Fungicide Sensitivity Profile of Pyrenophora teres f. teres in Field Population
Abstract
:1. Introduction
2. Materials and Methods
2.1. Field Sampling and Fungal Isolates
2.2. DNA Extraction and Species Determination
2.3. In Vitro Fungicide Sensitivity Assay
2.4. Molecular Analysis of Fungicide Target Site Protein Genes, Cyp51A Promoter Region, and Mating Type
2.5. Statistical Analysis
3. Results
3.1. Pyrenophora teres f. teres Sensitivity to DMI Fungicides
3.2. Pyrenophora teres f. teres Sensitivity to SDHI Fungicides
3.3. Pyrenophora teres f. teres Sensitivity to QoI Fungicides
3.4. Isolates with Relevant Mutations in All Three Target Site Proteins
3.5. Pyrenophora teres f. teres Mating Types
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Newton, A.C.; Flavell, A.J.; George, T.S.; Leat, P.; Mullholland, B.; Ramsay, L.; Revoredo-Giha, C.; Russell, J.; Steffenson, B.J.; Swanston, J.S.; et al. Crops that feed the world 4. Barley: A resilient crop? Strengths and weaknesses in the context of food security. Food Secur. 2011, 3, 141–178. [Google Scholar] [CrossRef]
- Sooväli, P. Integrated Plant Disease Management in Spring Barley and Oat Production. Ph.D. Thesis, Estonian University of Life Sciences, Tartu, Estonia, 21 December 2011. [Google Scholar]
- Smedegård-Petersen, V. Pyrenophora teres f. maculata f. nov. and Pyrenophora teres f. teres on Barley in Denmark; Agricultural University of Copenhagen: Copenhagen, Denmark, 1971; pp. 124–144. [Google Scholar]
- Jalli, M.; Laitinen, P.; Latvala, S. The emergence of cereal fungal diseases and the incidence of leaf spot diseases in Finland. Agric. Food Sci. 2011, 20, 62–73. [Google Scholar] [CrossRef]
- Jalli, M.; Kaseva, J.; Andersson, B.; Ficke, A.; Jørgensen, L.N.; Ronis, A.; Kaukoranta, T.; Ørum, J.-E.; Djurle, A. Yield increases due to fungicide control of leaf blotch diseases in wheat and barley as a basis for IPM decision-making in the Nordic-Baltic region. Eur. J. Plant Pathol. 2020, 158, 315–333. [Google Scholar] [CrossRef]
- Jørgensen, L.N.; Matzen, N.; Ficke, A.; Andersson, B.; Jalli, M.; Ronis, A.; Nielsen, G.C.; Erlund, P.; Djurle, A. Using risk models for control of leaf blotch diseases in barley minimises fungicide use—Experiences from the Nordic and Baltic countries. Acta Agric. Scand. Sect. B Soil Plant Sci. 2021, 71, 247–260. [Google Scholar] [CrossRef]
- Kangor, T.; Sooväli, P.; Tamm, Ü.; Tamm, I.; Koppel, M. Malting barley diseases, yield and quality—Responses to using various agro-technology regimes. Proc. Latv. Acad. Sci. Sect. B. Nat. Exact Appl. Sci. 2017, 71, 57–62. [Google Scholar] [CrossRef]
- Sooväli, P.; Koppel, M. Efficacy of fungicide tebuconazole in barley varieties with different resistance level. Agric. Food Sci. 2010, 19, 34–42. [Google Scholar] [CrossRef]
- Rau, D.; Maier, F.J.; Papa, R.; Brown, A.H.D.; Balmas, V.; Saba, E.; Schaefer, W.; Attene, G. Isolation and characterization of the mating-type locus of the barley pathogen Pyrenophora teres and frequencies of mating-type idiomorphs within and among fungal populations collected from barley landraces. Genome 2005, 48, 855–869. [Google Scholar] [CrossRef] [PubMed]
- McLean, M.S.; Howlett, B.J.; Hollaway, G.J. Epidemiology and control of spot form of net blotch (Pyrenophora teres f. maculata) of barley: A review. Crop Pasture Sci. 2009, 60, 303–315. [Google Scholar] [CrossRef]
