Next Article in Journal
Synchrospora gen. nov., a New Peronosporaceae Genus with Aerial Lifestyle from a Natural Cloud Forest in Panama
Next Article in Special Issue
Nutritional, Bioactive, and Flavor Components of Giant Stropharia (Stropharia rugoso-annulata): A Review
Previous Article in Journal
Whole-Genome Sequence Analysis of Candida glabrata Isolates from a Patient with Persistent Fungemia and Determination of the Molecular Mechanisms of Multidrug Resistance
Previous Article in Special Issue
Phenylalanine Ammonia-Lyase: A Key Gene for Color Discrimination of Edible Mushroom Flammulina velutipes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 9
Issue 5
10.3390/jof9050516
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Gene from Ganoderma lucidum with Similarity to nmrA of Filamentous Ascomycetes Contributes to Regulating AreA

by
He Liu
†,
Jinjin Qiao
†,
Jiaolei Shangguan
,
Xiaoyu Guo
,
Zhenzhen Xing
,
Xiaolin Zhou
,
Mingwen Zhao
and
Jing Zhu
*
Department of Microbiology, College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Fungi 2023, 9(5), 516; https://doi.org/10.3390/jof9050516
Submission received: 28 March 2023 / Revised: 25 April 2023 / Accepted: 25 April 2023 / Published: 26 April 2023
(This article belongs to the Special Issue Biotechnology of Edible Fungi 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Fungal AreA is a key nitrogen metabolism transcription factor in nitrogen metabolism repression (NMR). Studies have shown that there are different ways to regulate AreA activity in yeast and filamentous ascomycetes, but in Basidiomycota, how AreA is regulated is unknown. Here, a gene from Ganoderma lucidum with similarity to nmrA of filamentous ascomycetes was identified. The NmrA interacted with the C-terminal of AreA according to yeast two-hybrid assay. In order to determine the effect of NmrA on the AreA, 2 nmrA silenced strains of G. lucidum, with silencing efficiencies of 76% and 78%, were constructed using an RNA interference method. Silencing nmrA resulted in a decreased content of AreA. The content of AreA in nmrAi-3 and nmrAi-48 decreased by approximately 68% and 60%, respectively, compared with that in the WT in the ammonium condition. Under the nitrate culture condition, silencing nmrA resulted in a 40% decrease compared with the WT. Silencing nmrA also reduced the stability of the AreA protein. When the mycelia were treated with cycloheximide for 6 h, the AreA protein was almost undetectable in the nmrA silenced strains, while there was still approximately 80% of the AreA protein in the WT strains. In addition, under the nitrate culture, the content of AreA protein in the nuclei of the WT strains was significantly increased compared with that under the ammonium condition. However, when nmrA was silenced, the content of the AreA protein in the nuclei did not change compared with the WT. Compared with the WT, the expression of the glutamine synthetase gene in nmrAi-3 and nmrAi-48 strains increased by approximately 94% and 88%, respectively, under the ammonium condition, while the expression level of the nitrate reductase gene in nmrAi-3 and nmrAi-48 strains increased by approximately 100% and 93%, respectively, under the nitrate condition. Finally, silencing nmrA inhibited mycelial growth and increased ganoderic acid biosynthesis. Our findings are the first to reveal that a gene from G. lucidum with similarity to the nmrA of filamentous ascomycetes contributes to regulating AreA, which provides new insight into how AreA is regulated in Basidiomycota.

1. Introduction

Nitrogen is the raw material of protein, nucleic acid, and other biological macromolecules, and plays important roles in the growth and development of animals, plants, and microorganisms. How to improve nitrogen utilization and promote biological growth and metabolism have become hot research topics [1,2]. Fungi can use a variety of nitrogen sources, including inorganic and organic nitrogen sources. However, fungi preferentially utilize preferred nitrogen sources, such as ammonium salt and glutamine. When there is no preferred nitrogen source, fungi assimilate the non-preferred nitrogen sources, such as nitrate and proline. This regulatory strategy for nitrogen source utilization is called nitrogen metabolism repression (NMR) [3,4,5]. In fungi, NMR is mediated by GATA-type transcription factors. These are considered to be Gln3 and Gat1 in Saccharomyces cerevisiae, AreA in Aspergillus nidulans and Ganoderma lucidum [6,7,8], and NIT2 in Neurospora crassa [9].
The regulation of these GATA-type transcription factors on nitrogen metabolism has been reported in many fungi [3,10,11]. In addition, AreA has important impacts on the growth and development, virulence, and secondary metabolism of fungi [3,12,13]. However, the mechanism of nitrogen source regulation by AreA activity has mainly been studied in yeast and Aspergillus. In S. cerevisiae, under the preferred nitrogen condition, Gln3 and Gat1 were phosphorylated by interacting with the phosphorylated Ure2 and then located in the cytoplasm. Under the nitrogen starvation condition, Ure2 was dephosphorylated by Tap42-PP2A and dissociated from Gln3 and Gat1, which led to the transfer of Gln3 and Gat1 from the cytoplasm to the nucleus [14]. In A. nidulans, NmrA interacted with the C-terminal domain of the AreA protein that contains the zinc finger structure domain [15,16,17], and acted as a negative regulatory protein of AreA [18,19]. When the C-terminal of AreA or NmrA was deleted, some genes involved in nitrogen metabolism were overexpressed under the preferred nitrogen condition [18,20]. The NmrA protein in A. nidulans was gradually degraded when the external environment changed from preferred nitrogen to the nitrogen starvation condition [21]. However, the mechanism of how AreA is regulated in Basidiomycota has not been studied yet. According to the current research, the proteins involved in the regulation of AreA activity in yeast and some filamentous ascomycetes are different [22]; the regulation of AreA in Basidiomycota is worth studying further.
G. lucidum is an important medicinal basidiomycete, and has many active metabolites, such as ganoderic acid, polysaccharides, proteins, and steroids [23,24]. These active ingredients have important pharmacological functions [25]. The types or concentrations of nitrogen sources significantly affect the mycelial growth and the biosynthesis of active metabolites in G. lucidum [26,27]. Furthermore, AreA, a global transcription factor, played an important role in regulating the synthesis of secondary metabolites of G. lucidum [8,28]. However, there are few reports on how AreA responds to the changes in external nitrogen sources in Basidiomycota. Therefore, it is of great significance to study how AreA responds to nitrogen sources in G. lucidum.
In this study, we identified a homologous gene of the Ganoderma nmrA. The NmrA protein interacted with the C-terminal of AreA, and influenced the expression of genes involved in nitrogen metabolism, mycelial growth, and secondary metabolism. Further study showed that NmrA was required for the stability of the AreA protein, but it did not influence the nuclear localization of AreA. Our findings provide insight into how AreA is regulated in Basidiomycota.

2. Materials and Methods

2.1. The G. lucidum Strains and Growth Conditions

The G. lucidum strain (ACCC53264) was provided by the Agricultural Culture Collection of China (ACCC). Complete yeast medium (CYM) was used to culture the strains. The components of the CYM included 2% glucose, 1% maltose, 0.2% tryptone, 0.2% yeast extract, 0.4% KH2PO4, and 0.05% MgSO4 (pH 5.5). Escherichia coli DH5α (Sangon Biotech, Shanghai, China) was grown in Luria–Bertani (LB) media containing ampicillin (100 μg·mL−1) or kanamycin (50 μg·mL−1) for extracting the constructed plasmid. Different nitrogen media contained 2% glucose, 0.5% KH2PO4, 0.5% MgSO4, 15 mM (NH4)2SO4, or 30 mM NaNO3. The WT and nmrA silenced strains were cultured in media at 28 °C for 5 days. Finally, the colonies of the WT and nmrA silenced strains were photographed, and their diameters were measured. The WT and nmrA silenced strains were cultured in CYM liquid medium for 4 days, and then they were cultured under the ammonium or nitrate conditions for 3 days.

