Epidemiological Survey of Four Reproductive Disorder Associated Viruses of Sows in Hunan Province during 2019–2021
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Pre-Treatment
2.2. Nucleic Acid Extraction and Pathogen Detection
2.3. Cloning and Sequencing
2.4. Bioinformatics Analysis
3. Results
3.1. The Epidemiology of These Four Pathogens in Clinical Samples
3.2. Phylogenetic Analysis of PRRSV Strains
3.3. Phylogenetic Analysis of PCV2 Strains
3.4. Phylogenetic Analysis of CSFV Strains
3.5. Phylogenetic Analysis of PRV Strains
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dai, G.; Huang, M.; Fung, T.S.; Liu, D.X. Research progress in the development of porcine reproductive and respiratory syndrome virus as a viral vector for foreign gene expression and delivery. Expert Rev. Vaccines 2020, 19, 1041–1051. [Google Scholar] [CrossRef]
- Ouyang, T.; Zhang, X.; Liu, X.; Ren, L. Co-infection of swine with porcine circovirus type 2 and other swine viruses. Viruses 2019, 11, 185. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.; Yao, J.; Yang, Y.; Luo, W.; Yuan, X.; Yang, L.; Wang, A. Current status and challenge of pseudorabies virus infection in China. Virol. Sin. 2021, 36, 588–607. [Google Scholar] [CrossRef] [PubMed]
- Moennig, V.; Floegel-Niesmann, G.; Greiser-Wilke, I. Clinical signs and epidemiology of classical swine fever: A review of new knowledge. Vet. J. 2003, 165, 11–20. [Google Scholar] [CrossRef]
- Chen, N.; Ye, M.; Li, S.; Huang, Y.; Zhou, R.; Yu, X.; Tian, K.; Zhu, J. Emergence of a novel highly pathogenic recombinant virus from three lineages of porcine reproductive and respiratory syndrome virus 2 in China 2017. Transbound. Emerg. Dis. 2018, 65, 1775–1785. [Google Scholar] [CrossRef] [PubMed]
- Fang, K.; Liu, S.; Li, X.; Chen, H.; Qian, P. Epidemiological and genetic characteristics of porcine reproductive and respiratory syndrome virus in south China between 2017 and 2021. Front. Vet. Sci. 2022, 9, 853044. [Google Scholar] [CrossRef]
- Franzo, G.; Segalés, J. Porcine circovirus 2 genotypes, immunity and vaccines: Multiple genotypes but one single serotype. Pathogens 2020, 9, 1049. [Google Scholar] [CrossRef]
- Chen, N.; Huang, Y.; Ye, M.; Li, S.; Xiao, Y.; Cui, B.; Zhu, J. Co-infection status of classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circoviruses (PCV2 and PCV3) in eight regions of China from 2016 to 2018. Infect. Genet. Evol. 2019, 68, 127–135. [Google Scholar] [CrossRef]
- Hao, G.; Zhang, H.; Chen, H.; Qian, P.; Li, X. Comparison of the pathogenicity of classical swine fever virus subgenotype 2.1c and 2.1d strains from China. Pathogens 2020, 9, 821. [Google Scholar] [CrossRef]
- Liu, Q.; Wang, X.; Xie, C.; Ding, S.; Yang, H.; Guo, S.; Li, J.; Qin, L.; Ban, F.; Wang, D.; et al. A novel human acute encephalitis caused by pseudorabies virus variant strain. Clin. Infect. Dis. 2021, 73, e3690–e3700. [Google Scholar] [CrossRef]
- Zhao, D.; Yang, B.; Yuan, X.; Shen, C.; Zhang, D.; Shi, X.; Zhang, T.; Cui, H.; Yang, J.; Chen, X.; et al. Advanced research in porcine reproductive and respiratory syndrome virus co-infection with other pathogens in swine. Front. Vet. Sci. 2021, 8, 699561. [Google Scholar] [CrossRef] [PubMed]
- Saade, G.; Deblanc, C.; Bougon, J.; Marois-Créhan, C.; Fablet, C.; Auray, G.; Belloc, C.; Leblanc-Maridor, M.; Gagnon, C.A.; Zhu, J.; et al. Coinfections and their molecular consequences in the porcine respiratory tract. Vet. Res. 2020, 51, 80. [Google Scholar] [CrossRef] [PubMed]
- Opriessnig, T.; Gauger, P.C.; Faaberg, K.S.; Shen, H.; Beach, N.M.; Meng, X.J.; Wang, C.; Halbur, P.G. Effect of porcine circovirus type 2a or 2b on infection kinetics and pathogenicity of two genetically divergent strains of porcine reproductive and respiratory syndrome virus in the conventional pig model. Vet. Microbiol. 2012, 158, 69–81. [Google Scholar] [CrossRef]
- Genzow, M.; Schwartz, K.; Gonzalez, G.; Anderson, G.; Chittick, W. The effect of vaccination against Porcine reproductive and respiratory syndrome virus (PRRSV) on the Porcine circovirus-2 (PCV-2) load in porcine circovirus associated disease (PCVAD) affected pigs. Can. J. Vet. Res. 2009, 73, 87–90. [Google Scholar] [PubMed]
- Zeng, Z.; Liu, Z.; Wang, W.; Tang, D.; Liang, H.; Liu, Z. Establishment and application of a multiplex PCR for rapid and simultaneous detection of six viruses in swine. J. Virol. Methods 2014, 208, 102–106. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Chang, X.; Zhou, J.; Wang, D.; Zhou, J.; Fan, B.; Ni, Y.; Yin, J.; Lv, L.; Zhao, Y.; et al. Co-infection analysis of bacterial and viral respiratory pathogens from clinically healthy swine in Eastern China. Vet. Med. Sci. 2021, 7, 1815–1819. [Google Scholar] [CrossRef]
- Zhao, P.; Yu, L.; Liu, Y.; Zhang, L.; Liang, P.; Wang, L.; Jing, H.; Huang, L.; Song, C.; Dong, J. Genetic variation analysis of Type 2 porcine reproductive and respiratory syndrome virus in Guangdong Province from 2016 to 2018. Acta Virol. 2021, 65, 221–231. [Google Scholar] [CrossRef]
- Yin, B.; Qi, S.; Sha, W.; Qin, H.; Liu, L.; Yun, J.; Zhu, J.; Li, G.; Sun, D. Molecular characterization of the Nsp2 and ORF5 (ORF5a) genes of PRRSV strains in nine provinces of China during 2016–2018. Front. Vet. Sci. 2021, 8, 605832. [Google Scholar] [CrossRef]
- Liu, P.; Bai, Y.; Jiang, X.; Zhou, L.; Yuan, S.; Yao, H.; Yang, H.; Sun, Z. High reversion potential of a cell-adapted vaccine candidate against highly pathogenic porcine reproductive and respiratory syndrome. Vet. Microbiol. 2018, 227, 133–142. [Google Scholar] [CrossRef]
- Jiang, Y.F.; Xia, T.Q.; Zhou, Y.J.; Yu, L.X.; Yang, S.; Huang, Q.F.; Li, L.W.; Gao, F.; Qu, Z.H.; Tong, W.; et al. Characterization of three porcine reproductive and respiratory syndrome virus isolates from a single swine farm bearing strong homology to a vaccine strain. Vet. Microbiol. 2015, 179, 242–249. [Google Scholar] [CrossRef]
- Yu, Y.; Zhang, Q.; Cao, Z.; Tang, Y.D.; Xia, D.; Wang, G.; Shan, H. Recent advances in porcine reproductive and respiratory syndrome virus NADC30-like research in China: Molecular characterization, pathogenicity, and control. Front. Microbiol. 2022, 12, 791313. [Google Scholar] [CrossRef] [PubMed]
- Qu, T.; Li, R.; Yan, M.; Luo, B.; Yang, T.; Yu, X. High prevalence of PCV2d in Hunan province, China: A retrospective analysis of samples collected from 2006 to 2016. Arch. Virol. 2018, 163, 1897–1906. [Google Scholar] [CrossRef] [PubMed]
