup using 1000 bootstrap values at each node. The present gltA sequence (accession no. OR400635) for R. raoultii is marked with bold and underlined font.
Figure 2. Phylogeny was inferred based on rickettsial gltA fragments using the neighbor-joining method. GenBank accession numbers are followed by the species and country names at each terminal taxon. Rickettsia canadensis (CP000409) was taken as an outgroup using 1000 bootstrap values at each node. The present gltA sequence (accession no. OR400635) for R. raoultii is marked with bold and underlined font.
Vetsci 10 00636 g002
Vetsci 10 00636 g003
Figure 3. Phylogeny was inferred based on rickettsial ompA fragments using the neighbor-joining method. GenBank accession numbers are followed by the species and country names at each terminal taxon. Rickettsia canadensis (CP000409) was taken as an outgroup using 1000 bootstrap values at each node. The present ompA sequence (accession no. OR400636) for R. raoultii is marked with bold and underlined font.
Figure 3. Phylogeny was inferred based on rickettsial ompA fragments using the neighbor-joining method. GenBank accession numbers are followed by the species and country names at each terminal taxon. Rickettsia canadensis (CP000409) was taken as an outgroup using 1000 bootstrap values at each node. The present ompA sequence (accession no. OR400636) for R. raoultii is marked with bold and underlined font.
Vetsci 10 00636 g003
Vetsci 10 00636 g004
Figure 4. Phylogeny was inferred based on rickettsial ompB fragments using the neighbor-joining method. GenBank accession numbers are followed by species and country names at each terminal taxon. A group of sequences of Rickettsia lusitaniae (MN629485), Rickettsia australis (CP003338), and Rickettsia akari (AF123707) were taken as outgroups using 1000 bootstrap values at each node. The present gltA sequence of (accession no. OR400637) R. raoultii is marked with bold and underlined font.
Figure 4. Phylogeny was inferred based on rickettsial ompB fragments using the neighbor-joining method. GenBank accession numbers are followed by species and country names at each terminal taxon. A group of sequences of Rickettsia lusitaniae (MN629485), Rickettsia australis (CP003338), and Rickettsia akari (AF123707) were taken as outgroups using 1000 bootstrap values at each node. The present gltA sequence of (accession no. OR400637) R. raoultii is marked with bold and underlined font.
Vetsci 10 00636 g004
Table 1. List of primers used for the amplification of rickettsial fragments in various ticks collected from camels, goats, and sheep in the present study.
Table 1. List of primers used for the amplification of rickettsial fragments in various ticks collected from camels, goats, and sheep in the present study.
GenePrimerSequence Amplicon SizePCR ConditionStudy
gltACS-78GCAAGTATCGGTGAGGATGTAAT401 bp95 °C 3 min, 40× (95 °C 15 s, 48 °C 30 s, 72°C 30 s), 72 °C 7 min[54]
CS-323GCTTCCTTAAAATTCAATAAATCAGGAT
ompARrl9O.70 ATGGCGAATATTTCTCCAAAA 532 bp95 °C 3 min, 35× (95 °C 20 s, 48 °C 30 s, 63 °C 2 min), 72 °C 7 min[55]
Rrl9O.602 AGTGCAGCATTCGCTCCCCCT
ompB120-M59CCGCAGGGTTGGTAACTGC862 bp95 °C 3 min, 40× (95 °C 30 s, 50 °C 30 s, 68 °C 90 s), 68 °C 7 min[56]
120-807CCTTTTAGATTACCGCCTAA
Table 2. A summary of some previously published reports on Rickettsia raoultii in ticks, fleas, humans, vegetation, and animals in Palearctic and Oriental regions.
Table 2. A summary of some previously published reports on Rickettsia raoultii in ticks, fleas, humans, vegetation, and animals in Palearctic and Oriental regions.
Country/Year of StudyRickettsia raoultiiTick Species/SourceHosts/SourcesIdentification Method (Serologically/Molecularly)Genetic Marker (s)Reference
Morocco/2002–2006R. raoultiiDermacentor marginatusLivestock, dogs, and vegetationMolecularlygltA, ompA[60]
France/2002–2007R. raoultiiBloodHumansSerologically and molecularly (sequencing)ompA[35]
Dermacentor spp.
Spain/2003–2008R. raoultiiBody fluids and biopsiesHumansMolecularly (sequencing)gltA and ompB[61]
Japan/2004–2009R. raoultiiAmblyomma sparsumSnakes, tortoises, lizards, and frogs imported from ZambiaMolecularly and phylogeneticallygltA[62]
Slovakia/2004–2010R. raoultiiDe. marginatusVegetation, horses, sheep,Molecularly and phylogeneticallygltA, ompA and sca4[14]
Dermacentor reticulatusGoats, and dogs
Turkey/2006R. raoultiiHyalomma marginatumHumansMolecularly (sequencing)ompA[63]
De. marginatus
Portugal/2006–2009R. raoultiiDe. marginatusVegetationMolecularlygltA, ompA[64]
Taiwan/2006–2010R. raoultii–likeliver, spleen, and kidneyBandicota indicaMolecularly (sequencing)ompB and gltA[27]
Mus musculus
Hungary/2006–2010R. raoultiiDe. marginatusHumansMolecularly (sequencing)gltA, ompA, and16S rRNA[65]
De. reticulatus
SpainR. raoultiiDe. marginatusHumansMolecularlygltA, ompA[66]
Blood
Georgia/2008–2009R. raoultiiDe. marginatusLivestock, rodentsMolecularlyompB[67]
Malaysia/2008–2011R. raoultii–likekidney, liver, spleen and heartWild ratsMolecularly and phylogeneticallygltA[26]
Belarus/2009R. raoultiiIxodes ricinusCows and vegetationMolecularly and phylogeneticallyompA[68]
De. reticulatus
Thailand/2009R. raoultii–likeAmblyomma helvolumLizardMolecularly and phylogenetically16S rRNA, gltA, and ompA[69]
Korea/2010–2015R. raoultiiHaemaphysalis longicornisDogsMolecularly and phylogenetically16S rRNA[70]
Germany/2010–2011R. raoultiiDe. reticulatusMyodes glareolusMolecularlygltA[71]
Ix. ricinus
Fleas
Czech Republic/2010–2011R. raoultiiDe. reticulatusVegetationMolecularlygltA[72]
Romania/2011–2012R. raoultiiBloodHumansSerologically–[73]
Slovakia/2011–2020R. raoultiiBloodHumansSerologically–[74]
MolecularlygltA, 23S rRNA, and ompB
Hungary/2011–2012R. raoultiiDe. reticulatusVegetationMolecularlygltA[75]
China/2012R. raoultiiDermacentor silvarumHumansMolecularly and phylogeneticallygltA and ompA[76]
Blood
GermanyR. raoultiiBloodDogsSerologically [77]
MongoliaR. raoultiiDermacentor nuttalliVegetationMolecularly and phylogeneticallyompB, gltA[78]
Laos/2012–2014,R. raoultiiAmblyomma testudinarium Molecularly and phylogeneticallyompA, gltA, ompB, and 17–kDa[79]
Haemaphysalis
Spain/2012–2019R. raoultiiDe. reticulatusCantabrian brown bearMolecularly and phylogeneticallygltA, ompA[80]
Malaysia/2012–2013R. raoultii–likeHaemaphysalis bispinosaCattle, sheepMolecularly and phylogeneticallygltA, ompA and ompB[81]
Haemaphysalis spp. Chicken, Dogs
Rhipicephalus microplusCattle
Rhipicephalus sanguineusDogs
Malaysia/2013R. raoultii–likeBloodHumanMolecularlygltA, ompB[28]
Korea/2013–2017R. raoultiiIxodes nipponensisKorean water deerMolecularly and phylogenetically16S rRNA and gltA[82]
Ha. longicornis
Romania/2013–2014R. raoultiiDe. marginatusHumansMolecularly (sequencing)23S rRNA[83]
Romania/2013R. raoultiiDe. reticulatusDogsMolecularly (sequencing)ompB[84]
Poland/2013R. raoultiiIx. ricinusVegetationMolecularly and phylogeneticallyompA, 16S rRNA,[85]
De. reticulatus
Poland/2013–2014R. raoultiiDe. reticulatusDogs and catsMolecularlygltA[86]
Ukraine/2013–2014R. raoultiiDe. reticulatusVegetationMolecularlysca4,[87]
France/2014–2021R. raoultiiDe. marginatusHumansMolecularlygltA[88]
Greece/2014R. raoultiiDe. marginatusGoatsMolecularly and phylogeneticallyAtp, gltA, DnaA and DnaK[89]
China–Russian border/2014R. raoultiiIxodes persulcatusVegetationMolecularly (sequencing)gltA, ompA[17]
Algeria/2014R. raoultiiIx. ricinusCattleMolecularly [90]
Netherlands/2014R. raoultiiDe. reticulatusVegetationMolecularlygltA[91]
Mongolia/2015–2016R. raoultiiBloodHumanMolecularly and phylogenetically16S rRNA, gltA, and ompA[92]
Hyalomma asiaticumSheep, cattle, camels, dogs
De. nuttalli
SerbiaR. raoultiiDe. reticulatusDogsMolecularlyompA[93]
Austria/2015R. raoultiiDe. reticulatusVegetationMolecularlyompA, gltA[94]
China/2015–2016R. raoultiiSerum and bloodHumanSerologically and molecularlyrrs, gltA, ompA, ompB, and sca4[29]
Kazakhstan/2015R. raoultiiDe. marginatusVegetationMolecularly and phylogeneticallyompB, ompA, 23S–5S[95]
De. reticulatus
Hy. asiaticum
RussiaR. raoultiiDe. silvarumVegetationMolecularly and phylogenetically16S, ompA, ompB, sca4[96]
Haemaphysalis japonica
Haemaphysalis concinna
Russia (Siberia)/2016R. raoultiiBlood HumanMolecularly and phylogeneticallygltA[33]
Cerebrospinal fluid
Poland/2016–2018R. raoultiiDe. reticulatusVegetationMolecularly and phylogeneticallygltA[97]
Turkey/2016–2019R. raoultiiHyalomma aegyptiumTortoiseMolecularly (sequencing)gltA[98]
IndiaR. raoultii–likeHa. bispinosaGoatsMolecularly and phylogeneticallyhtrA, gltA[99]
Iran/2017–2018R. raoultiiHy. marginatumSheepMolecularly and phylogeneticallygltA[100]
China/2017R. raoultiiDe. marginatusHumansSerologically and molecularly (phylogenetically)17—kDa, gltA, sca1, sca4, ompA, and ompB[32]
Blood
Belgium/2017R. raoultiiDe. reticulatusHumansMolecularlygltA[101]
China–Kazakhstan border/2017R. raoultiiDe. nuttalliLong–tailed ground squirrelMolecularly and phylogenetically17–kDa, sca1, sca4, gltA, ompA and ompB[21]
De. silvarum
Denmark/2017R. raoultiiDe. reticulatusJackalMolecularly and phylogeneticallyompA, gltA, ompB[102]
Korea/2018R. raoultiiHa. longicornisHumanMolecularly and phylogeneticallyompA[22]
Pakistan/2018–2019R. raoultii–likeBloodDogsMolecularly and phylogeneticallygltA[30]
Iran/2018–2019R. raoultiiBloodDogsMolecularly and phylogeneticallygltA, ompA[30]
Turkey/2018–2020R. raoultiiCtenocephalides felisGoatsMolecularly and phylogeneticallygltA[25]