2.2. Analysis of NmrA and Ure2 and Construction of the nmrA Silenced Strains

The sequences of NmrA from A. nidulans (AAC39442.1), Fusarium fujikuroi (CAA75863.1), N. crassa OR74A (XP_961314.3), and Ure2 of S. cerevisiae (AAM93186.1) were obtained from NCBI. These sequences were used as queries in the local protein library of G. lucidum to obtain the homologous protein. SMART (http://smart.embl-heidelberg.de/, accessed on 28 March 2023) was used to analyze the conserved domain of Ure2 and NmrA. DNAMAN software was used for the homologous sequence alignment.
The total RNA of the samples was extracted with RNAisoTM Plus Reagent and a Hiscript®III RT SuperMix for real-time PCR (RT-qPCR) (Vazyme, Nanjing, China) was used to convert the RNA into cDNA. Using the paired primers listed in Table 1, with the cDNA of G. lucidum as the template, the silencing sequences of nmrA were obtained by PCR. The PCR products were digested using KpnI and XbaI and then cloned into the previously constructed pAN7-ura3-dual-hyg vector [29], in which a glyceraldehyde-3-phosphate dehydrogenase promoter was used to express the antisense strand of nmrA. The constructed pAN7-nmrA-hyg plasmids were introduced into the protoplast of the wild-type (WT) strain by an electroporation method [30]. A CYM medium containing 100 μg·mL−1 hygromycin B (Sangon Biotech, Shanghai, China) was used to select the transformants, and the silencing efficiencies of transformants were verified by RT-qPCR with the primers listed in Table 1. The 18S RNA was used as the housekeeping gene. A ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) and the 2–ΔΔCT method (Livak and Schmittgen 2001) were used to analyze all samples on a Mastercycler®ep realplex (Eppendorf, Hamburg, Germany). The nmrA silenced strains were named nmrAi strains, and the WT strain transformed with pAN7-ura3-dual-hyg plasmid was named the empty-vector control (CK).

2.3. Yeast Two-Hybrid Assay

The cDNA of G. lucidum was used as the template, and the primers in Table 1 were used to obtain the sequences of the full length of areA, the N- and C-terminal of areA, and nmrA by PCR. These sequences were ligated to the pGBKT7 bait vector or the pGADT7 prey vector. Yeast Y2H gold strains were co-transformed by pGBKT7-areA and pGADT7-nmrA. The Y2H gold strains were screened on synthetic dropout media (SD-leu/Trp/Ade/AbA/X-α-gal/15mM 3-AT) at 28 °C for 3–5 days, and the interactions were assessed on SD media (SD-leu/Trp /His/Ade/AbA/X-α-gal/5 mM 3-AT). Protein interactions were assessed based on the expression of different reporters under the control of GAL4-responsive promoters [31]. The yeast strains co-transformed with pGBKT7-53 and pGADT7-T were used as the positive control, and pGBKT7-Lam and pGADT7-T were used as the negative control. Protein interactions were assessed based on the production of blue colonies on the plates.

2.4. Protein Extraction

For the extraction of total protein, 0.1 g of fresh mycelia was ground into a powder with liquid nitrogen and added to 800 μL of extraction buffer, which contained 0.5 M Tris-HCl, 10% SDS, 20% glycerin, 1 M dithiothreitol, and 100 mM phenylmethyl sulfonyl fluoride. All samples were placed on ice for 10 min and then centrifuged at 10,000× g at 4 °C for 10 min. The supernatant was taken as the protein sample. The NE-PERTM Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific, Shanghai, China) were used to extract the nuclear and cytoplasmic proteins. In brief, 0.04 g of fresh mycelia was weighed and fully ground. According to the manufacturer’s instructions, an extraction buffer was added to the samples to extract the cytoplasmic and nuclear proteins, respectively.

2.5. Western Blot Analysis

Protein samples and 1 × SDS buffer (65 mM Tris-HCl, pH 6.8, 2% w/v SDS, 10% glycerol, 2.5% v/v β-mercaptoethanol, and 0.05% w/v bromophenol blue) were directly mixed and boiled at 100 °C for 10 min. The protein samples were separated on SDS-PAGE gels (12% polyacrylamide) and transferred to the polyvinylidene difluoride membranes using a Trans-Blot SD Cell and Systems (Bio-Rad, Hercules, CA, USA). After being blocked in 5% milk for 1 h at room temperature, the membranes were incubated with the primary antibody of β-tubulin (diluted 1: 1000) protein or AreA protein (diluted 1: 1000) overnight at 4 °C. The AreA protein was expressed and purified in our previously study [8]. The purified protein was sent to Genscript Biotech Corporation (Nanjing, China) to obtain the polyclonal antibody of AreA. The membranes were washed three times with TBST buffer (0.1% Tween-20 in 1 × TBS buffer) before being incubated with an appropriate secondary antibody. HRP goat anti-Mouse IgG antibody (diluted 1: 1000) and anti-Rabbit IgG antibody (diluted 1: 1000) were used as the secondary antibodies. The membranes were incubated with the secondary antibody for 1 h at room temperature, and then they were incubated using an ECL Western Blotting Detection Kit (Vazyme, Nanjing, China) and detected by a chemiluminescence detection system (Bio-Rad, Hercules, CA, USA).

2.6. Enzyme Activity Analysis

The fresh mycelia (0.5 g) were ground in liquid nitrogen and 2 mL of extraction buffer, which contained 50 mM Tris-HCl (pH 8.0), 2 mM MgSO4·7H2O, 4 mM DTT, and 400 mM sucrose, was added to the samples. All samples were centrifuged at 12,000× g at 4 °C for 15 min. The supernatant was collected for subsequent detection. The activity of glutamine synthetase (GS) was detected according to our previous methods [32]. The activity of nitrate reductase (NR) was detected by a Solarbio kit (Solarbio, Beijing, China). According to the guidelines of the kit, the reaction reagent was added to the supernatant, and finally, the absorbance at 340 nm was detected. The NR activity was calculated as an increase in the OD340 per 1 mg of protein after a 1 h reaction.

2.7. Quantification of Ganoderic Acid (GA)

The total GA was detected using the HPLC method according to the previously described method [33]. Briefly, dried mycelia (0.05 g) were weighed and fully ground and then added to 2 mL of a 10% (w/v) KOH-75% (v/v) ethanol solution. The samples were left for 2 h for saponification and the mixture was extracted 3 times with 2 mL hexane. Samples of the hexane layer were collected and vaporized under nitrogen gas until dry. The residue was dissolved in 0.5 mL of acetonitrile. An Agilent 1290 Infinity UPLC system (Agilent Technologies, Santa Clara, CA, USA) was used with an Agilent 1290 diode array detector and an Agilent Zorbax Eclipse Pluss C18 Rapid Resolution HD 18-Micron column (2.1 ×100 mm) (Agilent, Tokyo, Japan).

2.8. Statistical Analysis

The experiments was repeated three times. Each error bar represents the standard deviation (SD) of the mean of three replicates. Statistical analysis was performed using the one-way ANOVA provided by GraphPad Prism 8.0 software.

3. Results

3.1. A Homologous NmrA Protein Was Found in G. lucidum

AreA is the key transcription factor that functions in nitrogen metabolism, fungal growth, and secondary metabolism [8,34,35]. It was reported that NmrA in filamentous ascomycetes interacted with AreA, and Ure2 in S. cerevisiae interacted with Gln3 and Gat1 [22], but the AreA-interacting proteins in Basidiomycota are unknown. Here, the ure2 (GenBank accession number: NP_014170.1) of S. cerevisiae and nmrA (GenBank accession number: XP_681437.1) of A. nidulans were used to determine the homologous genes according to the local genome bank of G. lucidum.
A suspected nmrA homologous gene (GenBank accession number: OP846035) was obtained in G. lucidum. The cDNA sequence of this nmrA gene had an open reading frame of 987 bp and encoded 329 amino acids with a deduced protein molecular weight of 36.74 kDa. The NmrA of G lucidum exhibited 60.03% amino acid identity with that of filamentous ascomycetes, including F. fujikuroi and N. crassa (Figure S1). The NmrA protein contained a Rossmann-type folded NAD+ and an NADP+ binding domain (Pfam05368, cd08947) (Figure 1A). This domain enables NmrA to distinguish between the oxidized and reduced forms of dinucleotides in A. nidulans [36]. The short chain dehydrogenase/reductase (SDR) family also contains a Rossmann folding domain. The difference between NmrA and SDR is that the proteins of SDR family have a Tyr-X-X-X-Lys structure, which is crucial for SDR activity [37]. However, the tyrosine in the Tyr-X-X-X-Lys structure is replaced by methionine, which leads to different functions between the NmrA and the SDR family [38]. We analyzed the sequences of NmrA in G. lucidum and found that the NmrA had the Met-X-X-X-Lys structure (Figure 1B). These results indicate that the homologous protein of NmrA was identified in G. lucidum.
A total of 4suspected homologous proteins of Ure2 (Gl23507, Gl23543, Gl24307, and Gl26599) were found in G. lucidum that had a conserved glutathione S-transferase (GST) domain (Figure S2) according to the Ure2 protein (the amino acids sequence accession number: AAM93186.1) in S. cerevisiae. The Ure2 in S. cerevisiae has a “flexible cap region” that determines its different function from glutathione S-transferase [39,40]. However, we found that the four suspected proteins of Ure2 in G. lucidum did not contain this special domain (Figure 1C), which indicates that these proteins of G. lucidum might not be homologous to the Ure2 of S. cerevisiae. In summary, the NmrA homologous protein in G. lucidum was used for studying further.

3.2. The NmrA Interacted with the C-Terminal of AreA According to a Yeast Two-Hybrid Assay

As a negative regulatory protein in nitrogen metabolism, NmrA interacted with AreA in A. nidulans and Nit2 (the homologous protein of AreA) in N. crassa [15,17]. Therefore, a yeast two-hybrid experiment was used to verify the interaction of AreA with NmrA in G. lucidum. The C-terminal of the AreA contained a zinc finger structure domain while the N-terminal contained a pfam DUF1752 domain. The full length of the nmrA was cloned into a pGADT7 prey vector. The sequences of areA-N and areA-C (Figure 2A) and the full length of areA were inserted into the pGBKT7 bait vector, respectively. These constructed vectors were then transformed into the yeast Y2H Gold strains. As shown in Figure 2B, yeast strains transformed with the pGADT7-nmrA and pGBKT7-areA-N grew on an SD-Trp/Leu medium. However, they did not grow on an SD-Trp/Leu/His/Ade medium. The above results showed that there was no interaction between AreA-N and NmrA. On the contrary, the yeast strains transformed with pGADT7-nmrA and pGBKT7-areA-C could grow on SD-Trp/Leu/His/Ade medium. The results of the yeast two-hybrid experiment showed that NmrA interacted with the C-terminal domain of AreA in G. lucidum.

3.3. Effect of NmrA on the Content of AreA Protein

In order to study the effect of NmrA on AreA, we first constructed the nmrA silenced strains using an RNA interference method. The silencing efficiencies of the strains were determined using RT-qPCR. Finally, four nmrA silenced strains, nmrAi-1, nmrAi-3, nmrAi-30, and nmrAi-48, were selected, with the expression reduced by approximately 74%, 79%, 77%, and 72%, respectively, compared with the WT (Figure 3A). Under the ammonium condition, the nmrA expression of nmrAi-1, nmrAi-3, nmrAi-30, and nmrAi-48 was decreased by approximately 71%, 68%, 76%, and 67%, respectively, compared with that of WT (Figure 3B). Under the nitrate condition, the nmrA expression of nmrAi-1, nmrAi-3, nmrAi-30, and nmrAi-48 was decreased by approximately 73%, 69%, 74%, and 77%, respectively, compared with that of WT (Figure 3C). nmrAi-3 and nmrAi-48 were randomly selected for the following experiments.
We examined the effect of NmrA on the expression of areA and the AreA protein content when mycelia were cultured in ammonium or nitrate conditions as sole nitrogen sources. As shown in Figure 3D, silencing of nmrA did not influence the expression of areA either in ammonium or nitrate. However, the intracellular AreA protein content was significantly reduced in the nmrA silenced strains compared with that in the WT (Figure 3E). Under the ammonium condition, the protein content of AreA in nmrAi-3 and nmrAi-48 was decreased by approximately 65% and 70%, respectively, compared with that of the WT (Figure 3F). While under the nitrate condition, the content of AreA in the nmrAi-3 and nmrAi-48 silenced strains was decreased by approximately 30% and 46%, respectively, compared with that of the WT (Figure 3F). These results indicate that silencing nmrA decreased the content of AreA.

3.4. Effect of NmrA on the Stability of the AreA Protein

In order to further study the effect of NmrA on the stability of the AreA protein, cycloheximide (CHX) was used to treat the mycelia cultured on CYM to detect the degradation of the AreA protein. CHX is an inhibitor of eukaryotic protein synthesis and is usually used to detect protein degradation [41,42]. After the WT and nmrA silenced strains were treated with CHX, the protein content of AreA was detected by Western blot. As shown in Figure 4, the protein content of AreA in the WT was decreased gradually with the prolongation of the CHX treatment time. At 6 h, approximately 80% of the AreA protein was still present, compared with the untreated strains. Compared with the change in AreA protein content in the WT, the AreA content in nmrA silenced strains decreased faster. After 6 h of treatment, the AreA protein content was nearly undetectable in the nmrA silenced strains. These results indicate that silencing nmrA reduced the stability of the AreA protein.

3.5. Effect of NmrA on the Subcellular Localization of AreA

As a key transcription factor responsible for regulating nitrogen metabolism, AreA enters the nucleus and regulates the expression of its downstream-related genes [20,43,44,45]. Therefore, the contents of AreA in the nucleus were detected under the ammonium or nitrate condition. As shown in Figure 5A,B, the content of AreA protein in the nuclei of the WT strain was increased 4.16-fold under the nitrate condition compared with that under the ammonium condition. The contents of the AreA protein in the nucleus of the nmrAi-3 and nmrAi-48 strains showed no significant changes compared with that of the WT, no matter the conditions (ammonium salt or nitrate) (Figure 5A,B). However, the content of the AreA protein in the cytoplasm of the WT, nmrAi-3, and nmrAi-48 strains was increased under the ammonium condition compared with those under the condition of nitrates (Figure 5C,D). These results suggest that although silencing of nmrA decreased the intracellular AreA content, it did not affect the AreA content of the nuclei.

3.6. Effect of NmrA on the Expression Levels of Glutamine Synthase Gene and Nitrate Reductase Gene

AreA can activate the expression of the glutamine synthase gene (gs) and the nitrate reductase gene (nr) by binding to their promoter regions in G. lucidum [32]. Therefore, we examined these gene expressions and enzyme activities. As shown in Figure 6A,B, compared with the WT, the expression of gs in nmrAi-3 and nmrAi-48 was increased by approximately 94% and 88%, respectively, and the enzyme activity was also increased by approximately 65% and 40%, respectively, under the ammonium condition (Figure 6B). However, compared with the WT, there were no significant changes in the expression level of gs or the enzyme activity of glutamine synthase under the nitrate condition. The expression and enzyme activity of nr showed different results from those of gs. Compared with the WT, the expression level or enzyme activity of nitrate reductase of nmrAi-3 and nmrAi-48 did not change significantly under the ammonium condition. However, under the nitrate condition, the expression of nr in nmrAi-3 and nmrAi-48 strains was increased by approximately 100% and 93%, respectively, and the activity of NR increased by approximately 64% and 45%, respectively (Figure 6C,D). These results indicate that silencing of nmrA influenced the expression levels of gs and nr.

3.7. Effect of NmrA on Mycelial Growth and Ganoderic Acid Biosynthesis

AreA has important impacts on fungal growth and secondary metabolism [3,8]. First, we investigated mycelial growth when nmrA was silenced. As shown in Figure 7A,B, compared with the WT, the growth of nmrAi-3 and nmrAi-48 were significantly inhibited under both the ammonium salt and nitrate conditions. Under the ammonium condition, the diameters of nmrAi-3 and nmrAi-48 were decreased by approximately 25% and 26%, respectively, compared with that in the WT. Under the nitrate condition, the diameters were decreased by approximately 33% and 38%, respectively, in the nmrAi-3 and nmrAi-48 strains. In addition, the biomasses of nmrAi-3 and nmrAi-48 were decreased by approximately 21% and 23%, respectively, compared with that of the WT under the ammonium condition. Under the nitrate condition, the biomasses of nmrAi-3 and nmrAi-48 were decreased by approximately 20% and 26%, respectively, compared with that of the WT (Figure 7C). The above results suggest that silencing of nmrA has a negative effect on mycelial growth.
The ganoderic acid (GA) contents in nmrAi-3 and nmrAi-48 were increased by approximately 25% and 31%, respectively, under the ammonium condition compared with the WT. However, the GA contents of nmrAi-3 and nmrAi-48 under the nitrate condition did not change significantly compared with the WT (Figure 7D). In addition, the expression levels of genes involved in GA biosynthesis, such as hmgr (3-hydroxy-3-methylglutaryl-CoA reductase), sqs (squalene synthase), and osc (lanosterol synthase), were also investigated (Figure S3). We found that the expression levels of hmgr and osc of nmrAi-3 and nmrAi-48 increased under the ammonium condition while the expression levels of sqs remained unchanged. Although the expression level of hmgr was decreased under the nitrate condition, the sqs expression level was increased, and the osc expression level remained unchanged. These results indicate that silencing of nmrA could influence GA biosynthesis.

4. Discussion

Fungi can use a wide range of nitrogen sources. The mechanism of how fungi control nitrogen utilization has been studied in yeast and filamentous ascomycetes. Fungal AreA is a key nitrogen metabolism transcription factor in NMR. Many studies have shown that there are different ways to regulate AreA activity in yeast and filamentous ascomycetes [22], but in Basidiomycota, how AreA is regulated is unknown. In this study, a homologous protein of NmrA was identified, and its interaction with AreA was shown in G. lucidum. In addition, NmrA was shown to be required for the stability of the AreA protein, mycelial growth, and secondary metabolism.
The NmrA in filamentous fungi is a negative regulatory protein in the NMR, and it plays important roles in fungal growth, development, and toxicity [18,19]. The growth of A. nidulans was significantly inhibited after the deletion of nmrA [18], and mycelial growth inhibition was also observed after the deletion of nmrA in A. flavus and Metarhizium anisopliae [19,46]. In addition, the deletion of nmrA in A. flavus resulted in increased conidia production and enhanced adaptation to the environment [46]. While the conidia yield and virulence decreased when nmrA was deleted in M. anisopliae [19], mutation of nmrA did not affect the virulence of F. fujikuroi [3,47]. Here, we found that the NmrA affect the mycelial growth and the ganoderic acid content of G. lucidum.
Fungal NmrA plays important roles in not only many physiological processes but also in nitrogen metabolism, such as nitrogen sources utilization. In N. crassa, glutamine reduced deaminase production. However, when nmr-1 (the nmrA homologous gene) was mutated, the enzyme activity of deaminase was increased under the glutamine condition [48]. The NmrA of G. lucidum influenced the expression of genes involved in nitrogen metabolism, such as genes encoding glutamine synthetase and nitrate reductase. The expression of areA in WT was increased under the nitrate condition compared with that under the ammonium condition, and then the activated AreA regulated the expression of gs and nr [8,32]. Under the nitrate condition, silencing of nmrA led to a further increase in nr expression, which might be due to the reduced inhibitory effect of NmrA on AreA. However, the expression of gs showed the opposite result compared with the expression of nr. The gs expression did not change in the nmrA silenced strains under the nitrate condition. However, it increased in the nmrA silenced strains compared with that in the WT strains under the nitrate condition. The expressions of these genes are not only induced by AreA.The transcription factor NirA could act synergistically with AreA to mediate nitrate reductase enzyme activity in Aspergillus [49]. GCN4, a bZIP transcription factor, also has a pivotal role in the expression of nitrogen-regulated genes and nitrogen metabolism [50]. It interacted with Sko1 to form heterodimers to activate the expression of areA and gs in G. lucidum [51]. These studies not only demonstrate that other factors might participate in the regulation of the gene expression of nr and gs, but also reflect that the regulation of nitrogen utilization is a complex network.
Interaction of proteins, signaling, and post-translational modifications can control the functioning of transcription factors, including subcellular localization, protein stability, and transcriptional regulatory activity [52,53]. NmrA interacted with AreA to regulate the AreA activity in filamentous ascomycetes [15,16,17], but did not influence the entrance to the nucleus of AreA [20]. In A. nidulans, under the nitrogen starvation condition, the content of NmrA protein was decreased, and the inhibitory effect of NmrA on AreA activity was relieved [18,20,21]. In yeast, it was the Ure2 protein that interacted with Gln3 (a homologous protein of AreA) and regulated the transfer of Gln3 to the nuclei to activate gene expression [54]. Additionally, the Gln3 was phosphorylated under the preferred nitrogen condition and then maintained in the cytoplasm. Until now, the post-translational modification has been only found in yeast. In this study, we conducted a preliminary study on the subcellular localization, transcriptional regulatory activity, and protein stability of AreA in G. lucidum. It is NmrA, rather than Ure2, that interacted with AreA in G. lucidum. However, silencing of nmrA did not affect the content of AreA in the nuclei but affected the total content of AreA, especially the cytoplasmic AreA content in G. lucidum. The regulation of AreA may be different in different species, and the detailed mechanism needs to be further studied. Our studies show how the AreA activity is regulated in Basidiomycota and suggest clues for further research.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof9050516/s1, Figure S1 Homologous comparison of the conserved domain of NmrA in filamentous ascomycetes and G. lucidum. Figure S2 Analysis of conserved domains of the Ure2 in S. cerevisiae and four suspected homologous Ure2 in G. lucidum. Figure S3 Expression levels of GA synthesis genes (hmgr, sqs and osc) in the WT, CK, and nmr silenced strains under the ammonium and nitrate conditions.

Author Contributions

Data curation, H.L., J.Q., J.S., Z.X. and X.Z.; formal analysis, J.Z.; funding acquisition, J.Z. and M.Z.; investigation, H.L.; methodology, J.Q., J.S., X.G., Z.X. and X.Z.; software, J.Q. and X.G.; writing—original draft, H.L.; writing—review and editing, J.Z. and M.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially funded by the National Natural Science Foundation of China (project no. 31900065) and the earmarked fund for CARS20.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Vidal, E.A.; Alvarez, J.M.; Araus, V.; Riveras, E.; Brooks, M.D.; Krouk, G.; Ruffel, S.; Lejay, L.; Crawford, N.M.; Coruzzi, G.M.; et al. Nitrate in 2020: Thirty years from transport to signaling networks. Plant Cell 2020, 32, 2094–2119. [Google Scholar] [CrossRef] [PubMed]
  2. Shi, H.; Chen, M.; Gao, L.; Wang, Y.; Bai, Y.; Yan, H.; Xu, C.; Zhou, Y.; Xu, Z.; Chen, J.; et al. Genome-wide association study of agronomic traits related to nitrogen use efficiency in wheat. Theor. Appl. Genet. 2022, 135, 4289–4302. [Google Scholar] [CrossRef] [PubMed]
  3. Tudzynski, B. Nitrogen regulation of fungal secondary metabolism in fungi. Front. Microbiol. 2014, 5, 656. [Google Scholar] [CrossRef] [PubMed]
  4. Marzluf, G.A. Genetic regulation of nitrogen metabolism in the fungi. Microbiol. Mol. Biol. Rev. 1997, 61, 17–32. [Google Scholar] [CrossRef]
  5. Milhomem Cruz-Leite, V.R.; Salem-Izacc, S.M.; Novaes, E.; Neves, B.J.; de Almeida Brito, W.; O’Hara Souza Silva, L.; Paccez, J.D.; Parente-Rocha, J.A.; Pereira, M.; de Almeida Soares, C.M.; et al. Nitrogen catabolite repression in members of paracoccidioides complex. Microb. Pathog. 2020, 149, 104281. [Google Scholar] [CrossRef] [PubMed]
  6. Hofman-Bang, J. Nitrogen Catabolite Repression in Saccharomyces cerevisiae. Mol. Biotechnol. 1999, 12, 35–74. [Google Scholar] [CrossRef]
  7. Georis, I.; Feller, A.; Vierendeels, F.; Dubois, E. The yeast GATA factor Gat1 occupies a central position in nitrogen catabolite repression-sensitive gene activation. Mol. Cell Biol. 2009, 29, 3803–3815. [Google Scholar] [CrossRef]
  8. Zhu, J.; Sun, Z.; Shi, D.; Song, S.; Lian, L.; Shi, L.; Ren, A.; Yu, H.; Zhao, M. Dual functions of AreA, a GATA transcription factor, on influencing ganoderic acid biosynthesis in Ganoderma lucidum. Environ. Microbiol. 2019, 21, 4166–4179. [Google Scholar] [CrossRef]
  9. Tao, Y.; Marzluf, G.A. The NIT2 nitrogen regulatory protein of Neurospora: Expression and stability of nit-2 mRNA and protein. Curr. Genet. 1999, 36, 153–158. [Google Scholar] [CrossRef]
  10. Kmetzsch, L.; Staats, C.C.; Simon, E.; Fonseca, F.L.; Oliveira, D.L.; Joffe, L.S.; Rodrigues, J.; Lourenco, R.F.; Gomes, S.L.; Nimrichter, L.; et al. The GATA-type transcriptional activator Gat1 regulates nitrogen uptake and metabolism in the human pathogen Cryptococcus neoformans. Fungal Genet. Biol. 2011, 48, 192–199. [Google Scholar] [CrossRef]
  11. Giese, H.; Sondergaard, T.E.; Sorensen, J.L. The AreA transcription factor in Fusarium graminearum regulates the use of some nonpreferred nitrogen sources and secondary metabolite production. Fungal Biol. 2013, 117, 814–821. [Google Scholar] [CrossRef]
  12. Kim, E.; Goraksha-Hicks, P.; Li, L.; Neufeld, T.P.; Guan, K.L. Regulation of TORC1 by Rag GTPases in nutrient response. Nat. Cell Biol. 2008, 10, 935–945. [Google Scholar] [CrossRef] [PubMed]
  13. Horst, R.J.; Zeh, C.; Saur, A.; Sonnewald, S.; Sonnewald, U.; Voll, L.M. The Ustilago maydis Nit2 homolog regulates nitrogen utilization and is required for efficient induction of filamentous growth. Eukaryot. Cell 2012, 11, 368–380. [Google Scholar] [CrossRef] [PubMed]
  14. Blinder, D.; Coschigano, P.W.; Magasanik, B. Interaction of the GATA factor Gln3p with the nitrogen regulator Ure2p in Saccharomyces cerevisiae. J. Bacteriol. 1996, 178, 4734–4736. [Google Scholar] [CrossRef] [PubMed]
  15. Xiao, X.; Fu, Y.H.; Marzluf, G.A. The negative-acting NMR regulatory protein of Neurospora crassa binds to and inhibits the DNA-binding activity of the positive-acting nitrogen regulatory protein NIT2. Biochemistry 1995, 34, 8861–8868. [Google Scholar] [CrossRef] [PubMed]
  16. Lamb, H.K.; Ren, J.; Park, A.; Johnson, C.; Leslie, K.; Cocklin, S.; Thompson, P.; Mee, C.; Cooper, A.; Stammers, D.K.; et al. Modulation of the ligand binding properties of the transcription repressor NmrA by GATA-containing DNA and site-directed mutagenesis. Protein Sci. 2004, 13, 3127–3138. [Google Scholar] [CrossRef]
  17. Kotaka, M.; Johnson, C.; Lamb, H.K.; Hawkins, A.R.; Ren, J.; Stammers, D.K. Structural analysis of the recognition of the negative regulator NmrA and DNA by the zinc finger from the GATA-type transcription factor AreA. J. Mol. Biol. 2008, 381, 373–382. [Google Scholar] [CrossRef]
  18. Andrianopoulos, A.; Kourambas, S.; Sharp, J.A.; Davis, M.A.; Hynes, M.J. Characterization of the Aspergillus nidulans nmrA gene involved in nitrogen metabolite repression. J. Bacteriol. 1998, 180, 1973–1977. [Google Scholar] [CrossRef]
  19. Li, C.; Zhang, Q.; Xia, Y.; Jin, K. MaNmrA, a negative transcription regulator in nitrogen catabolite repression pathway, contributes to nutrient utilization, stress resistance, and virulence in entomopathogenic fungus Metarhizium acridum. Biology 2021, 10, 1167. [Google Scholar] [CrossRef]
  20. Todd, R.B.; Fraser, J.A.; Wong, K.H.; Davis, M.A.; Hynes, M.J. Nuclear accumulation of the GATA factor AreA in response to complete nitrogen starvation by regulation of nuclear export. Eukaryot. Cell 2005, 4, 1646–1653. [Google Scholar] [CrossRef]
  21. Zhao, X.; Hume, S.L.; Johnson, C.; Thompson, P.; Huang, J.; Gray, J.; Lamb, H.K.; Hawkins, A.R. The transcription repressor NmrA is subject to proteolysis by three Aspergillus nidulans proteases. Protein Sci. 2010, 19, 1405–1419. [Google Scholar] [CrossRef] [PubMed]
  22. Wong, K.H.; Hynes, M.J.; Davis, M.A. Recent advances in nitrogen regulation: A comparison between Saccharomyces cerevisiae and filamentous fungi. Eukaryot. Cell 2008, 7, 917–925. [Google Scholar] [CrossRef] [PubMed]
  23. Shi, L.; Ren, A.; Mu, D.; Zhao, M. Current progress in the study on biosynthesis and regulation of ganoderic acids. Appl. Microbiol. Biotechnol. 2010, 88, 1243–1251. [Google Scholar] [CrossRef]
  24. Ye, L.; Liu, S.; Xie, F.; Zhao, L.; Wu, X. Enhanced production of polysaccharides and triterpenoids in Ganoderma lucidum fruit bodies on induction with signal transduction during the fruiting stage. PLoS ONE 2018, 13, e0196287. [Google Scholar] [CrossRef] [PubMed]
  25. Calvino, E.; Manjon, J.L.; Sancho, P.; Tejedor, M.C.; Herraez, A.; Diez, J.C. Ganoderma lucidum induced apoptosis in NB4 human leukemia cells: Involvement of Akt and Erk. J. Ethnopharmacol. 2010, 128, 71–78. [Google Scholar] [CrossRef] [PubMed]
  26. Li, H.J.; Zhang, D.H.; Han, L.L.; Yu, X.; Zhao, P.; Li, T.; Zhong, J.J.; Xu, J.W. Further improvement in ganoderic acid production in static liquid culture of Ganoderma lucidum by integrating nitrogen limitation and calcium ion addition. Bioprocess Biosyst. Eng. 2016, 39, 75–80. [Google Scholar] [CrossRef]
  27. Hu, G.; Zhai, M.; Niu, R.; Xu, X.; Liu, Q.; Jia, J. Optimization of culture condition for ganoderic acid production in Ganoderma lucidum liquid static culture and design of a suitable bioreactor. Molecules 2018, 23, 2563. [Google Scholar] [CrossRef]
  28. Zhao, W.; Xu, J.W.; Zhong, J.J. Enhanced production of ganoderic acids in static liquid culture of Ganoderma lucidum under nitrogen-limiting conditions. Bioresour. Technol. 2011, 102, 8185–8190. [Google Scholar] [CrossRef]
  29. Mu, D.; Shi, L.; Ren, A.; Li, M.; Wu, F.; Jiang, A.; Zhao, M. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum. PLoS ONE 2012, 7, e43737. [Google Scholar] [CrossRef]
  30. Mu, D.; Li, C.; Zhang, X.; Li, X.; Shi, L.; Ren, A.; Zhao, M. Functions of the nicotinamide adenine dinucleotide phosphate oxidase family in Ganoderma lucidum: An essential role in ganoderic acid biosynthesis regulation, hyphal branching, fruiting body development, and oxidative-stress resistance. Environ. Microbiol. 2014, 16, 1709–1728. [Google Scholar] [CrossRef]
  31. Hong, H.; Xiao, H.; Yuan, H.; Zhai, J.; Huang, X. Cloning and characterisation of JAZ gene family in Hevea brasiliensis. Plant Biol. 2015, 17, 618–624. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, J.; Song, S.; Sun, Z.; Lian, L.; Shi, L.; Ren, A.; Zhao, M. Regulation of glutamine synthetase activity by transcriptional and posttranslational modifications negatively influences ganoderic acid biosynthesis in Ganoderma lucidum. Environ. Microbiol. 2021, 23, 1286–1297. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, Y.N.; Zhang, T.J.; Lu, X.X.; Ma, B.L.; Ren, A.; Shi, L.; Jiang, A.L.; Yu, H.S.; Zhao, M.W. Membrane fluidity is involved in the regulation of heat stress induced secondary metabolism in Ganoderma lucidum. Environ. Microbiol. 2017, 19, 1653–1668. [Google Scholar] [CrossRef]
  34. Fu, Y.H.; Marzluf, G.A. Site-directed mutagenesis of the ‘zinc finger’ DNA-binding domain of the nitrogen-regulatory protein NIT2 of Neurospora. Mol. Microbiol. 1990, 4, 1847–1852. [Google Scholar] [CrossRef] [PubMed]
  35. Wilson, R.A.; Arst, H.N., Jr. Mutational analysis of AREA, a transcriptional activator mediating nitrogen metabolite repression in Aspergillus nidulans and a member of the “streetwise” GATA family of transcription factors. Microbiol. Mol. Biol. Rev. 1998, 62, 586–596. [Google Scholar] [CrossRef]
  36. Lamb, H.K.; Leslie, K.; Dodds, A.L.; Nutley, M.; Cooper, A.; Johnson, C.; Thompson, P.; Stammers, D.K.; Hawkins, A.R. The negative transcriptional regulator NmrA discriminates between oxidized and reduced dinucleotides. J. Biol. Chem. 2003, 278, 32107–32114. [Google Scholar] [CrossRef]
  37. Baker, M.E.; Blasco, R. Expansion of the mammalian 3β-hydroxysteroid dehydrogenase/plant dihydroflavonol reductase superfamily to include a bacterial cholesterol dehydrogenase, a bacterial UDP-galactose-4-epimerase, and open reading frames in vaccinia virus and fish lymphocystis. FEBS Lett. 1992, 301, 89–93. [Google Scholar] [CrossRef]
  38. Stammers, D.K.; Ren, J.; Leslie, K.; Nichols, C.E.; Lamb, H.K.; Cocklin, S.; Dodds, A.; Hawkins, A.R. The structure of the negative transcriptional regulator NmrA reveals a structural superfamily which includes the short-chain dehydrogenase/reductases. EMBO J. 2001, 20, 6619–6626. [Google Scholar] [CrossRef]
  39. Bousset, L.; Belrhali, H.; Janin, J.; Melki, R.; Morera, S. Structure of the globular region of the prion protein Ure2 from the yeast Saccharomyces cerevisiae. Structure 2001, 9, 39–46. [Google Scholar] [CrossRef]
  40. Umland, T.C.; Taylor, K.L.; Rhee, S.; Wickner, R.B.; Davies, D.R. The crystal structure of the nitrogen regulation fragment of the yeast prion protein Ure2p. Proc. Natl. Acad. Sci. USA 2001, 98, 1459–1464. [Google Scholar] [CrossRef]
  41. Shen, L.; Su, Z.; Yang, K.; Wu, C.; Becker, T.; Bell-Pedersen, D.; Zhang, J.; Sachs, M.S. Structure of the translating Neurospora ribosome arrested by cycloheximide. Proc. Natl. Acad. Sci. USA 2021, 118, e2111862118. [Google Scholar] [CrossRef]
  42. Sharma, P.; Wu, J.; Nilges, B.S.; Leidel, S.A. Humans and other commonly used model organisms are resistant to cycloheximide-mediated biases in ribosome profiling experiments. Nat. Commun. 2021, 12, 5094. [Google Scholar] [CrossRef]
  43. Bertram, P.G.; Choi, J.H.; Carvalho, J.; Ai, W.; Zeng, C.; Chan, T.F.; Zheng, X.F. Tripartite regulation of Gln3p by TOR, Ure2p, and phosphatases. J. Biol. Chem. 2000, 275, 35727–35733. [Google Scholar] [CrossRef]
  44. Tate, J.J.; Buford, D.; Rai, R.; Cooper, T.G. General amino acid control and 14-3-3 proteins Bmh1/2 are required for nitrogen catabolite repression-sensitive regulation of Gln3 and Gat1 localization. Genetics 2017, 205, 633–655. [Google Scholar] [CrossRef]
  45. Hunter, C.C.; Siebert, K.S.; Downes, D.J.; Wong, K.H.; Kreutzberger, S.D.; Fraser, J.A.; Clarke, D.F.; Hynes, M.J.; Davis, M.A.; Todd, R.B. Multiple nuclear localization signals mediate nuclear localization of the GATA transcription factor AreA. Eukaryot. Cell 2014, 13, 527–538. [Google Scholar] [CrossRef]
  46. Han, X.; Qiu, M.; Wang, B.; Yin, W.B.; Nie, X.; Qin, Q.; Ren, S.; Yang, K.; Zhang, F.; Zhuang, Z.; et al. Functional analysis of the nitrogen metabolite repression regulator gene nmrA in Aspergillus flavus. Front. Microbiol. 2016, 7, 1794. [Google Scholar] [CrossRef]
  47. Schonig, B.; Brown, D.W.; Oeser, B.; Tudzynski, B. Cross-species hybridization with Fusarium verticillioides microarrays reveals new insights into Fusarium fujikuroi nitrogen regulation and the role of AreA and NMR. Eukaryot. Cell 2008, 7, 1831–1846. [Google Scholar] [CrossRef]
  48. DeBusk, R.M.; Ogilvie, S. Regulation of amino acid utilization in Neurospora crassa: Effect of nmr-1 and ms-5 mutations. J. Bacteriol. 1984, 160, 656–661. [Google Scholar] [CrossRef]
  49. Narendja, F.; Goller, S.P.; Wolschek, M.; Strauss, J. Nitrate and the GATA factor AreA are necessary for in vivo binding of NirA, the pathway-specific transcriptional activator of Aspergillus nidulans. Mol. Microbiol. 2002, 44, 573–583. [Google Scholar] [CrossRef]
  50. Hinnebusch, A.G. Translational regulation of GCN4 and the general amino acid control of yeast. Annu. Rev. Microbiol. 2005, 59, 407–450. [Google Scholar] [CrossRef]
  51. Lian, L.; Shi, L.; Zhu, J.; Shi, L.; Ren, A.; You, H.; Liu, R.; Zhao, M. GCN4 Enhances the transcriptional regulation of AreA by interacting with SKO1 to mediate nitrogen utilization in Ganoderma lucidum. Appl. Environ. Microbiol. 2022, 88, e0132222. [Google Scholar] [CrossRef]
  52. Daitoku, H.; Sakamaki, J.; Fukamizu, A. Regulation of FoxO transcription factors by acetylation and protein-protein interactions. Biochim. Biophys. Acta 2011, 1813, 1954–1960. [Google Scholar] [CrossRef]
  53. Filtz, T.M.; Vogel, W.K.; Leid, M. Regulation of transcription factor activity by interconnected post-translational modifications. Trends Pharm. Sci. 2014, 35, 76–85. [Google Scholar] [CrossRef]
  54. Zhang, W.; Du, G.; Zhou, J.; Chen, J. Regulation of sensing, transportation, and catabolism of nitrogen sources in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 2018, 82, e00040-17. [Google Scholar] [CrossRef]
Jof 09 00516 g001 550
Figure 1. Bioinformatics analysis of NmrA in G. lucidum and A. nidulans, and Ure2 in G. lucidum and S. cerevisiae. (A) Conserved domain analysis of NmrA in A. nidulans and G. lucidum. (B) Determination of the Met-X-X-X-Lys structure in A. nidulans and G. lucidum. (C) Location analysis of the Ure2 “Flexible Cap Region” of S. cerevisiae and G. lucidum.
Figure 1. Bioinformatics analysis of NmrA in G. lucidum and A. nidulans, and Ure2 in G. lucidum and S. cerevisiae. (A) Conserved domain analysis of NmrA in A. nidulans and G. lucidum. (B) Determination of the Met-X-X-X-Lys structure in A. nidulans and G. lucidum. (C) Location analysis of the Ure2 “Flexible Cap Region” of S. cerevisiae and G. lucidum.
Jof 09 00516 g001
Jof 09 00516 g002 550
Figure 2. The yeast two-hybrid method was used to verify the interaction between AreA and NmrA. (A) The sequences of AreA were divided into two parts for the yeast two-hybrid assay. (B) pGBKT7-areA, pGBKT7-areA-N, or pGBKT7-areA-C was co-transformed with the pGADT7-nmrA into the Y2H strain. The Y2H strain containing the target carrier was cultured on an SD-Trp/Leu auxotrophic medium and an SD-Trp/Leu/His/Ade auxotrophic medium with 20 ng/mL of X-α-gal, 15 mM 3-AT, and 125 ng/mL AbA and then the media were incubated at 30 °C for 2 days to assess the protein–protein interactions. The strain with pGBKT7-53 and pGADT7-T was used as the positive control. The strain with pGBKT7-Lam and pGADT7-T was used as the negative control.
Figure 2. The yeast two-hybrid method was used to verify the interaction between AreA and NmrA. (A) The sequences of AreA were divided into two parts for the yeast two-hybrid assay. (B) pGBKT7-areA, pGBKT7-areA-N, or pGBKT7-areA-C was co-transformed with the pGADT7-nmrA into the Y2H strain. The Y2H strain containing the target carrier was cultured on an SD-Trp/Leu auxotrophic medium and an SD-Trp/Leu/His/Ade auxotrophic medium with 20 ng/mL of X-α-gal, 15 mM 3-AT, and 125 ng/mL AbA and then the media were incubated at 30 °C for 2 days to assess the protein–protein interactions. The strain with pGBKT7-53 and pGADT7-T was used as the positive control. The strain with pGBKT7-Lam and pGADT7-T was used as the negative control.
Jof 09 00516 g002
Jof 09 00516 g003 550
Figure 3. Effect of NmrA on AreA protein content. (A) Construction of the nmrA silenced strains. The strains were cultured on a CYM containing 100 μg/mL of hygromycin B at 28 °C for 5 days. The silencing efficiency of nmrA was identified by RT-qPCR. (B) The silencing efficiencies of nmrA of all strains were detected under the ammonium condition. (C) The silencing efficiencies of nmrA for all strains were detected under the nitrate condition. (D) The expression levels of areA in the WT and nmrA silenced strains were detected under the ammonium or nitrate conditions. (E) Western blot was used to detect the protein content of AreA in the WT and nmrA silenced strains. The WT and nmrA silenced strains were cultured in ammonium or nitrate at 28 °C for 5 days, and then the mycelia were collected for protein extraction. (F) The protein level was quantitatively analyzed using Image J v1.8.0 software. All data are presented as means ± SDs (n = 3). Asterisks indicate significant differences compared with the WT strain (one-way ANOVA, **** p < 0.0001, ns: no significance). Different letters indicate significant differences among groups (p < 0.05).
Figure 3. Effect of NmrA on AreA protein content. (A) Construction of the nmrA silenced strains. The strains were cultured on a CYM containing 100 μg/mL of hygromycin B at 28 °C for 5 days. The silencing efficiency of nmrA was identified by RT-qPCR. (B) The silencing efficiencies of nmrA of all strains were detected under the ammonium condition. (C) The silencing efficiencies of nmrA for all strains were detected under the nitrate condition. (D) The expression levels of areA in the WT and nmrA silenced strains were detected under the ammonium or nitrate conditions. (E) Western blot was used to detect the protein content of AreA in the WT and nmrA silenced strains. The WT and nmrA silenced strains were cultured in ammonium or nitrate at 28 °C for 5 days, and then the mycelia were collected for protein extraction. (F) The protein level was quantitatively analyzed using Image J v1.8.0 software. All data are presented as means ± SDs (n = 3). Asterisks indicate significant differences compared with the WT strain (one-way ANOVA, **** p < 0.0001, ns: no significance). Different letters indicate significant differences among groups (p < 0.05).
Jof 09 00516 g003
Jof 09 00516 g004 550
Figure 4. The effect of nmrA on the stability of the AreA protein. (A) The AreA protein levels of the WT and nmrA silenced strains were detected by Western blot. The WT and nmrA silenced strains were cultured on CYM and pretreated with cycloheximide (CHX) for 0 to 12 h. (B,C) The graphs show the relative band intensity of the AreA after different CHX treatments for the WT and nmrA silenced strains, respectively. Different letters indicate significant differences among groups (p < 0.05).
Figure 4. The effect of nmrA on the stability of the AreA protein. (A) The AreA protein levels of the WT and nmrA silenced strains were detected by Western blot. The WT and nmrA silenced strains were cultured on CYM and pretreated with cycloheximide (CHX) for 0 to 12 h. (B,C) The graphs show the relative band intensity of the AreA after different CHX treatments for the WT and nmrA silenced strains, respectively. Different letters indicate significant differences among groups (p < 0.05).
Jof 09 00516 g004
Jof 09 00516 g005 550
Figure 5. The effect of nmrA on the contents of AreA in the nuclei. (A) The contents of AreA in the nuclei of the WT and nmrA silenced strains under ammonium salt and nitrate conditions were detected by Western blot. (B) The protein content was quantified by Image J v1.8.0 software. The contents of AreA protein in the WT under the nitrate condition were used as the standard. (C) Western blot was used to detect the AreA protein contents in the cytoplasm of the WT and nmrA silenced strains under the ammonium or nitrate conditions. (D) The AreA protein content in (C) was quantified by Image J v1.8.0 software. The contents of AreA protein in the WT under the nitrate condition were taken as the standard. The Histone protein (H3) was used as an internal reference for the nuclear protein. The β-tubulin protein was used as an internal reference for the cytoplasm protein. All data are presented as means ± SDs (n = 3). Different letters indicate significant differences among groups (p < 0.05).
Figure 5. The effect of nmrA on the contents of AreA in the nuclei. (A) The contents of AreA in the nuclei of the WT and nmrA silenced strains under ammonium salt and nitrate conditions were detected by Western blot. (B) The protein content was quantified by Image J v1.8.0 software. The contents of AreA protein in the WT under the nitrate condition were used as the standard. (C) Western blot was used to detect the AreA protein contents in the cytoplasm of the WT and nmrA silenced strains under the ammonium or nitrate conditions. (D) The AreA protein content in (C) was quantified by Image J v1.8.0 software. The contents of AreA protein in the WT under the nitrate condition were taken as the standard. The Histone protein (H3) was used as an internal reference for the nuclear protein. The β-tubulin protein was used as an internal reference for the cytoplasm protein. All data are presented as means ± SDs (n = 3). Different letters indicate significant differences among groups (p < 0.05).
Jof 09 00516 g005
Jof 09 00516 g006 550
Figure 6. Expression levels and enzyme activities of glutamine synthase and nitrate reductase for the WT and nmrA silenced strains under the ammonium or nitrate conditions. (A) Relative expression of the gs gene in the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. (B) The enzyme activity of GS for the WT, CK, and nmrA silenced strains under the ammonium and nitrate conditions. (C) Relative expression of the nr gene in the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. (D) NR enzyme activity of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. All data are presented as means ± SDs (n = 3). Asterisks indicate significant differences compared with the WT strain (one-way ANOVA, * p < 0.05, ** p < 0.01, ns: no significance).
Figure 6. Expression levels and enzyme activities of glutamine synthase and nitrate reductase for the WT and nmrA silenced strains under the ammonium or nitrate conditions. (A) Relative expression of the gs gene in the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. (B) The enzyme activity of GS for the WT, CK, and nmrA silenced strains under the ammonium and nitrate conditions. (C) Relative expression of the nr gene in the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. (D) NR enzyme activity of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. All data are presented as means ± SDs (n = 3). Asterisks indicate significant differences compared with the WT strain (one-way ANOVA, * p < 0.05, ** p < 0.01, ns: no significance).
Jof 09 00516 g006
Jof 09 00516 g007 550
Figure 7. The effect of NmrA on mycelial growth and ganoderic acid biosynthesis. (A) The growth of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. All strains were photographed after 5 days of growth at 28 °C. (B) The diameters of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. (C) The mycelial biomasses of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. The WT, CK, and nmrA silenced strains were cultured in a CYM liquid medium for 3 days and then transferred to a liquid medium containing 30 mM of ammonium or 30 of mM nitrate for 5 days. Samples were then collected for detection. (D) The GA contents of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. All data are presented as means ± SDs (n = 3). Asterisks indicate significant differences compared with the WT strain (one-way ANOVA, * p < 0.05, ** p < 0.01, ns: no significance). Different letters indicate significant differences among groups (p < 0.05).
Figure 7. The effect of NmrA on mycelial growth and ganoderic acid biosynthesis. (A) The growth of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. All strains were photographed after 5 days of growth at 28 °C. (B) The diameters of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. (C) The mycelial biomasses of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. The WT, CK, and nmrA silenced strains were cultured in a CYM liquid medium for 3 days and then transferred to a liquid medium containing 30 mM of ammonium or 30 of mM nitrate for 5 days. Samples were then collected for detection. (D) The GA contents of the WT, CK, and nmrA silenced strains under the ammonium or nitrate conditions. All data are presented as means ± SDs (n = 3). Asterisks indicate significant differences compared with the WT strain (one-way ANOVA, * p < 0.05, ** p < 0.01, ns: no significance). Different letters indicate significant differences among groups (p < 0.05).
Jof 09 00516 g007
Table
Table 1. Paired primers designed for target gene manipulation in Ganoderma lucidum.
Table 1. Paired primers designed for target gene manipulation in Ganoderma lucidum.
PrimerSequence (5′ to 3′)Description
pGBKT7-AreA-FGGAATTCCATATGATGTTGCAACATACTCTCObtain full length of areA
for yeast Y2H assay
pGBKT7-AreA-RGGAATTCTTAAGCCCCGCCGCC
pGADT7-NmrA-FGGAATTCCATATGATGACGAAGCTCGTTGCObtain full length of nmrA
for yeast Y2H assay
pGADT7-NmrA-RGGAATTCTTACACGAGCGATAGGCCGAG
pGBKT7-AreA-N-FatggccatggaggccgaattcATGTTGCAACATACTCTCObtain N-terminal of areA
for yeast Y2H assay
pGBKT7-AreA-N-RtcgacggatccccgggaattcTTATGCGCCAGCACG
pGBKT7-AreA-C-FatggccatggaggccgaattcAGTGGCGCCCAGCObtain C-terminal of areA
for yeast Y2H assay
pGBKT7-AreA-C-RtcgacggatccccgggaattcTTAAGCCCCGCCGCC
Hmgr-QRT-FGTCATCCTCCTATGCCAAACDetect the hmgr expression
Hmgr-QRT-RTGAACTGTGCGAAAGG
Sqs-QRT-FCTGCTTATTCTACCTGGTGCTACGDetect the hmgr expression
Sqs-QRT-RGGCTTCACGGCGAGTTTGT
Osc-QRT-FAGGGAGAACCCGAAGCATTDetect the hmgr expression
Osc-QRT-RCGTCCACAGCGTCGCATAAC
GS-QRT-FACCAACTTCCGCCACCATDetect the gs expression
GS-QRT-RAAGACCTTGCCAGCACCAG
NR-QRT-FAAGACGACCAACTCCDetect the nr expression
NR-QRT-RGCCAAGTGCCATAA
18s-QRT-FTATCGAGTTCTGACTGGGTTGTDetect the 18s expression
18s-QRT-RATCCGTTGCTGAAAGTTGTAT
NmrA-QRT-FGCATATCTCCGGTGGTCGTTDetect the nmrA expression
NmrA-QRT-RGGTATTTGCCTGGACAACGC
NmrAi-FgcgcacaggcggagaactagtTCGTGCTCCTCTCGTTTGObtain the silencing fragment of the nmrA gene
NmrAi-RactcttcatccccctggtaccCACGAGCGATAGGCCGAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, H.; Qiao, J.; Shangguan, J.; Guo, X.; Xing, Z.; Zhou, X.; Zhao, M.; Zhu, J. A Gene from Ganoderma lucidum with Similarity to nmrA of Filamentous Ascomycetes Contributes to Regulating AreA. J. Fungi 2023, 9, 516. https://doi.org/10.3390/jof9050516

AMA Style

Liu H, Qiao J, Shangguan J, Guo X, Xing Z, Zhou X, Zhao M, Zhu J. A Gene from Ganoderma lucidum with Similarity to nmrA of Filamentous Ascomycetes Contributes to Regulating AreA. Journal of Fungi. 2023; 9(5):516. https://doi.org/10.3390/jof9050516

Chicago/Turabian Style

Liu, He, Jinjin Qiao, Jiaolei Shangguan, Xiaoyu Guo, Zhenzhen Xing, Xiaolin Zhou, Mingwen Zhao, and Jing Zhu. 2023. "A Gene from Ganoderma lucidum with Similarity to nmrA of Filamentous Ascomycetes Contributes to Regulating AreA" Journal of Fungi 9, no. 5: 516. https://doi.org/10.3390/jof9050516

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop