Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India
Abstract
:1. Introduction
2. Materials and Methods
2.1. Isolates and Fungarium Specimens
2.2. Collection, Isolation and Morphological Identification
2.3. DNA Extraction, PCR Amplification and DNA Sequencing
2.4. Phylogenetic Analysis
2.5. Fermentation for Beauvericin Production
2.6. Extraction of Beauvericin
2.7. Detection of Beauvericin
2.7.1. Thin-Layer Chromatography (TLC)
2.7.2. High-Performance Liquid Chromatography (HPLC)
2.7.3. High-Resolution Mass Spectrometry (HRMS)
2.8. Large Scale Fermentation and Extraction of Beauvericin from Fusarium tardicrescens NFCCI 5201
2.9. Determination of the Antibacterial Activity
2.10. Determination of the Individual and Combined Effect of Fusarium tardicrescens NFCCI 5201 Extract Containing Beauvericin and Amphotericin B on Pathogenic Fungi of Agricultural Importance
- Control plate containing PDA;
- PDA supplemented with amphotericin B (40 µg/mL);
- PDA supplemented with F. tardicrescens NFCCI 5201 extract containing beauvericin (40 µg/mL);
- PDA supplemented with amphotericin B (20 µg/mL) and F. tardicrescens NFCCI 5201 extract containing beauvericin (20 µg/mL).
2.11. Antioxidant Activity of Extract of Fusarium tardicrescens NFCCI 5201 Containing Beauvericin
3. Results
3.1. Phylogenetic Analysis
3.2. Detection of Beauvericin Produced
3.2.1. Thin Layer Chromatography
3.2.2. High-Performance Liquid Chromatography
3.2.3. High-Resolution Mass Spectrometry (HRMS)
3.3. Large Scale Fermentation
3.4. Antimicrobial and MIC of Crude Extract of Fusarium tardicrescens NFCCI 5201
3.5. Individual and Combined Effect of Extract of Fusarium tardicrescens NFCCI 5201 Containing Beauvericin and Amphotericin B on Pathogenic Fungi
3.6. Antioxidant Effect of Extract of Fusarium tardicrescens NFCCI 5201 Containing Beauvericin
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gupta, A.K.; Baran, R.; Summerbell, R.C. Fusarium infections of the skin. Curr. Opin. Infect. Dis. 2000, 13, 121–128. [Google Scholar] [CrossRef]
- Summerell, B.A. Resolving Fusarium: Current status of the genus. Annu. Rev. Phytopathol. 2019, 57, 323–339. [Google Scholar] [CrossRef]
- Taylor, J.W.; Jacobson, D.J.; Kroken, S.; Kasuga, T.; Geiser, D.M.; Hibbett, D.S.; Fisher, M.C. Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol. 2000, 31, 21–32. [Google Scholar] [CrossRef] [Green Version]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [Green Version]
- Odonnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Biol. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
- O’Donnell, K.; Cigelnik, E.; Nirenberg, H.I. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 1998, 90, 465–493. [Google Scholar] [CrossRef]
- O’Donnell, K.; Sutton, D.A.; Rinaldi, M.G.; Gueidan, C.; Crous, P.W.; Geiser, D.M. Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. J. Clin. Microbiol. 2009, 47, 3851–3861. [Google Scholar] [CrossRef] [Green Version]
- O’Donnell, K. Molecular phylogeny of the Nectria haematococca-Fusarium solani species complex. Mycologia 2000, 92, 919–938. [Google Scholar] [CrossRef]
- Nalim, F.A.; Samuels, G.J.; Wijesundera, R.L.; Geiser, D.M. New species from the Fusarium solani species complex derived from perithecia and soil in the Old-World tropics. Mycologia 2011, 103, 1302–1330. [Google Scholar] [CrossRef]
- Herron, D.A.; Wingfield, M.J.; Wingfield, B.D.; Rodas, C.A.; Marincowitz, S.; Steenkamp, E.T. Novel taxa in the Fusarium fujikuroi species complex from Pinus spp. Stud. Mycol. 2015, 80, 131–150. [Google Scholar] [CrossRef] [Green Version]
- Crous, P.W.; Lombard, L.; Sandoval-Denis, M.; Seifert, K.A.; Schroers, H.J.; Chaverri, P.; Gene, J.; Guarro, J.; Hirooka, Y.; Bensch, K.; et al. Fusarium: More than a node or a foot-shaped basal cell. Stud. Mycol. 2021, 98, 100116. [Google Scholar] [CrossRef]
- Zhang, T.; Jia, X.P.; Zhuo, Y.; Liu, M.; Gao, H.; Liu, J.T.; Zhang, L.X. Cloning and characterization of a novel 2-ketoisovalerate reductase from the beauvericin producer Fusarium proliferatum LF061. BMC Biotechnol. 2012, 12, 55. [Google Scholar] [CrossRef] [Green Version]
- Sood, S.; Sandhu, S.S.; Mukherjee, T.K. Pharmacological and therapeutic potential of beauvericin: A Short Review. J. Proteom. Bioinform. 2017, 10, 18–23. [Google Scholar] [CrossRef]
- Hilgenfeld, R.; Saenger, W. Structural chemistry of natural and synthetic ionophores and their complexes with cations. Top. Curr. Chem. 1982, 101, 1–82. [Google Scholar]
- Ovchinnikov, Y.A.; Ivanov, V.T.; Evstratov, A.E.; Mikhaleva, I.I.; Bystrov, V.F.; Portnova, S.L.; Balashova, T.A.; Meshcheryakova, E.N.; Tulchinsky, V.M. The enniatins ionophores, conformation and ion binding properties. Int. J. Pept. Protein Res. 1974, 6, 465–498. [Google Scholar] [CrossRef]
- Steinrauf, L.K. Beauvericin and the other enniatins. Met. Ions Biol. Syst. 1985, 19, 139–171. [Google Scholar]
- Lin, H.I.; Lee, Y.J.; Chen, B.F.; Tsai, M.C.; Lu, J.L.; Chou, C.J.; Jow, G.M. Involvement of Bcl-2 family, cytochrome c and caspase 3 in induction of apoptosis by beauvericin in human non-small cell lung cancer cells. Cancer Lett. 2005, 230, 248–259. [Google Scholar] [CrossRef]
- Castlebury, L.A.; Sutherland, J.B.; Tanner, L.A.; Henderson, A.L.; Cerniglia, C.E. Short Communication: Use of a bioassay to evaluate the toxicity of beauvericin to bacteria. World J. Microbiol. Biotechnol. 1999, 15, 131–133. [Google Scholar] [CrossRef]
- Dzoyem, J.P.; Melong, R.; Tsamo, A.T.; Maffo, T.; Kapche, D.; Ngadjui, B.T.; McGaw, L.J.; Eloff, J.N. Cytotoxicity, antioxidant and antibacterial activity of four compounds produced by an endophytic fungus Epicoccum nigrum associated with Entada abyssinica. Rev. Bras. Farmacogn. 2017, 27, 251–253. [Google Scholar] [CrossRef]
- Fotso, J.; Smith, J.S. Evaluation of beauvericin toxicity with the bacterial bioluminescence assay and the Ames mutagenicity bioassay. J. Food Sci. 2003, 68, 1938–1941. [Google Scholar] [CrossRef]
- Meca, G.; Sospedra, I.; Soriano, J.M.; Ritieni, A.; Moretti, A.; Manes, J. Antibacterial effect of the bioactive compound beauvericin produced by Fusarium proliferatum on solid medium of wheat. Toxicon 2010, 56, 349–354. [Google Scholar] [CrossRef]
- Nilanonta, C.; Isaka, M.; Kittakoop, P.; Trakulnaleamsai, S.; Tanticharoen, M.; Thebtaranonth, Y. Precursor-directed biosynthesis of beauvericin analogs by the insect pathogenic fungus Paecilomyces tenuipes BCC 1614. Tetrahedron 2002, 58, 3355–3360. [Google Scholar] [CrossRef]
- Zhang, H.W.; Ruan, C.F.; Bai, X.L.; Zhang, M.; Zhu, S.S.; Jiang, Y.Y. Isolation and identification of the antimicrobial agent beauvericin from the endophytic Fusarium oxysporum 5-19 with NMR and ESI-MS/MS. Biomed Res. Int. 2016, 2016, 1084670. [Google Scholar] [CrossRef] [Green Version]
- Wu, X.F.; Xu, R.; Ouyang, Z.J.; Qian, C.; Shen, Y.; Wu, X.D.; Gu, Y.H.; Xu, Q.; Sun, Y. Beauvericin ameliorates experimental colitis by inhibiting activated T Cells via downregulation of the PI3K/Akt signaling pathway. PLoS ONE 2013, 8, e83013. [Google Scholar] [CrossRef] [Green Version]
- Fukuda, T.; Arai, M.; Tomoda, H.; Omura, S. New beauvericins, potentiators of antifungal miconazole activity, produced by Beauveria sp FKI-1366-II. Structure elucidation. J. Antibiot. 2004, 57, 117–124. [Google Scholar] [CrossRef] [Green Version]
- Shekhar-Guturja, T.; Tebung, W.A.; Mount, H.; Liu, N.N.; Kohler, J.R.; Whiteway, M.; Cowen, L.E. Beauvericin potentiates azole activity via inhibition of multidrug efflux, blocks Candida albicans morphogenesis, and is effluxed via Yor1 and circuitry controlled by Zcf29. Antimicrob. Agents Chemother. 2016, 60, 7468–7480. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.X.; Yan, K.Z.; Zhang, Y.; Huang, R.; Bian, J.; Zheng, C.S.; Sun, H.X.; Chen, Z.H.; Sun, N.; An, R.; et al. High-throughput synergy screening identifies microbial metabolites as combination agents for the treatment of fungal infections. Proc. Natl. Acad. Sci. USA 2007, 104, 4606–4611. [Google Scholar] [CrossRef] [Green Version]
- Campos, F.F.; Sales, P.A.; Romanha, A.J.; Araujo, M.S.S.; Siqueira, E.P.; Resende, J.M.; Alves, T.M.A.; Martins, O.A.; dos Santos, V.L.; Rosa, C.A.; et al. Bioactive endophytic fungi isolated from Caesalpinia echinata Lam. (Brazilwood) and identification of beauvericin as a trypanocidal metabolite from Fusarium sp. Mem. Inst. Oswaldo Cruz 2015, 110, 65–74. [Google Scholar] [CrossRef]
- Aamir, S.; Sutar, S.; Singh, S.K.; Baghela, A. A rapid and efficient method of fungal genomic DNA extraction, suitable for PCR based molecular methods. Plant Pathol. Quar. 2015, 5, 74–81. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innes, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [Green Version]
- Vilgalys, R.; Sun, B.L. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA-sequences. Proc. Natl. Acad. Sci. USA 1994, 91, 7832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.J.J.; Whelen, S.; Benjamin, D.H. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, M.; Yonezawa, T.; Lee, K.; Kumagai, S.; Sugita-Konishi, Y.; Goto, K.; Hara-Kudo, Y. Molecular phylogeny of the higher and lower taxonomy of the Fusarium genus and differences in the evolutionary histories of multiple genes. BMC Evol. Biol. 2011, 11, 322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peterson, S.W. Multilocus DNA sequence analysis shows that Penicillium biourgeianum is a distinct species closely related to P. brevicompactum and P. olsonii. Mycol. Res. 2004, 108, 434–440. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large data sets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Aberkane, A.; Cuenca-Estrella, M.; Gomez-Lopez, A.; Petrikkou, E.; Mellado, E.; Monzón, A.; Rodriguez-Tudela, J.L. Comparative evaluation of two different methods of inoculum preparation for antifungal susceptibility testing of filamentous fungi. J. Antimicrob. Chemother. 2002, 50, 719–722. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.; Kang, J.; Kim, B.; Park, S.; Lee, C. Statistical optimization of culture conditions for the production of enniatins H, I, and MK1688 by Fusarium oxysporum KFCC 11363P. J. Biosci. Bioeng. 2011, 111, 279–285. [Google Scholar] [CrossRef] [PubMed]
- Logrieco, A.; Moretti, A.; Castella, G.; Kostecki, M.; Golinski, P.; Ritieni, A.; Chelkowski, J. Beauvericin production by Fusarium species. Appl. Environ. Microbiol. 1998, 64, 3084–3088. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Touchstone, J.C. Practice of Thin Layer Chromatography, 3rd ed.; John Wiley and Sons, Inc.: Hoboken, NJ, USA, 1992; pp. 1–14. [Google Scholar]
- Fessenden, R.J.; Fessenden, J.S.; Feist, P. Organic Laboratory Techniques, 3rd ed.; Cengage Learning: Boston, MA, USA; Brooks/Cole Thomson Leaning, Inc.: Belmont, CA, USA, 2001; pp. 133–138. [Google Scholar]
- Xu, L.J.; Liu, Y.S.; Zhou, L.G.; Wu, J.Y. Optimization of a liquid medium for beauvericin production in Fusarium redolens Dzf2 mycelial culture. Biotechnol. Bioprocess Eng. 2010, 15, 460–466. [Google Scholar] [CrossRef]
- Teh, C.H.; Nazni, W.A.; Nurulhusna, A.; Norazah, A.; Lee, H.L. Determination of antibacterial activity and minimum inhibitory concentration of larval extract of fly via resazurin-based turbidometric assay. BMC Microbiol. 2017, 17, 36. [Google Scholar] [CrossRef] [Green Version]
- Foerster, S.; Desilvestro, V.; Hathaway, L.J.; Althaus, C.L.; Unemo, M. A new rapid resazurin-based microdilution assay for antimicrobial susceptibility testing of Neisseria gonorrhoeae. J. Antimicrob. Chemother. 2017, 72, 1961–1968. [Google Scholar] [CrossRef]
- Adjou, E.S.; Kouton, S.; Dahouenon-Ahoussi, E.; Sohounhloue, C.K.; Soumanou, M.M. Antifungal activity of Ocimum canum essential oil against toxinogenic fungi isolated from peanut seeds in post-harvest in Benin. Int. Res. J. Biol. 2012, 1, 20–26. [Google Scholar]
- Philippe, S.; Soua¨ıbou, F.; Guy, A.; Sébastien, D.T.; Boniface, Y.; Paulin, A.; Issaka, Y.; Dominique, S. Chemical composition and antifungal activity of essential oil of fresh leaves of Ocimum gratissimum from Benin against six mycotoxigenic fungi isolated from traditional cheese wagashi. Res. J. Biol. Sci. 2012, 1, 22–27. [Google Scholar]
- Jinesh, V.K.; Jaishree, V.; Badami, S.; Shyam, W. Comparative evaluation of antioxidant properties of edible and non-edible leaves of Anethum graveolens Linn. Indian J. Nat. Prod. Reso. 2010, 1, 168–173. [Google Scholar]
- Elizabeth, K.; Rao, M.W.A. Oxygen radical scavenging activity of Curcumin. Int. J. Pharmaceu. 1990, 58, 237–240. [Google Scholar]
- Jamaluddin; Goswami, M.S.; Ojha, B.M. Fungi of India 1989–2001; Scientific Publishers: Jodhpur, India, 2004; pp. 1–326. [Google Scholar]
- Manoharachary, C.; Atri, N.S.; Devi, T.P.; Kamil, D.; Singh, S.K.; Singh, A.P. Bilgrami’s Fungi of India List and References (1988–2020); Today & Tomorrow’s Printers and Publishers: New Delhi, India, 2022; pp. 1–475. [Google Scholar]
- Santos, A.C.D.; Trindade, J.V.C.; Lima, C.S.; Barbosa, R.D.; da Costa, A.F.; Tiago, P.V.; Oliveira, N. Morphology, phylogeny, and sexual stage of Fusarium caatingaense and Fusarium pernambucanum, new species of the Fusarium incarnatum-equiseti species complex associated with insects in Brazil. Mycologia 2019, 111, 244–259. [Google Scholar] [CrossRef]
- Lombard, L.; Sandoval-Denis, M.; Lamprecht, S.C.; Crous, P.W. Epitypification of Fusarium oxysporum—Clearing the taxonomic chaos. Persoonia 2019, 43, 1–47. [Google Scholar] [CrossRef] [Green Version]
- Vanwyk, P.S.; LOS, O.; Palterl, G.D.C.; Marasas, W.F.O. Geographic distribution and pathogenicity of Fusarium species associated with crown rot of wheat in the orange free state, South Africa. Phytophylactica 1987, 19, 271–274. [Google Scholar]
- Matic, S.; Tabone, G.; Gullino, M.L.; Garibaldi, A.; Guarnaccia, V. Emerging leafy vegetable crop diseases caused by the Fusarium incarnatum-equiseti species complex. Phytopathol. Mediterr. 2020, 59, 303–317. [Google Scholar] [CrossRef]
- Sever, Z.; Ivić, D.; Kos, T.; Miličević, T. Fusarium rot in stored apples in Croatia Arh. Hig. Rada. Toksikol. 2012, 63, 463–470. [Google Scholar] [CrossRef]
- Frisullo, S.; Logrieco, A.; Moretti, A.; Grammatikaki, G.; Bottalico, A. Banana Corm and Root Rot by Fusarium compactum, in Crete. Phytopathol. Mediterr. 1994, 33, 78–82. [Google Scholar]
- Mazhar, M.A.; Jahangir, A.Z.; Banihashemi, Z.; Izadpanah, K. First report of isolation and pathogenicity of Fusarium compactum on safflower. Iran. J. Plant Pathol. 2013, 49, 277. [Google Scholar]
- Brizuela, A.M.; De la Lastra, E.; Marin-Guirao, J.I.; Galvez, L.; de Cara-Garcia, M.; Capote, N.; Palmero, D. Fusarium consortium populations associated with Asparagus crop in Spain and their role on field decline syndrome. J. Fungi 2020, 6, 336. [Google Scholar] [CrossRef]
- Maryani, N.; Lombard, L.; Poerba, Y.S.; Subandiyah, S.; Crous, P.W.; Kema, G.H.J. Phylogeny and genetic diversity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp. cubense in the Indonesian centre of origin. Stud. Mycol. 2019, 92, 155–194. [Google Scholar] [CrossRef]
- Ujat, A.; Vadamalai, G.; Hattori, Y.; Nakashima, C.; Wong, C.; Zulperi, D. Current classification and diversity of Fusarium species complex, the causal pathogen of Fusarium wilt disease of banana in Malaysia. Agronomy 2021, 11, 1955. [Google Scholar] [CrossRef]
- Maryani, N.; Sandoval-Denis, M.; Lombard, L.; Crous, P.W.; Kema, G.H.J. New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 2019, 43, 48–69. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.M.; Chen, Q.; Diao, Y.Z.; Duan, W.J.; Cai, L. Fusarium incarnatum-equiseti complex from China. Persoonia 2019, 43, 70–89. [Google Scholar] [CrossRef] [Green Version]
- Lu, Y.A.; Qiu, J.B.; Wang, S.F.; Xu, J.H.; Ma, G.Z.; Shi, J.R.; Bao, Z.H. Species diversity and toxigenic potential of Fusarium incarnatum-equiseti species complex isolates from rice and soybean in China. Plant Dis. 2021, 105, 2628–2636. [Google Scholar] [CrossRef]
- Yi, R.H.; Lian, T.; Su, J.J.; Chen, J. First report of internal black rot on Carica papaya fruit caused by Fusarium sulawesiense in China. Plant Dis. 2022, 106, 319. [Google Scholar] [CrossRef]
- Lu, M.; Zhang, Y.; Li, Q.; Huang, S.; Tang, L.; Chen, X.; Guo, T.; Mo, J.; Ma, L. First report of leaf blight caused by Fusarium pernambucanum and Fusarium sulawesiense on Plum in Sichuan, China. Plant Dis. 2022. [Google Scholar] [CrossRef]
- Araújo, M.B.M.; Moreira, G.M.; Nascimento, L.V.; Nogueira, G.D.; Nascimento, S.R.D.; Pfenning, L.H.; Ambrosio, M.M.D. Fusarium rot of melon is caused by several Fusarium species. Plant Pathol. 2021, 70, 712–721. [Google Scholar] [CrossRef]
- Urbaniak, M.; Stepien, L.; Uhlig, S. Evidence for naturally produced beauvericins containing N-Methyl-Tyrosine in Hypocreales fungi. Toxins 2019, 11, 182. [Google Scholar] [CrossRef] [Green Version]
- Geiser, D.M.; Jimenez-Gasco, M.D.; Kang, S.C.; Makalowska, I.; Veeraraghavan, N.; Ward, T.J.; Zhang, N.; Kuldau, G.A.; O’Donnell, K. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 2004, 110, 473–479. [Google Scholar] [CrossRef]
- Wingfield, M.J.; De Beer, Z.W.; Slippers, B.; Wingfield, B.D.; Groenewald, J.Z.; Lombard, L.; Crous, P.W. One fungus, one name promotes progressive plant pathology. Mol. Plant Pathol. 2012, 13, 604–613. [Google Scholar] [CrossRef]
- Aiyaz, M.; Thimmappa Divakara, S.; Mudili, V.; George Moore, G.; Kumar Gupta, V.; i Yli-Mattila, T.; Chandra Nayaka, S.; Ramachandrappa Niranjana, S. Molecular diversity of seed-borne Fusarium species associated with maize in India. Curr. Genom. 2016, 17, 132–144. [Google Scholar] [CrossRef] [Green Version]
- Gupta, S.; Krasnoff, S.B.; Underwood, N.L.; Renwick, J.A.A.; Roberts, D.W. Isolation of beauvericin as an insect toxin from Fusarium semitectum and Fusarium moniliforme var. subglutinans. Mycopathologia 1991, 155, 185–189. [Google Scholar] [CrossRef]
- Moretti, A.; Logrieco, A.; Bottalico, A.; Ritieni, A.; Fogliano, V.; Randazzo, G. Diversity in beauvericin and fusaproliferin production by different populations of Gibberella fujikuroi (Fusarium section Liseola). Sydowia 1997, 48, 44–56. [Google Scholar]
- Azliza, I.N.; Hafizi, R.; Nurhazrati, M.; Salleh, B. Production of major mycotoxins by Fusarium species isolated from wild grasses in peninsular Malaysia. Sains Malays. 2014, 43, 89–94. [Google Scholar]
- Xu, L.; Wang, J.; Zhao, J.; Li, P.; Shan, T.; Wang, J.; Li, X.; Zhou, L. Beauvericin from the endophytic fungus, Fusarium redolens, isolated from Dioscorea zingiberensis and its antibacterial activity. Nat. Prod. Commun. 2010, 5, 811–814. [Google Scholar] [CrossRef] [Green Version]
- Caicedo, N.H.; Davalos, A.F.; Puente, P.A.; Rodriguez, A.Y.; Caicedo, P.A. Antioxidant activity of exo-metabolites produced by Fusarium oxysporum: An endophytic fungus isolated from leaves of Otoba gracilipes. Open Microbiol. J. 2019, 8, e903. [Google Scholar] [CrossRef] [Green Version]
- Menezes, B.S.; Solidade, L.S.; Conceição, A.A.; Santos Junior, M.N.; Leal, P.L.; de Brito, E.S.; Canuto, K.M.; Mendonça, S.; de Siqueira, F.G.; Marques, L.M. Pigment production by Fusarium solani BRM054066 and determination of antioxidant and anti-inflammatory properties. AMB Express 2020, 10, 117. [Google Scholar] [CrossRef]
NFCCI No. | Host | Place of Collection | Date of Isolation |
---|---|---|---|
NFCCI 680 | Azadirachta indica (Endophyte) | Maharashtra | 25 September 2006 |
NFCCI 681 | Azadirachta indica (Endophyte) | Maharashtra | 20 December 2006 |
NFCCI 1127 | Jatropha curcus (Phyloplane) | Durg, Chhattisgarh | 23 May 2007 |
NFCCI 1788 | Soil | Imphal, Manipur | 23 June 2009 |
NFCCI 1895 | Soil | Mahabaleshwar, Maharashtra | 25 August 2009 |
NFCCI 2053 | Wilted Guava plant (Root) | Rajasthan | 9 February 2010 |
NFCCI 2150 | Soil | Arctic Tundra | 25 June 2010 |
NFCCI 2315 | Potato | Goa | 15 June 2009 |
NFCCI 2460 | Zanthooxylum armatum | Udhampur, Jammu and Kashmir | 13 June 2011 |
NFCCI 2467 | Bottle Gourd | Dapoli, Maharashtra | 16 June 2011 |
NFCCI 2470 | Coconut leaves | Vellayani, Thiruvananthapuram, Kerala | 22 June 2011 |
NFCCI 2491 | Soil | Bangalore, Karnataka | 8 July 2012 |
NFCCI 2696 | Coleus sp. | Puthenthope, Kerala | 19 March 2012 |
NFCCI 2871 | Wilted tomato plant (Root) | Manipur | 25 September 2012 |
NFCCI 2872 | Wilted tomato plant (Root) | Manipur | 25 September 2012 |
NFCCI 2885 | Azadirachta indica (Endophyte) | Chandravati, Rajasthan | 9 April 2012 |
NFCCI 2886 | Azadirachta indica (Endophyte) | Chikkamagaluru, Karnataka | 15 July 2012 |
NFCCI 2904 | Aegle marmelos | Karnataka | 28 November 2009 |
NFCCI 2945 | Soil | Tiruchirappalli, Tamil Nadu | 7 January 2012 |
NFCCI 2946 | Aegle marmelos | Karnataka | 25 November 2010 |
NFCCI 2949 | Cotton field | Shirpur, Maharashtra | 9 October 2012 |
NFCCI 2953 | Cotton field | Shirpur, Maharashtra | 6 August 2015 |
NFCCI 2956 | Cotton field | Shirpur, Maharashtra | 19 October 2012 |
NFCCI 2959 | Pigeon pea (Root) | Amravati, Maharashtra | 30 October 2012 |
NFCCI 2960 | Pigeon pea (Root) | Amravati, Maharashtra | 30 October 2012 |
NFCCI 2961 | Pigeon pea (Root) | Beed, Maharashtra | 26 October 2012 |
NFCCI 2962 | Pigeon pea (Root) | Kalamb, Osmanabad, Maharashtra | 26 October 2011 |
NFCCI 2964 | Pigeon pea (Root) | Latur, Maharashtra | 30 August 2012 |
NFCCI 2972 | Pigeon pea (Root) | Ahmednagar, Maharashtra | 30 October 2012 |
NFCCI 3020 | Soil | Karnataka | 24 December 2010 |
NFCCI 3031 | Piper betle (Leaf-endophyte) | Tamil Nadu | 26 December 2011 |
NFCCI 3038 | Wilted cumin plant | Gujarat | 24 February 2013 |
NFCCI 3044 | Wilted cumin plant | Gujarat | 24 February 2013 |
NFCCI 3048 | Wilted cumin plant | Gujarat | 24 February 2013 |
NFCCI 3049 | Wilted cumin plant | Gujarat | 24 February 2013 |
NFCCI 3051 | Wilted cumin plant | Gujarat | 24 February 2013 |
NFCCI 3065 | Ocimum sanctum | Maharashtra | 20 August 2012 |
NFCCI 3072 | Barleria prionitis (Stem) | Maharashtra | 24 September 2012 |
NFCCI 3074 | Barleria prionitis | Maharashtra | 20 September 2012 |
NFCCI 3091 | Textile sludge | Tamil Nadu | 14 September 2012 |
NFCCI 3092 | Textile sludge | Tamil Nadu | 8 September 2012 |
NFCCI 3093 | Textile sludge | Tamil Nadu | 15 September 2012 |
NFCCI 3147 | Rotten sugarcane | Dapoli, Maharashtra | 5 January 2013 |
NFCCI 3239 | Marigold (Seeds) | Mumbai, Maharashtra | 8 February 2013 |
NFCCI 3243 | Cow pea | Thiruvananthapuram, Kerala | 20 June 2012 |
NFCCI 3264 | Cow pea | Thiruvananthapuram, Kerala | 12 September 2012 |
NFCCI 3270 | Dead wood | Mumbai, Maharashtra | 29 March 2013 |
NFCCI 3282 | Soil | Amarkantak, Madhya Pradesh | 26 September 2012 |
NFCCI 3300 | Cathranthus roseus | Raipur, Chhattisgarh | 12 August 2012 |
NFCCI 3475 | Ocimum sanctum (Endophyte) | Amaravati, Maharashtra | 21 July 2013 |
NFCCI 3703 | Onion | Nanded, Maharashtra | 14 September 2014 |
NFCCI 3706 | Castor sp. (Root) | Aanand, Gujarat | 20 December 2014 |
NFCCI 4095 | Soil | Pune, Maharashtra | 2 April 2014 |
NFCCI 4180 | Soil | Chandigarh | 19 June 2018 |
NFCCI 4759 | Anaphalis contorta (Root-endophyte) | Imphal, Manipur | 18 February 2019 |
NFCCI 4792 | Chickpea (Root) | Pratapgarh, Uttar Pradesh | 21 January 2018 |
NFCCI 4830 | Cotton (Root) | Madurai, Tamil Nadu | 5 September 2018 |
NFCCI 4859 | Dillenia indica | Arunachal Pradesh | 15 October 2016 |
NFCCI 4885 | Cucumber (Twig and leaf) | Jobner, Jaipur, Rajasthan | 3 May 2020 |
NFCCI 4888 | Cucumber (Twig) | Jobner, Jaipur, Rajasthan | 02 June 2020 |
NFCCI 4889 | Unknown insect | Vishakhapatnum Andhra Pradesh | 30 October 2020 |
NFCCI 4919 | Soil | Pathanamthitta, Kerala | 15 September 2020 |
NFCCI 4963 | Plant litter | Raiganj, Uttar dinajpur, West Bengal | 25 March 2019 |
NFCCI 4972 | Sugarcane bagasse | Dharur, Beed, Maharashtra | 22 December 2020 |
NFCCI No. | Host | Place of Collection | Date of Collection | Date of Isolation |
---|---|---|---|---|