- McDonald, B.A.; Linde, C. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef]
- Liu, Z.; Ellwood, S.R.; Oliver, R.P.; Friesen, T.L. Pyrenophora teres: Profile of an increasingly damaging barley pathogen. Mol. Plant Pathol. 2011, 12, 1–19. [Google Scholar] [CrossRef]
- Jordan, V.W.L.; Allen, E.C. Barley net blotch: Influence of straw disposal and cultivation methods on inoculum potential, and on incidence and severity of autumn disease. Plant Pathol. 1984, 33, 547–559. [Google Scholar] [CrossRef]
- Jørgensen, J.H.; Bech, C.; Jensen, J. Reaction of European spring barley varieties to a population of the net blotch fungus. Plant Breed. 2000, 119, 43–46. [Google Scholar] [CrossRef]
- Rusu, T.; Gus, P.; Bogdan, I.; Moraru, P.I.; Pop, A.I.; Clapa, D.; Marin, D.I.; Oroian, I.; Pop, L.I. Implications of minimum tillage systems on sustainability of agricultural production and soil conservation. J. Food Agric. Environ. 2009, 8, 335–338. [Google Scholar]
- van den Bosch, F.; Paveley, N.; Shaw, M.; Hobbelen, P.; Oliver, R. The dose rate debate: Does the risk of fungicide resistance increase or decrease with dose? Plant Pathol. 2011, 60, 597–606. [Google Scholar] [CrossRef]
- Statistics Estonia. Statistical Database. Sales of Pesticides by Active Substance. Available online: https://andmed.stat.ee/et/stat/keskkond__pollumajanduskeskkond/KK2085/table/tableViewLayout2 (accessed on 2 February 2023).
- Akhavan, A.; Strelkov, S.E.; Askarian, H.; Kher, S.V.; Fraser, M.; Kutcher, H.R.; Turkington, T.K. Sensitivity of western Canadian Pyrenophora teres f. teres and P. teres f. maculata isolates to propiconazole and pyraclostrobin. Can. J. Plant Pathol. 2017, 39, 11–24. [Google Scholar] [CrossRef]
- Mair, W.J.; Deng, W.; Mullins, J.G.L.; West, S.; Wang, P.; Besharat, N.; Ellwood, S.R.; Oliver, R.P.; Lopez-Ruiz, F.J. Demethylase inhibitor fungicide resistance in Pyrenophora teres f. sp. teres associated with target site modification and inducible overexpression of Cyp51. Front. Microbiol. 2016, 7, 1279. [Google Scholar] [CrossRef]
- Marzani, Q.A.; Swarbrick, P.; Rossall, S. Correlation of the F129L mutation in Pyrenophora teres, the pathogen of net blotch of barley, with the efficacy of QoI fungicides. IOSR J. Agric. Vet. Sci. 2013, 3, 66–72. [Google Scholar] [CrossRef]
- Rehfus, A.; Miessner, S.; Achenbach, J.; Strobel, D.; Bryson, R.; Stammler, G. Emergence of succinate dehydrogenase inhibitor resistance of Pyrenophora teres in Europe. Pest Manag. Sci. 2016, 72, 1977–1988. [Google Scholar] [CrossRef] [PubMed]
- Semar, M.; Strobel, D.; Koch, A.; Klappach, K.; Stammler, G. Field efficacy of pyraclostrobin against populations of Pyrenophora teres containing the F129L mutation in the cytochrome b gene. J. Plant Dis. Prot. 2007, 114, 117–119. [Google Scholar] [CrossRef]
- Sierotzki, H.; Frey, R.; Wullschleger, J.; Palermo, S.; Karlin, S.; Godwin, J.; Gisi, U. Cytochrome b gene sequence and structure of Pyrenophora teres and P. tritici-repentis and implications for QoI resistance. Pest Manag. Sci. 2007, 63, 225–233. [Google Scholar] [CrossRef]
- QoI Working Group of FRAC. Fungicide Resistance Action Committee Monitoring Results and Use Recommendations for QoI Fungicides. Available online: https://www.frac.info/frac-teams/working-groups/qol-fungicides/recommendations-for-qoi (accessed on 2 April 2023).
- Fraaije, B.A.; Buttersb, J.A.; Coelhoa, J.M.; Jonesc, D.R.; Hollomonb, D.W. Following the dynamics of strobilurin resistance in Blumeria graminis f.sp. tritici using quantitative allele-specific real-time PCR measurements with the fluorescent dye SYBR Green I. Plant Pathol. 2002, 51, 45–54. [Google Scholar] [CrossRef]
- Fraaije, B.A.; Cools, H.J.; Fountaine, J.; Lovell, D.J.; Motteram, J.; West, J.S.; Lucas, J.A. Role of ascospores in further spread of QoI-resistant cytochrome b alleles (G143A) in field populations of Mycosphaerella graminicola. Phytopathology 2005, 95, 933–941. [Google Scholar] [CrossRef] [PubMed]
- Hoffmeister, M.; Mehl, A.; Hinson, A.; Siepe, I.; Taufferner, T.; Stammler, G. Acquired QoI resistance in Pyrenophora teres through an interspecific partial gene transfer by Pyrenophora tritici repentis? J. Plant Dis. Prot. 2022, 129, 1073–1086. [Google Scholar] [CrossRef]
- Grasso, V.; Palermo, S.; Sierotzki, H.; Garibaldi, A.; Gisi, U. Cytochrome b gene structure and consequences for resistance to Qo inhibitor fungicides in plant pathogens. Pest Manag. Sci. 2006, 62, 465–472. [Google Scholar] [CrossRef] [PubMed]
- Vallieres, C.; Trouillard, M.; Dujardin, G.; Meunier, B. Deleterious effect of the Qo inhibitor compound resistance-conferring mutation G143A in the intron-containing cytochrome b gene and mechanisms for bypassing it. Appl. Environ. Microbiol. 2011, 77, 2088–2093. [Google Scholar] [CrossRef] [PubMed]
- SDHI Working Group of FRAC. Fungicide Resistance Action Committee Monitoring Results and Use Recommendations for SDHI Fungicides. Available online: https://www.frac.info/frac-teams/working-groups/sdhi-fungicides/recommendations-for-sdhi (accessed on 2 April 2023).
- Cools, H.J.; Fraajie, B.A. Update on mechanisms of azole resistance in Mycosphaerella graminicola and implications for future control. Pest Manag. Sci. 2013, 69, 150–155. [Google Scholar] [CrossRef] [PubMed]
- Celia-Sanchez, B.N.; Mangum, B.; Brewer, M.; Momany, M. Analysis of Cyp51 protein sequences shows 4 major Cyp51 gene family groups across fungi. G3 Genes Genomes Genet. 2022, 12, jkac249. [Google Scholar] [CrossRef] [PubMed]
- Becher, R.; Wirsel, S.G. Fungal cytochrome P450 sterol 14α-demethylase (CYP51) and azole resistance in plant and human pathogens. Appl. Microbiol. Biotechnol. 2012, 95, 825–840. [Google Scholar] [CrossRef] [PubMed]
- Mair, W.J.; Thomas, G.J.; Dodhia, K.; Hills, A.L.; Jayasena, K.W.; Ellwood, S.R.; Oliver, R.P.; Lopez-Ruiz, F.J. Parallel evolution of multiple mechanisms for demethylase inhibitor fungicide resistance in the barley pathogen Pyrenophora teres f. sp. maculata. Fungal Genet. Biol. 2020, 145, 103475. [Google Scholar] [CrossRef]
- Knight, N.L.; Adhikari, K.C.; Dodhia, K.N.; Mair, W.J.; Lopez-Ruiz, F.J. Workflows for detecting fungicide resistance in net form and spot form net blotch pathogens. Pest Manag. Sci. 2024, 80, 2131–2140. [Google Scholar] [CrossRef]
- Sautua, F.J.; Carmona, M.A. SDHI resistance in Pyrenophora teres f. teres and molecular detection of novel double mutations in sdh genes conferring high resistance. Pest Manag. Sci. 2023, 79, 3300–3311. [Google Scholar] [CrossRef] [PubMed]
- Qiagen—Kits Handbooks. DNeasy Mericon 96 QIAcube HT Handbook. Available online: https://www.qiagen.com/us/resources/resourcedetail?id=6c38af78-01df-4640-af5e-c208737f96b1&lang=en (accessed on 11 January 2023).
- White, T.J.; Bruns, T.D.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Eds.; Academic Press: London, UK, 1990; pp. 315–322. [Google Scholar]
- Lu, S.; Platz, G.J.; Edwards, M.C.; Friesen, T.L. Mating type locus-specific polymerase chain reaction markers for differentiation of Pyrenophora teres f. teres and P. teres f. maculata, the causal agents of barley net blotch. Phytopathology 2010, 100, 1298–1306. [Google Scholar] [CrossRef]
- Estonian Land Board. Spatial Data. Administrative and Settlement Division. Available online: https://geoportaal.maaamet.ee/eng/spatial-data/administrative-and-settlement-division-p312.html (accessed on 1 November 2020).
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [PubMed]
- Cools, H.J.; Bayon, C.; Atkins, S.; Lucas, J.A.; Fraaije, B.A. Overexpression of the sterol 14α-demethylase gene (MgCYP51) in Mycosphaerella graminicola isolates confers a novel azole fungicide sensitivity phenotype. Pest Manag. Sci. 2012, 68, 1034–1040. [Google Scholar] [CrossRef] [PubMed]
- Wicker, T.; Sabot, F.; Hua-Van, A.; Bennetzen, J.L.; Capy, P.; Chalhoub, B.; Flavell, A.; Leroy, P.; Morgante, M.; Panaud, O.; et al. A unified classification system for eukaryotic transposable elements. Nat. Rev. Genet. 2007, 8, 973–982. [Google Scholar] [CrossRef] [PubMed]
- SBI Working Group of FRAC. Fungicide Resistance Action Committee Monitoring Results and Use Recommendations for SBI Fungicides. Available online: https://www.frac.info/frac-teams/working-groups/sbi-fungicides/recommendations-for-sbi (accessed on 2 April 2023).
- Kiiker, R.; Juurik, M.; Heick, T.M.; Mäe, A. Changes in DMI, SDHI, and QoI fungicide sensitivity in the Estonian Zymoseptoria tritici population between 2019 and 2020. Microorganisms 2021, 9, 814. [Google Scholar] [CrossRef]
- Kiiker, R.; Juurik, M.; Mäe, A. Fungicide resistance evolving in Ramularia collo-cygni population in Estonia. Microorganisms 2021, 9, 1514. [Google Scholar] [CrossRef]
- Mäe, A.; Fillinger, S.; Sooväli, P.; Heick, T.M. Fungicide sensitivity shifting of Zymoseptoria tritici in Finnish-Baltic region and a novel insertion in the MFS1 promoter. Front. Plant Sci. 2020, 11, 385. [Google Scholar] [CrossRef]
- Lammari, H.-I.; Rehfus, A.; Stammler, G.; Benslimane, H. Sensitivity of the Pyrenophora teres population in Algeria to quinone outside inhibitors, succinate dehydrogenase inhibitors and demethylation inhibitors. Plant Pathol. J. 2020, 36, 218–230. [Google Scholar] [CrossRef] [PubMed]
- Blake, J.J.; Gosling, P.; Fraaije, B.A.; Burnett, F.J.; Knight, S.M.; Kildea, S.; Paveley, N.D. Changes in field dose–response curves for demethylation inhibitor (DMI) and quinone outside inhibitor (QoI) fungicides against Zymoseptoria tritici, related to laboratory sensitivity phenotyping and genotyping assays. Pest Manag. Sci. 2018, 74, 302–313. [Google Scholar] [CrossRef] [PubMed]
- Kildea, S.; Bucar, D.E.; Hutton, F.; de la Rosa, S.; Welch, T.E.; Phelan, S. Prevalence of QoI resistance and mtDNA diversity in the Irish Zymoseptoria tritici population. Ir. J. Agric. Food Res. 2019, 58, 27–33. [Google Scholar] [CrossRef]
- Akhavan, A.; Turkington, T.K.; Kebede, B.; Xi, K.; Kumar, K.; Tekauz, A.; Kutcher, H.R.; Tucker, J.R.; Strelkov, S.E. Genetic structure of Pyrenophora teres f. teres and P. teres f. maculata populations from western Canada. Eur. J. Plant Pathol. 2016, 146, 325–335. [Google Scholar] [CrossRef]
- Dahanayaka, B.A.; Vaghefi, N.; Knight, N.L.; Bakonyi, J.; Prins, R.; Seress, D.; Snyman, L.; Martin, A. Population structure of Pyrenophora teres f. teres barley pathogens from different continents. Phytopathology 2021, 111, 2118–2129. [Google Scholar] [CrossRef] [PubMed]
- Linde, C.C.; Smith, L.M. Host specialisation and disparate evolution of Pyrenophora teres f. teres on barley and barley grass. BMC Evol. Biol. 2019, 19, 139. [Google Scholar] [CrossRef]
- Serenius, M.; Mironenko, N.; Manninen, O. Genetic variation, occurrence of mating types and different forms of Pyrenophora teres causing net blotch of barley in Finland. Mycol. Res. 2005, 109, 809–817. [Google Scholar] [CrossRef]
Target | Primer Name | Sequence (5’–3’) | Annealing Temp. (°C) | Amplicon Size (kb) | Reference |
---|---|---|---|---|---|
Fungal ITS1-5.8S-ITS2 region | ITS1 | TCCGTAGGTGAACCTGCGG | 55 | 0.6 | [38] |
ITS4 | TCCTCCGCTTATTGATATGC | ||||
Ptt form-specific | Ptt_R1ID1_F3 | GACGCGGCTAATGTCGTAA | 61 | 0.21 | [35] |
Ptt_R1ID1_B3_R | GGCGGTAACAGCACCAAG | ||||
MAT-1 | Ptt-MAT1F | ATGAGACGCTAGTTCAGAGTCT | 60 | 1.14 | [39] |
Ptt-MAT1R | GATGCCCAGCCAAGGACAA | ||||
MAT-2 | Ptt-MAT2F | TACGTTGATGCAGCTTTCTCAAT | 60 | 1.42 | [39] |
Ptt-MAT2R | AACACCGTCCAAAGCACCT | ||||
sdhB | KES 1825 | CATAACCGAGGAAGCTTGAGTG | 63 | 1.2 | [21] |
KES 1837 | CAAACACAACTCGCAATTAACGC | ||||
sdhC | KES 1827 | ATCACCCAACACCACCATCG | 60 | 0.85 | [21] |
KES 1828 | ATGTTGCAAACTTCAATCGTACCC | ||||
sdhD | KES 1833 | CGATCCTTCAACCCACCTCCGA | 60 | 0.75 | [21] |
KES 1834 | ACCCGCTTATGCATGCCACAG | ||||
Cyp51A | PttCyp51A_1F | ATGCTCTCCCTCCTCTTCCTC | 62 | 1.5 | [19] |
PttCyp51A_3F a | GCATTCCAACGTCGTCAAAG | ||||
PttCyp51A_3R | TTACCGCCTCTCCCAGC | ||||
cyt b (F129L) | 1PtcytB-F | TGGTGGGTGGCTGAATATGCTACT | 58 | 0.35 | [22] |
1PTcytB-R | CAGACATTCCAAGACTATTTGAGGAAC | ||||
cyt b (G137R) | PttCytB-F2 | GTGGTATAACCCGACAGG | 58 | 0.35 | current study |
PttCytB-R2 | GCTATGAAATCAGCTTGCGCC | ||||
Cyp51A promoter | PttCyp51A_Pro_F | GGCTCATAAATGGCGGAAC | 58 | 0.57 | [19] |
PttCyp51A_Pro_R | AGGAAGAGGAGGGAGAGCAT | ||||
Cyp51A upstream region | PttCyp51A_Pro_F | GGCTCATAAATGGCGGAAC | 55 | 1.3 | [19] |
PttCyp51A_1R | GAGATCGTGGTACAGGCTTG |
Haplotype | Insert a | CYP51A Amino Acid Polymorphism | Frequency (%) | |||||||
---|---|---|---|---|---|---|---|---|---|---|
I133V | G168D | L204V | M237I | K419E | K421E | F489L | 2021 | 2022 | ||
Wild type b | − | I | G | L | M | K | K | F | - | - |
PttEE-A1 | − | V | G | L | M | E | E | F | - | 5.7 |
PttEE-A2 | + | V | G | L | M | E | E | F | - | 10 |
PttEE-A3 | − | V | G | L | M | E | E | L c | 94.3 | 67.2 |
PttEE-A4 | − | V | G | L | M | E | E | L d | - | 11.5 |
PttEE-14 | − | V | G | L | I | E | E | F | - | 2.1 |
PttEE-23 | + | V | G | L | M | E | K | F | - | 2.1 |
PttEE-4507 | − | V | D | L | M | E | E | F | - | 0.7 |
PttEE-4506 | − | I | D | L | M | E | E | F | - | 0.7 |
21PttEE-15 | − | V | G | V | M | E | E | L | 5.7 | - |
Year | Frequency of Amino Acid Substitutions | Fluxapyroxad a | Bixafen a | ||||||
---|---|---|---|---|---|---|---|---|---|
SDHB-H277Y | SDHC-S135R | SDHD-H134R | S | RS | R | S | RS | R | |
2021 | 0 | 30 | 0 | 62 | 36 | 2 | 94 | 6 | 0 |
2022 | 0 | 14 | 31 | 76 | 22 | 2 | 90 | 7 | 3 |
Azoxystrobin b | Pyraclostrobin b | ||||||||
CytB-F129L | CytB-G137R | S | RS | R | S | RS | R | ||
2021 | 30 | 0 | 63 | 37 | 0 | 78 | 18 | 4 | |
2022 | 12 | 0 | 85 | 14 | 1 | 92 | 7 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pütsepp, R.; Mäe, A.; Põllumaa, L.; Andresen, L.; Kiiker, R. Fungicide Sensitivity Profile of Pyrenophora teres f. teres in Field Population. J. Fungi 2024, 10, 260. https://doi.org/10.3390/jof10040260
Pütsepp R, Mäe A, Põllumaa L, Andresen L, Kiiker R. Fungicide Sensitivity Profile of Pyrenophora teres f. teres in Field Population. Journal of Fungi. 2024; 10(4):260. https://doi.org/10.3390/jof10040260
Chicago/Turabian StylePütsepp, Regina, Andres Mäe, Lee Põllumaa, Liis Andresen, and Riinu Kiiker. 2024. "Fungicide Sensitivity Profile of Pyrenophora teres f. teres in Field Population" Journal of Fungi 10, no. 4: 260. https://doi.org/10.3390/jof10040260