Germany/2018–2019R. raoultiiDe. reticulatusVegetationMolecularlyompB[103]
China/2018–2019R. raoultiiDe. marginatusRed foxesMolecularly and phylogenetically17–kDa, gltA, ompA, sca1[19]
heart, liver, spleen, lung and kidney
Ixodes canisugaMarbled polecat
Italy/2019R. raoultiiDe. marginatusWild boarsMolecularly and phylogeneticallyompA[104]
China/2019R. raoultiiBloodHumanMolecularly and phylogeneticallyompA and sca1[105]
RomaniaR. raoultiiDe. marginatusDogsMolecularly (sequencing)gltA, 17–kDa[106]
Ix. ricinus
Rhipicephalus rossicus
Haemaphysalis punctataVegetation
China/2019–2020R. raoultiiIx. persulcatusHumanMolecularly and phylogeneticallygltA and ompA[107]
De. silvarum
Ha. concinna
India/2020R. raoultiiHaemaphysalis intermediaCows, goats, and dogsMolecularly and phylogenetically16s rRNA, gltA, ompA, and ompB[108]
Poland/2021–2022R. raoultiiDe. reticulatusHumansMolecularly (sequencing)gltA and ompB[109]
China/2021–2022R. raoultiiDe. silvarumSheepMolecularly and phylogeneticallyrrs, gltA, ompA, and ompB[110]
Siberia/2022R. raoultiiDermacentor spp.VegetationMolecularly and phylogeneticallygltA, ompA, ompB, htrA, and 16S rRNA[111]
Table 3. Table showing the number of various inspected hosts in different localities, collected tick species and their life stages, and molecularly analyzed ticks for the detection of Rickettsia raoultii through gltA, ompA, and ompB fragments.
Table 3. Table showing the number of various inspected hosts in different localities, collected tick species and their life stages, and molecularly analyzed ticks for the detection of Rickettsia raoultii through gltA, ompA, and ompB fragments.
DistrictHostTick SpeciesNymph (%)Female (%)Male (%)Total (%)Subjected for Molecular Analysis (N, F)Detection of Rickettsia raoultii
TypeExaminedInfestedgltAompAompB
KohatCamels2014Hyalomma dromedarii7 (41.2)6 (35.3)4 (23.5)17 (3.0)2,2───
Hyalomma isaaci15 (45.5)12 (36.4)6 (18.2)33 (5.8)2,2───
Hyalomma turanicum20 (60.6)9 (27.3)4 (12.1)33 (5.8)2,21N, 1F1N, 1F1N, 1F
Sheep1912Hy. turanicum2 (33.3)2 (33.3)2 (33.3)6 (1.1)2,2───
Hy. isaaci2 (40.0)2 (40.0)1 (20.0)5 (0.9)2,2───
Hyalomma anatolicum3 (50.0)2 (33.3)1 (16.7)6 (1.1)2,2───
Goats1614Hy. isaaci3 (42.9)2 (28.6)2 (28.6)7 (1.2)2,2───
Rhipicephalus turanicus9 (60.0)4 (26.7)2 (13.3)15 (2.7)2,2───
Rhipicephalus microplus5 (41.7)4 (33.3)3 (25.0)12 (2.1)2,2───
Total5540 (72.7%) 66N43F25M134 (23.8%)18N, 18F1N, 1F
D.I KhanCamels1812Hy. dromedarii8 (44.4)6 (33.3)4 (22.2)18 (3.9)2,2───
Sheep169Hy. anatolicum11 (47.8)8 (34.8)4 (17.4)23 (4.1)2,2───
Hy. turanicum4 (44.4)3 (33.3)2 (22.2)9 (1.6)2,21N, 1F1N, 1F1N, 1F
Rh. turanicus12 (48.0)9 (36.0)4 (16.0)25 (4.4)2,2───
Rhipicephalus haemaphysaloides7 (46.7)5 (33.3)3 (20.0)15 (2.7)2,2───
Goats149Hy. anatolicum7 (53.8)4 (30.8)2 (15.4)13 (2.3)2,2───
Rh. turanicus14 (58.3)6 (25.0)4 (16.7)24 (4.2)2,2───
Rh. microplus4 (40.0)3 (30.0)3 (30.0)10 (1.8)2,2───
Total4830 (62.5%) 67N44F26M137 (24.3%)16N, 16F1N, 1F
Lower DirCamels2114Hy. dromedarii5 (50.0)3 (30.0)2 (20.0)10 (1.8)2,2───
Sheep158Haemaphysaliscornupunctata8 (57.1)4 (28.6)2 (14.3)14 (2.5)2,21N1N1N
Haemaphysalis sulcata20 (58.8)6 (17.6)8 (23.5)34 (6.0)2,2───
Rh. microplus5 (45.5)4 (36.4)2 (18.2)11 (1.9)2,2───
Goats136Ha. cornupunctata5 (55.6)2 (22.2)2 (22.2)9 (1.6)2,21N1N1N
Rh. haemaphysaloides8 (66.7)2 (16.7)2 (16.7)12 (2.1)2,2───
Total4928 (57.1%) 51N21F18M90 (16.0%)12N, 12F2N
BajaurCamels1711Hy. dromedarii7 (50.0)4 (28.6)3 (21.4)14 (2.5)2,2───
Sheep179Haemaphysalis bispinosa7 (46.7)5 (33.3)3 (20.0)15 (2.7)2,21N1N1N
Haemaphysalis sulcata10 (52.6)6 (31.6)3 (15.8)19 (3.4)2,2───
Ha. cornupunctata5 (38.5)5 (38.5)3 (23.1)13 (2.3)2,2───
Goats168Ha. bispinosa9 (60.0)4 (26.7)2 (13.3)15 (2.7)2,2───
Rh. microplus5 (41.7)4 (33.3)3 (25.0)12 (2.1)2,2───
Ha. cornupunctata8 (61.5)3 (23.1)2 (15.4)13 (2.3)2,2───
Total5028 (56.0%) 51N31F19M101 (17.9%)14N, 14F1N
MansehraCamels2313Hy. dromedarii6 (46.2)4 (30.8)2 (15.4)13 (2.3)2,2───
Sheep1810Rh. haemaphysaloides5 (50.0)3 (30.0)2 (20.0)10 (1.8)2,2───
Ha. bispinosa4 (50.0)2 (25.0)2 (25.0)8 (1.4)2,2───
Haemaphysalis montgomeryi15 (55.6)9 (33.3)3 (11.1)27 (4.8)2,21N1N1N
Goats1812Ha. sulcata8 (47.1)6 (35.3)3 (17.7)17 (3.0)2,2───
Rh. microplus5 (50.0)3 (30.0)2 (20.0)10 (1.8)2,2───
Ha. montgomeryi9 (52.9)5 (29.4)3 (17.7)17 (3.0)2,2───
Total5935 (59.3%) 52N32F18M102 (18.1%)14N, 14F1N
Overall total261161 (61.7%)287N (50.9%)171F (30.3%)106M(18.8%)56474N (25.8%), 74F (43.3%)6N (2.1%), 2F (3.5%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shehla, S.; Almutairi, M.M.; Alouffi, A.; Tanaka, T.; Chang, S.-C.; Chen, C.-C.; Ali, A. Molecular Survey of Rickettsia raoultii in Ticks Infesting Livestock from Pakistan with Notes on Pathogen Distribution in Palearctic and Oriental Regions. Vet. Sci. 2023, 10, 636. https://doi.org/10.3390/vetsci10110636

AMA Style

Shehla S, Almutairi MM, Alouffi A, Tanaka T, Chang S-C, Chen C-C, Ali A. Molecular Survey of Rickettsia raoultii in Ticks Infesting Livestock from Pakistan with Notes on Pathogen Distribution in Palearctic and Oriental Regions. Veterinary Sciences. 2023; 10(11):636. https://doi.org/10.3390/vetsci10110636

Chicago/Turabian Style

Shehla, Shehla, Mashal M. Almutairi, Abdulaziz Alouffi, Tetsuya Tanaka, Shun-Chung Chang, Chien-Chin Chen, and Abid Ali. 2023. "Molecular Survey of Rickettsia raoultii in Ticks Infesting Livestock from Pakistan with Notes on Pathogen Distribution in Palearctic and Oriental Regions" Veterinary Sciences 10, no. 11: 636. https://doi.org/10.3390/vetsci10110636

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop