Systemic Granulomatosis in the Meagre Argyrosomus regius: Fishing for a Plausible Etiology
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Gross Examination
2.2. Histopathology
2.3. Metagenomic Analysis
2.4. Microbiological Analysis and Nontuberculous Mycobacterial (NTM) Culture Screening
2.5. Molecular Identification of Mycobacterium spp.
2.5.1. DNA Extraction
2.5.2. Polymerase Chain Reaction (PCR)
2.5.3. Real-Time Quantitative PCR (qPCR)
2.6. In Situ Hybridization Assay
3. Results
3.1. Gross Examination
3.2. Histopathology
3.3. Metagenomic Analysis
3.4. Microbiological Analysis
3.5. Molecular Detection and Identification of Mycobacterium spp.
3.6. Association Between Histology and Mycobacteriun chelonae
3.7. In Situ Hybridization Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Monfort, M.C. Present Market Situation and Prospects of Meagre (Argyrosomus regius), as an Emerging Species in Mediterranean Aquaculture. In Studies and Reviews-General Fisheries Commission for the Mediterranean; Food and Agriculture Organization of the United Nations (FAO): Rome, Italy, 2002; ISBN 9789251066058. [Google Scholar]
- Duncan, N.J.; Estévez, A.; Fernández-Palacios, H.; Gairin, I.; Hernández-Cruz, C.M.; Roo, J.; Schuchardt, D.; Vallés, R. Aquaculture Production of Meagre (Argyrosomus regius): Hatchery Techniques, Ongrowing and Market. In Advances in Aquaculture Hatchery Technology; Elsevier: Amsterdam, The Netherlands, 2013; pp. 519–541. [Google Scholar]
- F.A.O. FishStatJ, a Tool for Fishery Statistics Analysis Release: 4.04.00. Available online: https://www.fao.org/fishery/en/statistics/software/fishstatj (accessed on 5 December 2023).
- Ghittino, C.; Manuali, E.; Latini, M.; Agnetti, F.; Rogato, F.; Agonigi, R.; Colussi, S.; Prearo, M. Caso Di Granulomatosi Sistemica in Ombrina Boccadoro (Argyrosomus regius) e Raffronto Con Le Lesioni Istologiche Presenti Nell’ Orata. Ittiopatologia 2004, 1, 59–67. [Google Scholar]
- Katharios, P.; Kokkari, K.; Papadaki, M.; Papandroulakis, N. Systemic Granulomas in Cultured Meagre, Argyrosomus regius. Aquac. Eur. 2011, 11, 537–538. [Google Scholar]
- Tsertou, M.I.; Smyrli, M.; Kokkari, C.; Antonopoulou, E.; Katharios, P. The Aetiology of Systemic Granulomatosis in Meagre (Argyrosomus regius): The “Nocardia” Hypothesis. In Aquaculture Reports; Elsevier BV: Amsterdam, The Netherlands, 2018; Volume 12, pp. 5–11. [Google Scholar]
- Gustinelli, A.; Čolak, S.; Quaglio, F.; Sirri, R.; Kolega, M.; Mejdandžić, D.; Caffara, M.; Baric, R.; Fioravanti, M. Histological Assessment of Systemic Granulomatosis Progression in Meagre Argyrosomus regius during Cage Ongrowing Phase. Dis. Aquat. Org. 2021, 145, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Rajme-Manzur, D.; Gollas-Galván, T.; Vargas-Albores, F.; Martínez-Porchas, M.; Hernández-Oñate, M.Á.; Hernández-López, J. Granulomatous Bacterial Diseases in Fish: An Overview of the Host’s Immune Response. In Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology; Elsevier BV: Amsterdam, The Netherlands, 2021; Volume 261, p. 111058. [Google Scholar]
- Pavloudi, C.; Tsertou, M.I.; Antonopoulou, E.; Katharios, P. Investigation of Systemic Granulomatosis in Cultured Meagre, Argyrosomus regius, Using Clinical Metagenomics. In Aquaculture; Elsevier BV: Amsterdam, The Netherlands, 2023; Volume 567, p. 739249. [Google Scholar]
- Avsever, M.L.; Günen, M.Z.; Eskiizmirliler, S.; Didinen, B.I.; Erdal, G.; Özden, M. The First Report of Mycobacterium Marinum Isolated from Cultured Meagre, Argyrosomus regius. Bull. Eur. Ass. Fish. Pathol. 2014, 34, 343–354. [Google Scholar]
- Timur, G.; Ürkü, Ç.; Çanak, Ö.; Erköse Genç, G.; Erturan, Z. Systemic Mycobacteriosis Caused by Mycobacterium Marinum in Farmed Meagre (Argyrosomus regius), in Turkey. Isr. J. Aquac. Bamidgeh 2015, 67, 1–8. [Google Scholar] [CrossRef]
- Ruiz, M.A.; Betancor, M.B.; Robaina, L.; Montero, D.; Hernández-Cruz, C.M.; Izquierdo, M.S.; Rosenlund, G.; Fontanillas, R.; Caballero, M.J. Dietary Combination of Vitamin E, C and K Affects Growth, Antioxidant Activity, and the Incidence of Systemic Granulomatosis in Meagre (Argyrosomus regius). Aquaculture 2019, 498, 606–620. [Google Scholar] [CrossRef]
- Ruiz García, M.Á.; Hernández-Cruz, C.M.; Caballero, M.J.; Fernández-Palacios, H.; Saleh, R.; Izquierdo, M.; Betancor Quintana, M.B. Incidence of Systemic Granulomatosis Is Modulated by the Feeding Sequence and Type of Enrichment in Meagre (Argyrosomus regius) Larvae. Aquac. Res. 2019, 50, 284–295. [Google Scholar] [CrossRef]
- Pfalzgraff, T.; Borges, P.; Robaina, L.; Kaushik, S.; Izquierdo, M. Essential Fatty Acid Requirement of Juvenile Meagre (Argyrosomus regius). In Aquaculture; Elsevier BV: Amsterdam, The Netherlands, 2023; Volume 572, p. 739532. [Google Scholar]
- Ruiz, M.Á.; Betancor, M.B.; Montero, D.; Caballero, M.J.; Hernández-Cruz, C.M.; Rosenlund, G.; Fontanillas, R.; Izquierdo, M.S. The Effect of Fish Stocking Density and Dietary Supplementation of Vitamin C and Micronutrients (Mn, Zn and Se) on the Development of Systemic Granulomatosis in Juvenile Meagre (Argyrosomus regius). Aquac. Res. 2021, 52, 5703–5718. [Google Scholar] [CrossRef]
- Costa, J.Z.; McCarthy, Ú.; Perez, O. Occurrence of Photobacterium damselae subsp. piscicida in Sea-Cage Farmed Meagre (Argyrosomus regius) in Tenerife, Canary Islands, Spain. Thalassas 2017, 33, 65–71. [Google Scholar]
- Labella, A.; Berbel, C.; Manchado, M.; Castro, D.; Borrego, J.J. Photobacterium damselae subsp. damselae, an Emerging Pathogen Affecting New Cultured Marine Fish Species in Southern Spain. Recent Adv. Fish Farms 2011, 9, 135–152. [Google Scholar]
- Elkesh, A.; Kantham, K.P.L.; Shinn, A.P.; Crumlish, M.; Richards, R.H. Systemic Nocardiosis in a Mediterranean Population of Cultured Meagre, Argyrosomus regius Asso (Perciformes: Sciaenidae). J. Fish Dis. 2013, 36, 141–149. [Google Scholar] [CrossRef] [PubMed]
- Acosta, F.; Vega, B.; Monzón-Atienza, L.; Superio, J.; Torrecillas, S.; Gómez-Mercader, A.; Castro, P.; Montero, D.; Galindo-Villegas, J. Phylogenetic Reconstruction, Histopathological Characterization, and Virulence Determination of a Novel Fish Pathogen, Nocardia brasiliensis. Aquaculture 2024, 581, 740458. [Google Scholar] [CrossRef]
- Antuofermo, E.; Pais, A.; Polinas, M.; Cubeddu, T.; Righetti, M.; Sanna, M.A.; Prearo, M. Mycobacteriosis Caused by Mycobacterium marinum in Reared Mullets: First Evidence from Sardinia (Italy). J. Fish Dis. 2017, 40, 327–337. [Google Scholar] [CrossRef] [PubMed]
- Mugetti, D.; Varello, K.; Gustinelli, A.; Pastorino, P.; Menconi, V.; Florio, D.; Fioravanti, M.L.; Bozzetta, E.; Zoppi, S.; Dondo, A.; et al. Mycobacterium pseudoshottsii in Mediterranean Fish Farms: New Trouble for European Aquaculture? Pathogens 2020, 9, 610. [Google Scholar] [CrossRef]
- Carella, F.; Aceto, S.; Pollaro, F. A Mycobacterial Disease Is Associated with the Silent Mass Mortality of the Pen Shell Pinna nobilis along the Tyrrhenian Coastline of Italy. Sci. Rep. 2019, 9, 2725. [Google Scholar] [CrossRef] [PubMed]
- Cascarano, M.C.; Stavrakidis-Zachou, O.; Mladineo, I.; Thompson, K.D.; Papandroulakis, N.; Katharios, P. Mediterranean Aquaculture in a Changing Climate: Temperature Effects on Pathogens and Diseases of Three Farmed Fish Species. Pathogens 2021, 10, 1205. [Google Scholar] [CrossRef]
- Falkinham, J.O. Nontuberculous Mycobacteria in the Environment. Tuberculosis 2022, 137, 28–31. [Google Scholar] [CrossRef]
- Delghandi, M.R.; El-Matbouli, M.; Menanteau-Ledouble, S. Mycobacteriosis and Infections with Non-Tuberculous Mycobacteria in Aquatic Organisms: A Review. Microorganisms 2020, 8, 1368. [Google Scholar] [CrossRef]
- Stathopoulou, P.; Asimakis, E.; Petropoulos, Y.; Apostolopoulou, G.; Tsiamis, G. Genomic Insights into the Fish-Pathogenic Mycobacterium pseudoshottsii Strain AR Recovered from Meagre (Argyrosomus regius). Microbiol. Resour. Announc. 2020, 9. [Google Scholar] [CrossRef]
- Decostere, A.; Hermans, K.; Haesebrouck, F. Piscine Mycobacteriosis: A Literature Review Covering the Agent and the Disease It Causes in Fish and Humans. Vet. Microbiol. 2004, 99, 159–166. [Google Scholar] [CrossRef]
- Francis-Floyd, R. Mycobacterial Infections of Fish; SRAC: Stoneville, MS, USA, 2011. [Google Scholar]
- Bruno, D.W.; Griffiths, J.; Mitchell, C.G.; Wood, B.P.; Fletcher, Z.J.; Drobniewski, F.A.; Hastings, T.S. Pathology Attributed to Mycobacterium chelonae Infection among Farmed and Laboratory-Infected Atlantic Salmon Salmo salar. Dis. Aquat. Org. 1998, 33, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.T.; Marancik, D.; Ware, C.; Griffin, M.J.; Soto, E. Mycobacterium salmoniphilum and M. chelonae in Captive Populations of Chinook Salmon. J. Aquat. Anim. Health 2021, 33, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Antuofermo, E.; Pais, A.; Nuvoli, S. Mycobacterium chelonae Associated with Tumor-like Skin and Oral Masses in Farmed Russian Sturgeons (Acipenser gueldenstaedtii). BMC Vet. Res. 2014, 10, 18. [Google Scholar] [CrossRef]
- Varello, K.; Prearo, M.; Serracca, L.; Meloni, D.; Rossini, I.; Righetti, M.; Pezzolato, M.; Fioravanti, M.L.; Ercolini, C.; Bozzetta, E. Granulomatous Lesions in a Wild Mullet Population from the Eastern Ligurian Sea (Italy): Mycobacteriosis vs. Pseudotuberculosis. J. Fish Dis. 2014, 37, 553–558. [Google Scholar] [CrossRef] [PubMed]
- Zanoni, R.G.; Florio, D.; Fioravanti, M.L.; Rossi, M.; Prearo, M. Occurrence of Mycobacterium Spp. in Ornamental Fish in Italy. J. Fish Dis. 2008, 31, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Cribier, B.; Aubry, A.; Caumes, E.; Cambau, E.; Jarlier, V.; Chosidow, O. Aspects Histopathologiques de l’infection Mycobacterium marinum. Ann. Dermatol. Venereol. 2011, 138, 17–22. [Google Scholar] [CrossRef]
- Crothers, J.W.; Laga, A.C.; Solomon, I.H. Clinical Performance of Mycobacterial Immunohistochemistry in Anatomic Pathology Specimens: The Beginning of the End for Ziehl-Neelsen? Am. J. Clin. Pathol. 2021, 155, 97–105. [Google Scholar] [CrossRef]
- Jensen, E. Technical Review: In Situ Hybridization. Anat. Rec. 2014, 297, 1349–1353. [Google Scholar] [CrossRef]
- Adams, A.; Thompson, K.D. Development of Diagnostics for Aquaculture: Challenges and Opportunities. In Aquaculture Research; Hindawi Limited: Stirling, UK, 2011; Volume 42, pp. 93–102. [Google Scholar]
- Fritsvold, C.; Mikalsen, A.B.; Haugland, Ø.; Tartor, H.; Sindre, H. Characterization of Early Phases of Cardiomyopathy Syndrome Pathogenesis in Atlantic Salmon (Salmo salar L.) through Various Diagnostic Methods. J. Fish Dis. 2022, 45, 1267–1279. [Google Scholar] [CrossRef]
- Gupta, E.; Bhalla, P.; Khurana, N.; Singh, T. Histopathology for the Diagnosis of Infectious Diseases. Indian J. Med. Microbiol. 2009, 27, 100–106. [Google Scholar] [CrossRef]
- Takahashi, S.; Tomita, J.; Nishioka, K.; Hisada, T.; Nishijima, M. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 2014, 9, 105592. [Google Scholar] [CrossRef] [PubMed]
- Banchi, P.; Colitti, B.; Del Carro, A.; Corrò, M.; Bertero, A.; Ala, U.; Del Carro, A.; Van Soom, A.; Bertolotti, L.; Rota, A. Challenging the Hypothesis of in Utero Microbiota Acquisition in Healthy Canine and Feline Pregnancies at Term: Preliminary Data. Vet. Sci. 2023, 10, 331. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, Interactive, Scalable and Extensible Microbiome Data Science Using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Tomasoni, M.; Esposito, G.; Mugetti, D.; Pastorino, P.; Stoppani, N.; Menconi, V.; Gagliardi, F.; Corrias, I.; Pira, A.; Acutis, P.L.; et al. The Isolation of Vibrio crassostreae and V. cyclitrophicus in Lesser-Spotted Dogfish (Scyliorhinus canicula) Juveniles Reared in a Public Aquarium. J. Mar. Sci. Eng. 2022, 10, 114. [Google Scholar] [CrossRef]
- Sun, J.R.; Hsieh, S.S.; Lee, S.Y.; Lu, J.J. Evaluation of Cord Formation in Kinyoun-Stained Smears of Mgit Cultures as a Rapid Identification Method for Mycobacterium tuberculosis complex. J. Rapid Methods Autom. Microbiol. 2009, 17, 339–349. [Google Scholar] [CrossRef]
- Telenti, A.; Marchesi, F.; Balz, M.; Bally, F.; Böttger, E.C.; Bodmer, T. Rapid Identification of Mycobacteria to the Species Level by Polymerase Chain Reaction and Restriction Enzyme Analysis. J. Clin. Microbiol. 1993, 31, 175–178. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Radomski, N.; Roguet, A.; Lucas, F.S.; Veyrier, F.J.; Cambau, E.; Accrombessi, H.; Moilleron, R.; Behr, M.A.; Moulin, L. AtpE Gene as a New Useful Specific Molecular Target to Quantify Mycobacterium in Environmental Samples. BMC Microbiol. 2013, 13, 227. [Google Scholar] [CrossRef]
- Nargan, K.; Glasgow, J.N.; Nadeem, S.; Naidoo, T.; Wells, G.; Hunter, R.L.; Hutton, A.; Lumamba, K.; Msimang, M.; Benson, P.V.; et al. Spatial Distribution of Mycobacterium Tuberculosis MRNA and Secreted Antigens in Acid-Fast Negative Human Antemortem and Resected Tissue. EBioMedicine 2024, 105, 105196. [Google Scholar] [CrossRef]
- Roberts, R.J. Fish Pathology; John Wiley & Sons: Hoboken, NJ, USA, 2012. [Google Scholar]
- Noga, E.J. Fish Diseases: Diagnosis and Treatment, 2nd ed.; Wiley: Hoboken, NJ, USA, 2010; ISBN 9781118786758. [Google Scholar]
- Austin, B.; Austin, D.A. Bacterial Fish Pathogens, 2016th ed.; Springer: Chichester, UK, 2016; Volume 27, ISBN 9783110377408. [Google Scholar]
- Aubry, M.-C. Necrotizing Granulomatous Inflammation: What Does It Mean If Your Special Stains Are Negative? In Modern Pathology; Elsevier BV: Amsterdam, The Netherlands, 2012; Volume 25, pp. 31–38. [Google Scholar]
- Gauthier, D.T.; Rhodes, M.W. Mycobacteriosis in Fishes: A Review. Vet. J. 2009, 180, 33–47. [Google Scholar] [CrossRef]
- Maboni, G.; Prakash, N.; Moreira, M.A.S. Review of Methods for Detection and Characterization of Non-Tuberculous Mycobacteria in Aquatic Organisms. J. Vet. Diagn. Investig. 2024, 36, 299–311. [Google Scholar] [CrossRef] [PubMed]
- Forbes, B.A.; Hall, G.S.; Miller, M.B.; Novak, S.M.; Rowlinson, M.C.; Salfinger, M.; Somoskövi, A.; Warshauer, D.M.; Wilson, M.L. Practice Guidelines for Clinical Microbiology Laboratories: Mycobacteria. Clin. Microbiol. Rev. 2018, 31, 2. [Google Scholar] [CrossRef] [PubMed]
- Colorni, A.; Avtalion, R.; Knibb, W.; Berger, E.; Colorni, B.; Timan, B. Histopathology of Sea Bass (Dicentrarchus Labrax) Experimentally Infected with Mycobacterium marinum and Treated with Streptomycin and Garlic (Allium sativum) Extract. Aquaculture 1998, 160, 1–17. [Google Scholar] [CrossRef]
- Watral, V.; Kent, M.L. Pathogenesis of Mycobacterium spp. in Zebrafish (Danio rerio) from Research Facilities. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2006, 145, 55–60. [Google Scholar] [CrossRef]
- van Ingen, J. Diagnosis of Nontuberculous Mycobacterial Infections. Semin. Respir. Crit. Care Med. 2013, 34, 103–109. [Google Scholar] [CrossRef]
- McNabb, A.; Eisler, D.; Adie, K.; Amos, M.; Rodrigues, M.; Stephens, G.; Black, W.A.; Isaac-Renton, J. Assessment of Partial Sequencing of the 65-Kilodalton Heat Shock Protein Gene (Hsp65) for Routine Identification of Mycobacterium Species Isolated from Clinical Sources. J. Clin. Microbiol. 2004, 42, 3000–3011. [Google Scholar] [CrossRef]
- Meritet, D.M.; Mulrooney, D.M.; Kent, M.L.; Löhr, C.V. Development of Quantitative Real-Time PCR Assays for Postmortem Detection of Myobacterium Spp. Common in Zebrafish (Danio rerio). J. Am. Assoc. Lab. Anim. Sci. 2017, 56, 131–141. [Google Scholar]
- Beran, V.; Matlova, L.; Dvorska, L.; Svastova, P.; Pavlik, I. Distribution of Mycobacteria in Clinically Healthy Ornamental Fish and Their Aquarium Environment. J. Fish Dis. 2006, 29, 383–393. [Google Scholar] [CrossRef] [PubMed]
- Volpe, E.; Mandrioli, L.; Errani, F.; Serratore, P.; Zavatta, E.; Rigillo, A.; Ciulli, S. Evidence of Fish and Human Pathogens Associated with Doctor Fish (Garra rufa, Heckel, 1843) Used for Cosmetic Treatment. J. Fish Dis. 2019, 42, 1637–1644. [Google Scholar] [CrossRef]
- Mandrioli, L.; Codotto, V.; D’Annunzio, G.; Volpe, E.; Errani, F.; Eishi, Y.; Uchida, K.; Morini, M.; Sarli, G.; Ciulli, S. Pathological and Tissue-Based Molecular Investigation of Granulomas in Cichlids Reared as Ornamental Fish. Animals 2022, 26, 1366. [Google Scholar] [CrossRef]
- Knibb, W.; Colorni, A.; Zlotkin, A.; Diamant, A. Detection and Identification of Mycobacterium marinum in Fish Using Polymerase Chain Reaction Technique 1992. Mol. Mar. Biol. Biotechnol. 1993, 2, 225–232. [Google Scholar] [PubMed]
- Kaattari, I.; Rhodes, M.; Kator, H.; Kaattari, S. Comparative Analysis of Mycobacterial Infections in Wild Striped Bass Morone saxatilis from Chesapeake Bay. In Diseases of Aquatic Organisms; Inter-Research Science Center: Oldendorf, Germany, 2005; Volume 67, pp. 125–132. [Google Scholar]
- Pourahmad, F.; Nemati, M.; Richards, R.H. Comparison of Three Methods for Detection of Mycobacterium marinum in Goldfish (Carassius auratus). Aquaculture 2014, 422–423, 42–46. [Google Scholar] [CrossRef]
Gene Name | Primer Name | Sequence (5′-3′) | Reference | |
---|---|---|---|---|
Metagenomic | 16S rRNA | Pro341F | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNBGCASCAG | [40] |
Pro805R | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACNVGGGTATCTAATCC | |||
PCR | Hsp65 | Tb11 | ACCAACGATGGTGTGTCCAT | [45] |
Tb12 | CTTGTCGAACCGCATACCCT | |||
qPCR | atpE | FatpE | CGGYGCCGGTATCGGYGA | [47] |
RatpE | CGAAGACGAACARSGCCAT | |||
probe PatpE | ACSGTGATGAAGAACGGBGTRAA |
Meagres Id | Liver Granulomas | PCR hsp65 (FFPE *) | PCR hsp65 (FrFr *) | Sequencing |
---|---|---|---|---|
1 | Yes | − | − | |
2 | Yes | + | + | Mycobacterium chelonae |
3 | Yes | + | − | Propionibacterium |
4 | Yes | + | + | Corynebacterium |
5 | Yes | − | − | |
6 | No | − | − | |
7 | No | − | − | |
8 | No | − | − | |
9 | No | − | − | |
10 | No | − | − | |
11 | Yes | − | − | |
12 | Yes | − | − | |
13 | No | + | + | M. chelonae |
14 | Yes | + | + | Propionibacterium |
15 | Yes | − | − | |
16 | No | − | − | |
17 | Yes | + | − | M. chelonae |
18 | Yes | − | − | |
19 | Yes | + | + | M. chelonae |
20 | Yes | − | + | M. chelonae |
21 | No | − | − | |
22 | No | − | − | |
23 | Yes | − | − | |
24 | No | − | − | |
25 | Yes | − | − | |
26 | No | − | − | |
27 | Yes | − | − | |
28 | No | − | − | |
29 | No | − | − | |
30 | No | − | − | |
31 | Yes | − | − | |
32 | No | − | − | |
33 | No | − | − | |
34 | No | − | − |
Analysis | Results | Meagre |
---|---|---|
Histopathology | Presence of granuloma | 31/34 |
Histochemistry | Ziehl–Neelsen; positivity in granulomas | 0/34 |
Microbiology | Bacteria and mycobacteria isolation | 0/33 |
qPCR in kidney | atpE qPCR + | 0/30 |
PCR FrFr livers | Hsp65 PCR + | 7/34 |
M. chelonae | 4/7 | |
PCR FFPE livers | Hsp65 PCR + | 6/34 |
M. chelonae | 4/6 | |
ISH | M. chelonae + | 0/30 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Murgia, C.; Cubeddu, T.; Burrai, G.P.; Alberti, A.; Bertolotti, L.; Colitti, B.; Prearo, M.; Pastorino, P.; Esposito, G.; Mandrioli, L.; et al. Systemic Granulomatosis in the Meagre Argyrosomus regius: Fishing for a Plausible Etiology. Vet. Sci. 2024, 11, 597. https://doi.org/10.3390/vetsci11120597
Murgia C, Cubeddu T, Burrai GP, Alberti A, Bertolotti L, Colitti B, Prearo M, Pastorino P, Esposito G, Mandrioli L, et al. Systemic Granulomatosis in the Meagre Argyrosomus regius: Fishing for a Plausible Etiology. Veterinary Sciences. 2024; 11(12):597. https://doi.org/10.3390/vetsci11120597
Chicago/Turabian StyleMurgia, Claudio, Tiziana Cubeddu, Giovanni P. Burrai, Alberto Alberti, Luigi Bertolotti, Barbara Colitti, Marino Prearo, Paolo Pastorino, Giuseppe Esposito, Luciana Mandrioli, and et al. 2024. "Systemic Granulomatosis in the Meagre Argyrosomus regius: Fishing for a Plausible Etiology" Veterinary Sciences 11, no. 12: 597. https://doi.org/10.3390/vetsci11120597
APA StyleMurgia, C., Cubeddu, T., Burrai, G. P., Alberti, A., Bertolotti, L., Colitti, B., Prearo, M., Pastorino, P., Esposito, G., Mandrioli, L., Barbera, G., Sanna, M. A., Polinas, M., Soto, E., & Antuofermo, E. (2024). Systemic Granulomatosis in the Meagre Argyrosomus regius: Fishing for a Plausible Etiology. Veterinary Sciences, 11(12), 597. https://doi.org/10.3390/vetsci11120597