- Xing, C.; Lu, Z.; Jiang, J.; Huang, L.; Xu, J.; He, D.; Wei, Z.; Huang, H.; Zhang, H.; Murong, C.; et al. Sub-subgenotype 2.1c isolates of classical swine fever virus are dominant in Guangdong province of China, 2018. Infect. Genet. Evol. 2019, 68, 212–217. [Google Scholar] [CrossRef] [PubMed]
- Yan, W.; Hu, Z.; Zhang, Y.; Wu, X.; Zhang, H. Case report: Metagenomic next-generation sequencing for diagnosis of human encephalitis and endophthalmitis caused by pseudorabies virus. Front. Med. 2022, 8, 753988. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5′-3′) | Binding Position | Length | Purpose | Reference Sequence |
---|---|---|---|---|---|
PRRSV-ORF5-F | CAACCGTTTTAGCCTGTCTT | 13734–13753 | 709 bp | Detection of PRRSV and Sequencing | PRU87392 |
PRRSV-ORF5-R | CAAAACGCCAAAAGCACC | 14425–14442 | |||
PCV2-OFR2-F | CCATGCCCTGAATTTCCATATGAAAT | 960–985 | 850 bp | Detection of PCV2 and Sequencing | MH191375 |
PCV2-OFR2-R | TGAGGTGCTGCCCAGGTGCT | 23–42 | |||
CSFV-NS5B-F | CCTTAACCATGCACATGTCAG | 11049–11069 | 574 bp | Detection of CSFV | FJ529205 |
CSFV-NS5B-R | TCAGTTGACAACACCAATAAG | 11602–11622 | |||
CSFV-E2-F | GTAAATATGTGTGTGTTAGACCAGA | 2211–2235 | 1402 bp | Sequencing | FJ529205 |
CSFV-E2-F | GTGTGGGTAATTGAGTTCCCTATCA | 3588–3612 | |||
PRV-dgE-F | CCGAGTACGTCACGGTCATC | 126232–126251 | 555 bp | Detection of PRV | KP257591 |
PRV-dgE-R | CTTCCGGTTTCTCCGGATCG | 126767–126766 | |||
PRV-gE-F | ATGCGGCCCTTTCTGCTGCGC | 125108–125128 | 1740 bp | Sequencing | KP257591 |
PRV-gE-R | TTAAGCGGGGCGGGACATCAAC | 126826–126847 |
Infection Categories | Virus | Infection Status in Surveyed Pig Farms (n = 89) | Infection Status in Collected Pig Samples (n = 407) | |||
---|---|---|---|---|---|---|
Positive Farms | Percentage (%) | Positive Samples | Percentage (%) | Subtotal (%) | ||
Single infection | PRRSV | 20 | 22.47 | 43 | 10.57 | 33.17 |
PCV2 | 34 | 38.20 | 67 | 16.46 | ||
CSFV | 13 | 14.61 | 20 | 4.91 | ||
PRV | 2 | 2.25 | 5 | 1.23 | ||
Dual infection | PRRSV + PCV2 | 14 | 15.73 | 37 | 9.09 | 21.13 |
PRRSV + CSFV | 4 | 4.49 | 13 | 3.19 | ||
PRRSV + PRV | 5 | 5.62 | 12 | 2.95 | ||
PCV2 + CSFV | 6 | 6.74 | 15 | 3.69 | ||
PCV2 + PRV | 4 | 4.49 | 9 | 2.21 | ||
Triple infection | PRRSV + PCV2 + CSFV | 1 | 1.12 | 2 | 0.49 | 0.49 |
Total | PRRSV | - | - | 107 | 26.29 | 54.79 |
PCV2 | - | - | 130 | 31.94 | ||
CSFV | - | - | 50 | 12.29 | ||
PRV | - | - | 26 | 6.39 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, Q.; Ge, L.; Tan, S.; Zhang, H.; Yang, Y.; Zhang, L.; Deng, Z. Epidemiological Survey of Four Reproductive Disorder Associated Viruses of Sows in Hunan Province during 2019–2021. Vet. Sci. 2022, 9, 425. https://doi.org/10.3390/vetsci9080425
Tang Q, Ge L, Tan S, Zhang H, Yang Y, Zhang L, Deng Z. Epidemiological Survey of Four Reproductive Disorder Associated Viruses of Sows in Hunan Province during 2019–2021. Veterinary Sciences. 2022; 9(8):425. https://doi.org/10.3390/vetsci9080425
Chicago/Turabian StyleTang, Qiwu, Lingrui Ge, Shengguo Tan, Hai Zhang, Yu Yang, Lei Zhang, and Zaofu Deng. 2022. "Epidemiological Survey of Four Reproductive Disorder Associated Viruses of Sows in Hunan Province during 2019–2021" Veterinary Sciences 9, no. 8: 425. https://doi.org/10.3390/vetsci9080425