NFCCI 5189 | Soil | Haridwar, Uttarakhand | 2 July 2018 | 12 July 2018 |
NFCCI 5190 | Ginger | Pune, Maharashtra | 27 August 2017 | 08 September 2017 |
NFCCI 5191 | Pomegranate | Pune, Maharashtra | 7 September 2019 | 15 September 2019 |
NFCCI 5192 | Zingiber officinale | Aurangabad, Maharashtra | 9 March 2017 | 10 March 2017 |
NFCCI 5193 | Soil | Jalgaon, Maharashtra | 10 October 2017 | 14 October 2017 |
NFCCI 5194 | Forest litter | Mahabaleshwar, Maharashtra | 12 October 2017 | 14 October 2017 |
NFCCI 5195 | Soil | Chandigarh | 1 April 2019 | 19 April 2019 |
NFCCI 5196 | Wilted sugarcane plant | Gorakhpur, Uttar Pradesh | 2 July 2021 | 17 July 2021 |
NFCCI 5197 | Chrysanthemum roseum | Mahabaleshwar, Maharashtra | 25 September 2018 | 27 September 2018 |
NFCCI 5198 | Soil | Pune, Maharashtra | 5 March 2020 | 16 March 2020 |
NFCCI 5199 | Soil | Jalgaon, Maharashtra | 8 October 2017 | 14 October 2017 |
NFCCI 5200 | Pea | Pune, Maharashtra | 15 April 2019 | 21 April 2019 |
NFCCI 5201 | Dead bark | Simbal, Himachal Pradesh | 14 December 2017 | 25 December 2017 |
NFCCI 5202 | Wilted Cashew plant | Pilcode, Kerala | 6 August 2019 | 20 August 2019 |
NFCCI 5203 | Rotten mushroom | Simbal, Himachal Pradesh | 19 May 2019 | 25 May 2019 |
NFCCI 5204 | Potato | Pune, Maharashtra | 28 December 2018 | 12 January 2019 |
NFCCI 5205 | Aloe vera (Leaf) | Pune, Maharashtra | 5 October 2019 | 16 October 2019 |
NFCCI 5206 | Soil | Vadodara, Gujarat | 3 October 2019 | 15 October 2019 |
NFCCI 5207 | Coconut | Goa | 15 October 2018 | 29 October 2018 |
NFCCI 5208 | Zingiber officinale | Aurangabad, Maharashtra | 5 October 2018 | 12 March 2018 |
NFCCI 5209 | Carrot rhizosphere | Pithoragarh, Uttarakhand | 3 October 2019 | 7 October 2019 |
NFCCI 5210 | Chilli (Fruit) | Simbal, Himachal Pradesh | 5 February 2019 | 12 February 2019 |
NFCCI 5211 | Damping-off Onion | Udaipur, Rajasthan | 19 September 2019 | 27 September 2019 |
NFCCI 5212 | Grape (Leaf) | Nashik, Maharashtra | 16 March 2020 | 17 April 2020 |
Name of the Gene Region | Primer | Direction | Sequence (5′-3′) | Reference |
---|---|---|---|---|
Internal transcribed spacer region of the nrDNA (ITS) | ITS-5 | Forward | GGAAGTAAAAGTCGTAACAAGG | [30] |
ITS-4 | Reverse | TCCTCCGCTTATTGATATGC | [30] | |
Translation elongation factor 1-alpha (tef1-α) | EF-1 | Forward | ATGGGTAAGGARGACAAGAC | [31] |
EF-2 | Reverse | GGARGTACCAGTSATCATG | [31] | |
28S large subunit of the nrDNA (LSU) | LR-OR | Forward | ACCCGCTGAACTTAAGC | [32] |
LR-7 | Reverse | TACTACCACCAAGATCT | [33] | |
RNA polymerase second largest subunit (rpb2) | fRPB2-5f | Forward | GAYGAYMGWGATCAYTTYGG | [34] |
fRPB2-7cR | Reverse | CCCATRGCTTGYTTRCCCAT | [34] | |
Beta-tubulin (β-tub) | βtuFFo1 | Forward | CAGACCGGTCAGTGCGTAA | [35] |
βtuFRo1 | Reverse | TTGGGGTCGAACATCTGCT | [35] | |
Calmodulin (CaM) | CF-1 | Forward | GCCGACTCTTTGACYGARGAR | [36] |
CF-4 | Reverse | TTTYTGCATCATRAGYTGGAC | [36] |
Identity | This Study | Earlier Reports | ||
---|---|---|---|---|
NFCCI No. | Host | Host | Reference | |
Fusarium caatingaense | NFCCI 5191 | Pomegranate | Dactylopius opuntiae | [55] |
Fusarium carminascens | NFCCI 5204 | Potato | Zea mays | [56] |
Fusarium compactum | NFCCI 2946 | Aegle marmelos | Poa annua Soil Spinach Wild rocket Cultivated rocket Lettuce Quercus suber Wheat Apple fruit cultivar Idared and Pink lady Banana corm and root rot Safflower (Carthamus tinctorius L.) Wheat soil Grasses | [https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022, [57,58,59,60,61,62]] |
NFCCI 2904 | ||||
NFCCI 5208 | Zingiber officinale | |||
Fusarium cugenangense | NFCCI 2872 | Wilted tomato plant (Root) | Crocus sp. Gossypium barbadense Human toe nail Vicia faba Musa sp. var. Pisang Kepok Gossypium sp. | [56,63] |
Fusarium duoseptatum | NFCCI 681 | Azadirachta indica (Endophyte) | Musa sapientum cv. Pisang Ambon Musa sp. var. Pisang Rastali M. acuminata var. Dwarf Cavendish M. acuminata var. Pisang Ambon Musa sp. var. Pisang Raja Musa sp. var. Pisang Hawa Musa sp. var. Pisang Awak Musa sp. var. Pisang Susu Musa sp. var. Pisang Keling | [56,63] |
Fusarium fabacearum | NFCCI 3239 | Marigold seeds | Zea mays Glycine max | [56] |
NFCCI 3706 | Castor root | |||
NFCCI 5200 | Pea | |||
Fusarium glycines | NFCCI 3048 | Wilted cumin plant | Linum usitatissium Ocimum basilicum Glycine max | [56] |
NFCCI 1788 | Soil | |||
Fusarium gossypinum | NFCCI 2467 | Bottle gourd | Gossypium hirsutum | [56] |
Fusarium grosmichelii | NFCCI 3243 | Cow pea | Banana corm M. acuminata var. Pisang Ambon Musa sp. var. Pisang Awak M. acuminata var. Pisang Ambon Lumut M. acuminata var. Cavendish Musa sp. var. Pisang Siem Jumbo M. acuminata var. Pisang Ambon Kuning Musa sp. var. Pisang Kepok | [63,64] |
Fusarium lumajangense | NFCCI 4180 | Soil | Musa sp. var. Pisang Raja Nangka Musa acuminata var. Pisang Mas Kirana | [65] |
Fusarium microconidium | NFCCI 3020 | Soil | Unknown | [11] |
Fusarium nanum | NFCCI 5192 | Zingiber officinale | Musa nana (Leaves) Solanum lycopersicum Musa acuminata Oat Soil Triticum sp. Sorghum sp. | [[66], https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022] |
Fusarium nirenbergiae | NFCCI 5189 | Soil | Secale cereale Musa sp. S. tuberosum Solanum lycopersicum Passiflora edulis Chrysanthemum sp. Bouvardia longiflora Dianthus caryophyllus Agathosma betulina Tulip roots Amputated human toe Human leg ulcer | [56] |
NFCCI 4859 | Dillenia indica | |||
Fusarium sulawesiense | NFCCI 2956 | Cotton field | Musa acuminata var. Pisang Cere (AAA) Oryza sp. Smilax corbularia Acalypha insulana Alocasia odora Ipomoea batatas Musa nana Musa paradisiacal Plum leaf Triticum aestivum Soil Oryza sativa Aleurocanthus woglumi Phaseolus lunatus Eucalyptus Carica papaya Prosopis sp. Cucumis melo Galia melon Bixa orellana Gossypium hirsutum Sorghum vulgare Musa sampientum var. Robusta Mango leaf Rhizosphere soil (Bromus tectorum) Soybean | [[11,67,68,69,70], https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022] |
NFCCI 2886 | Azadirachta indica (Endophyte) | |||
NFCCI 3031 | Piberbettle leaf (endophyte) | |||
NFCCI 4919 | Soil | |||
Fusarium tardichlamydosporum | NFCCI 3051 | Wilted cumin plant | M. sapientum cv. Pisang Awak Legor Musa sp. var. Monthan M. acuminata var. Pisang Barangan Musa sp. var. Bluggoe M. acuminata var. Lady finger Musa sp. var. Ney Poovan Musa sp. var. Pisang Awak Legor | [56,63] |
NFCCI 1895 | Soil | |||
NFCCI 2491 | ||||
Fusarium tardicrescens | NFCCI 680 | Azadirachta indica (Endophyte) | Musa sp. var. Harare Cicer sp. Raphanus sp. | [63] |
NFCCI 5201 | Dead bark | |||
Neocosmospora oblonga | NFCCI 2150 | Soil | Human eye Carbonatite | [[11], https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022] |
Neocosmospora suttoniana | NFCCI 5190 | Ginger | Human wound Equine eye Soil Homo sapiens Gossypium hirsutum Podocnemis unifilis Human cornea Human skin leukemic Human blood leukemia Human blood | [[11], https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022] |
NFCCI 2961 | Pigeon pea root (Wilted) | |||
NFCCI 5210 | Chilli fruit | |||
NFCCI 4830 | Cotton rot | |||
NFCCI 5211 | Onion plants (Damping-off) |
Identity | NFCCI No. | Biomass (g/L) | BEA Content (mg/g) | Final pH of Medium |
---|---|---|---|---|
Fusarium nirenbergiae | NFCCI 5189 | 6.61 ± 0.26 | 2.93 ± 0.12 | 7.73 ± 0.32 |
Fusarium annulatum | NFCCI 3264 | 6.72 ± 0.37 | 0.97 ± 0.14 | 7.48 ± 0.18 |
Fusarium lacertarum | NFCCI 3044 | 8.07 ± 0.52 | 0.66 ± 0.14 | 7.65 ± 0.24 |
Neocosmospora suttoniana | NFCCI 5190 | 7.14 ± 0.08 | - | 7.63 ± 0.22 |
Fusarium fabacearum | NFCCI 3239 | 6.22 ± 0.31 | - | 7.77 ± 0.4 |
Fusarium sacchari | NFCCI 3147 | 6.34 ± 0.10 | - | 7.6 ± 0.06 |
Fusarium caatingaense | NFCCI 5191 | 9.26 ± 0.26 | 0.33 ± 0.03 | 7.63 ± 0.03 |
Neocosmospora solani | NFCCI 2315 | 8.06 ± 0.65 | 0.34 ± 0.07 | 7.61 ± 0.12 |
Fusarium annulatum | NFCCI 3072 | 6.83 ± 0.09 | - | 7.75 ± 0.15 |
Fusarium glycines | NFCCI 3048 | 5.64 ± 0.12 | 2.00 ± 0.44 | 7.39 ± 0.24 |
Fusarium annulatum | NFCCI 3300 | 7.10 ± 0.34 | 0.66 ± 0.05 | 7.62 ± 0.54 |
Fusarium annulatum | NFCCI 2964 | 7.07 ± 0.19 | 1.11 ± 0.18 | 7.5 ± 0.13 |
Fusarium mangiferae | NFCCI 2885 | 7.97 ± 0.28 | - | 7.8 ± 0.15 |
Fusarium grosmichelii | NFCCI 3243 | 6.37 ± 0.59 | 1.44 ± 0.083 | 7.57 ± 0.21 |
Fusarium annulatum | NFCCI 2962 | 7.42 ± 0.06 | 3.26 ± 0.23 | 7.49 ± 0.17 |
Fusarium nanum | NFCCI 5192 | 6.40 ± 0.18 | - | 7 ± 0.14 |
Fusarium sacchari | NFCCI 3093 | 8.61 ± 0.83 | 2.31 ± 0.58 | 7.32 ± 0.22 |
Fusarium sulawesiense | NFCCI 2956 | 6.44 ± 0.37 | - | 7.44 ± 0.29 |
Neocosmospora metavorans | NFCCI 5193 | 6.25 ± 0.46 | - | 7.34 ± 0.17 |
Fusarium sulawesiense | NFCCI 2886 | 5.89 ± 0.27 | - | 7.34 ± 0.12 |
Fusarium annulatum | NFCCI 2959 | 6.13 ± 0.49 | - | 7.29 ±0.18 |
Fusarium sulawesiense | NFCCI 3031 | 8.99 ± 0.67 | - | 7.31 ± 0.48 |
Fusarium compactum | NFCCI 2946 | 8.89 ± 0.11 | 0.08 ± 0.04 | 7.44 ± 0.42 |
Neocosmospora vasinfecta | NFCCI 2960 | 6.64 ± 0.41 | 4.11 ± 0.17 | 7.44 ± 0.13 |
Fusarium brachygibbosum | NFCCI 3703 | 5.74 ± 0.32 | 0.15 ± 0.06 | 8.79 ± 0.04 |
Fusarium irregulare | NFCCI 5194 | 6.58 ± 0.48 | 1.88 ± 0.06 | 8.5 ± 0.20 |
Neocosmospora oblonga | NFCCI 2150 | 5.06 ± 0.19 | - | 8.67 ± 0.37 |
Neocosmospora metavorans | NFCCI 3475 | 6.51 ± 0.22 | - | 8.64 ± 0.06 |
Fusarium commune | NFCCI 2871 | 8.15 ± 0.18 | - | 8.67 ± 0.18 |
Neocosmospora metavorans | NFCCI 4095 | 6.71 ± 0.37 | - | 8.96 ± 0.28 |
Fusarium spinosum | NFCCI 5195 | 9.15 ± 0.64 | - | 8.9 ± 0.07 |
Fusarium microconidium | NFCCI 3020 | 8.52 ± 0.13 | - | 8.82 ± 0.08 |
Fusarium cugenangense | NFCCI 2872 | 7.01 ± 0.07 | 4.47 ± 0.51 | 8.69 ± 0.15 |
Fusarium irregulare | NFCCI 2460 | 9.04 ± 0.13 | - | 8.84 ± 0.03 |
Fusarium annulatum | NFCCI 3065 | 6.22 ± 0.42 | 0.20 ± 0.06 | 8.93 ± 0.17 |
Fusarium tardicrescens | NFCCI 680 | 7.12 ± 0.34 | 0.47 ± 0.07 | 8.87 ± 0.05 |
Fusarium sacchari | NFCCI 5196 | 9.18 ± 0.18 | 0.60 ± 0.06 | 7.87 ± 0.05 |
Fusarium lacertarum | NFCCI 5197 | 7.79 ± 2.1 | 0.49 ± 0.17 | 8.03 ± 0.02 |
Fusarium irregulare | NFCCI 5198 | 11.30 ± 4.8 | - | 8.36 ± 0.15 |
Fusarium annulatum | NFCCI 2470 | 10.71 ± 0.29 | - | 7.87 ± 0.13 |
Fusarium sacchari | NFCCI 3091 | 5.68 ± 0.17 | - | 7.28 ± 0.05 |
Neocosmospora metavorans | NFCCI 5199 | 5.35 ± 0.57 | - | 7.42 ± 0.17 |
Fusarium brachygibbosum | NFCCI 3074 | 7.80 ± 0.69 | 0.01 ± 0.05 | 7.72 ± 0.21 |
Neocosmospora suttoniana | NFCCI 2961 | 10.24 ± 0.7 | 0.67 ± 0.07 | 8.17 ± 0.45 |
Fusarium lacertarum | NFCCI 3049 | 7.22 ± 0.51 | 2.39 ± 0.39 | 7.19 ± 0.16 |
Fusarium sacchari | NFCCI 3092 | 5.79 ± 0.14 | - | 7.26 ± 0.15 |
Fusarium annulatum | NFCCI 1127 | 5.56 ± 0.61 | - | 6.92 ± 0.09 |
Fusarium fabacearum | NFCCI 3706 | 7.30 ± 0.47 | 1.00 ± 0.20 | 8.6 ± 0.05 |
Fusarium compactum | NFCCI 2904 | 6.45 ± 0.18 | 3.33 ± 0.51 | 7.02 ± 0.04 |
Fusarium lacertarum | NFCCI 3038 | 7.59 ± 0.09 | 0.16 ± 0.06 | 8.07 ± 0.15 |
Fusarium annulatum | NFCCI 2953 | 7.38 ± 0.15 | 2.21 ± 0.12 | 7.85 ± 0.17 |
Fusarium tardichlamydosporum | NFCCI 3051 | 7.99 ± 0.12 | 2.19 ± 0.18 | 7.92 ± 0.13 |
Fusarium duoseptatum | NFCCI 681 | 6.37 ± 0.28 | - | 6.86 ± 0.12 |
Fusarium annulatum | NFCCI 3270 | 5.14 ± 0.19 | 4.84 ± 0.36 | 7.24 ± 0.17 |
Fusarium verticillioides | NFCCI 2945 | 5.43 ± 1.2 | - | 7.18 ±0.3 |
Neocosmospora vasinfecta | NFCCI 2972 | 7.61 ± 2.1 | - | 7.32 ± 0.02 |
Fusarium annulatum | NFCCI 2053 | 4.64 ± 0.09 | 3.78 ± 0.55 | 7.73 ± 0.5 |
Fusarium proliferatum | NFCCI 3282 | 6.51 ± 3.2 | 0.16 ± 0.19 | 7.55 ± 0.12 |
Fusarium fabacearum | NFCCI 5200 | 10.07 ± 0.17 | 14.25 ± 0.28 | 8.11 ± 0.16 |
Fusarium tardicrescens | NFCCI 5201 | 11.23 ± 0.38 | 15.82 ± 0.54 | 8.2 ± 0.11 |
Fusarium sacchari | NFCCI 4889 | 14.17 ± 2.7 | 5.95 ± 0.61 | 8.23 ± 0.04 |
Albonectria rigidiuscula | NFCCI 5202 | 14.03 ± 0.07 | 0.16 ± 0.04 | 7.39 ± 0.13 |
Fusarium tardichlamydosporum | NFCCI 1895 | 7.80 ± 1.8 | 0.12 ± 0.05 | 7.27 ± 0.24 |
Fusarium pernambucanum | NFCCI 5203 | 9.90 ± 0.15 | 1.04 ± 0.11 | 8.09 ± 0.15 |
Fusarium carminascens | NFCCI 5204 | 11.15 ± 2.4 | 13.54 ± 0.62 | 8.44 ± 0.19 |
Fusarium nirenbergiae | NFCCI 4859 | 6.52 ± 0.08 | - | 7.5 ± 0.32 |
Fusarium irregulare | NFCCI 5205 | 9.32 ± 1.6 | - | 7.59 ± 0.27 |
Fusarium brachygibbosum | NFCCI 4972 | 11.03 ± 0.15 | - | 7.66 ± 0.21 |
Fusarium brachygibbosum | NFCCI 5206 | 8.52 ± 2.9 | - | 7.66 ± 0.51 |
Fusarium pernambucanum | NFCCI 5207 | 9.80 ± 2.6 | 1.43 ± 0.16 | 7.22 ± 0.18 |
Fusarium oxysporum | NFCCI 4759 | 7.69 ± 0.14 | 2.22 ± 0.43 | 7.12 ± 0.16 |
Fusarium verticillioides | NFCCI 4963 | 10.55 ± 3.7 | - | 7.55 ± 0.14 |
Fusarium verticillioides | NFCCI 2696 | 11.05 ± 2.7 | - | 7.85 ± 0.05 |
Fusarium compactum | NFCCI 5208 | 4.41 ± 0.13 | 1.146 ± 0.13 | 6.67 ± 0.07 |
Fusarium gossypinum | NFCCI 2467 | 4.59 ± 0.17 | 0.27 ± 0.08 | 8.29 ± 1.5 |
Fusarium acutatum | NFCCI 5209 | 4.69 ± 0.15 | 0.29 ± 0.06 | 6.38 ± 0.7 |
Neocosmospora suttoniana | NFCCI 5210 | 7.50 ± 3.7 | 0.90 ± 0.08 | 7.86 ± 0.36 |
Neocosmospora metavorans | NFCCI 4885 | 7.12 ± 2.5 | 0.86 ± 0.07 | 7.94 ± 0.59 |
Fusarium glycines | NFCCI 1788 | 11.20 ± 0.13 | 1.05 ± 0.10 | 8.04 ± 0.16 |
Fusarium tardichlamydosporum | NFCCI 2491 | 13.59 ± 0.19 | 1.38 ± 0.11 | 8 ± 0.08 |
Albonectria rigidiuscula | NFCCI 4888 | 13.77 ± 0.27 | 1.09 ± 0.08 | 8.13 ± 0.8 |
Neocosmospora suttoniana | NFCCI 4830 | 4.67 ± 2.6 | 1.01 ± 0.05 | 7.65 ±0.02 |
Neocosmospora suttoniana | NFCCI 5211 | 8.56 ± 3.1 | - | 8 ± 0.07 |
Fusarium annulatum | NFCCI 5212 | 10.94 ± 1.2 | - | 8.14 ± 0.4 |
Fusarium lumajangense | NFCCI 4180 | 8.26 ± 2.7 | 1.07 ± 0.39 | 8.18 ±0.05 |
Fusarium lacertarum | NFCCI 4792 | 9.66 ± 1.8 | - | 8.23 ± 0.1 |
Fusarium annulatum | NFCCI 2949 | 6.70 ± 0.27 | - | 8.16 ± 0.02 |
Fusarium sulawesiense | NFCCI 4919 | 8.72 ± 0.44 | - | 8.25 ± 0.14 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rana, S.; Singh, S.K.; Dufossé, L. Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India. J. Fungi 2022, 8, 662. https://doi.org/10.3390/jof8070662
Rana S, Singh SK, Dufossé L. Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India. Journal of Fungi. 2022; 8(7):662. https://doi.org/10.3390/jof8070662
Chicago/Turabian StyleRana, Shiwali, Sanjay Kumar Singh, and Laurent Dufossé. 2022. "Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India" Journal of Fungi 8, no. 7: 662. https://doi.org/10.3390/jof8070662