Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. A. fumigatus Strain and Growth Conditions
2.3. Isolation and Purification of EVs
2.4. Culture of Macrophages
2.5. Isolation of PBMCs
2.6. Cytokine Measurement
2.7. Nitric Oxide (NO) Measurement
2.8. Detection of O2•− by Lucigenin Enhanced Chemiluminescence
2.9. qPCR
2.10. Macrophage Adhesion Assay
2.11. Isolation and Culture of Neutrophils
2.12. Detection of NETs by Flow Cytometry
2.13. G. mellonella Survival Assay
2.14. Statistical Analysis
3. Results
3.1. A. fumigatus EVs Induce TNF-α by Macrophages
3.2. A. fumigatus EVs Induce Lower Arginase-1 and Higher iNOS Transcription in RAW 264.7 Macrophages
3.3. A. fumigatus EVs Augment Adhesion Molecule Gene Expression in RAW 264.7 Macrophages
3.4. A. fumigatus EVs Fail to Induce NETs Release and Cytokine Production by Neutrophils
3.5. EVs Induce Increased Survival in Galleria Mellonella Model of A. fumigatus Infection
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abad, A.; Fernandez-Molina, J.V.; Bikandi, J.; Ramirez, A.; Margareto, J.; Sendino, J.; Hernando, F.L.; Ponton, J.; Garaizar, J.; Rementeria, A. What makes Aspergillus fumigatus a successful pathogen? Genes and molecules involved in invasive aspergillosis. Rev. Iberoam. Micol. 2010, 27, 155–182. [Google Scholar] [CrossRef]
- van de Veerdonk, F.L.; Gresnigt, M.S.; Romani, L.; Netea, M.G.; Latge, J.P. Aspergillus fumigatus morphology and dynamic host interactions. Nat. Rev. Microbiol. 2017, 15, 661–674. [Google Scholar] [CrossRef]
- McCormick, A.; Loeffler, J.; Ebel, F. Aspergillus fumigatus: Contours of an opportunistic human pathogen. Cell. Microbiol. 2010, 12, 1535–1543. [Google Scholar] [CrossRef]
- Xu, S.; Shinohara, M.L. Tissue-Resident Macrophages in Fungal Infections. Front. Immunol. 2017, 8, 1798. [Google Scholar] [CrossRef] [PubMed]
- Chotirmall, S.H.; Al-Alawi, M.; Mirkovic, B.; Lavelle, G.; Logan, P.M.; Greene, C.M.; McElvaney, N.G. Aspergillus-associated airway disease, inflammation, and the innate immune response. BioMed Res. Int. 2013, 2013, 723129. [Google Scholar] [CrossRef]
- Latge, J.P.; Chamilos, G. Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. 2019, 33, e00140-18. [Google Scholar] [CrossRef]
- Deatherage, B.L.; Cookson, B.T. Membrane vesicle release in bacteria, eukaryotes, and archaea: A conserved yet underappreciated aspect of microbial life. Infect. Immun. 2012, 80, 1948–1957. [Google Scholar] [CrossRef]
- Yanez-Mo, M.; Siljander, P.R.; Andreu, Z.; Zavec, A.B.; Borras, F.E.; Buzas, E.I.; Buzas, K.; Casal, E.; Cappello, F.; Carvalho, J.; et al. Biological properties of extracellular vesicles and their physiological functions. J. Extracell. Vesicles 2015, 4, 27066. [Google Scholar] [CrossRef]
- Albuquerque, P.C.; Nakayasu, E.S.; Rodrigues, M.L.; Frases, S.; Casadevall, A.; Zancope-Oliveira, R.M.; Almeida, I.C.; Nosanchuk, J.D. Vesicular transport in Histoplasma capsulatum: An effective mechanism for trans-cell wall transfer of proteins and lipids in ascomycetes. Cell. Microbiol. 2008, 10, 1695–1710. [Google Scholar] [CrossRef] [PubMed]
- Gehrmann, U.; Qazi, K.R.; Johansson, C.; Hultenby, K.; Karlsson, M.; Lundeberg, L.; Gabrielsson, S.; Scheynius, A. Nanovesicles from Malassezia sympodialis and host exosomes induce cytokine responses—Novel mechanisms for host-microbe interactions in atopic eczema. PLoS ONE 2011, 6, e21480. [Google Scholar] [CrossRef] [PubMed]
- Vallejo, M.C.; Matsuo, A.L.; Ganiko, L.; Medeiros, L.C.; Miranda, K.; Silva, L.S.; Freymuller-Haapalainen, E.; Sinigaglia-Coimbra, R.; Almeida, I.C.; Puccia, R. The pathogenic fungus Paracoccidioides brasiliensis exports extracellular vesicles containing highly immunogenic alpha-Galactosyl epitopes. Eukaryot. Cell 2011, 10, 343–351. [Google Scholar] [CrossRef]
- Silva, B.M.; Prados-Rosales, R.; Espadas-Moreno, J.; Wolf, J.M.; Luque-Garcia, J.L.; Goncalves, T.; Casadevall, A. Characterization of Alternaria infectoria extracellular vesicles. Med. Mycol. 2014, 52, 202–210. [Google Scholar] [CrossRef] [PubMed]
- Bitencourt, T.A.; Rezende, C.P.; Quaresemin, N.R.; Moreno, P.; Hatanaka, O.; Rossi, A.; Martinez-Rossi, N.M.; Almeida, F. Extracellular Vesicles from the Dermatophyte Trichophyton interdigitale Modulate Macrophage and Keratinocyte Functions. Front. Immunol. 2018, 9, 2343. [Google Scholar] [CrossRef] [PubMed]
- Ikeda, M.A.K.; de Almeida, J.R.F.; Jannuzzi, G.P.; Cronemberger-Andrade, A.; Torrecilhas, A.C.T.; Moretti, N.S.; da Cunha, J.P.C.; de Almeida, S.R.; Ferreira, K.S. Extracellular Vesicles from Sporothrix brasiliensis Are an Important Virulence Factor That Induce an Increase in Fungal Burden in Experimental Sporotrichosis. Front. Microbiol. 2018, 9, 2286. [Google Scholar] [CrossRef] [PubMed]
- Freitas, M.S.; Pessoni, A.M.; Coelho, C.; Bonato, V.L.D.; Rodrigues, M.L.; Casadevall, A.; Almeida, F. Interactions of Extracellular Vesicles from Pathogenic Fungi with Innate Leukocytes. Curr. Top. Microbiol. Immunol. 2021, 432, 89–120. [Google Scholar] [CrossRef]
- Bitencourt, T.A.; Hatanaka, O.; Pessoni, A.M.; Freitas, M.S.; Trentin, G.; Santos, P.; Rossi, A.; Martinez-Rossi, N.M.; Alves, L.L.; Casadevall, A.; et al. Fungal Extracellular Vesicles Are Involved in Intraspecies Intracellular Communication. mBio 2022, 13, e03272-21. [Google Scholar] [CrossRef]
- Bielska, E.; May, R.C. Extracellular vesicles of human pathogenic fungi. Curr. Opin. Microbiol. 2019, 52, 90–99. [Google Scholar] [CrossRef]
- Freitas, M.S.; Oliveira, A.F.; da Silva, T.A.; Fernandes, F.F.; Goncales, R.A.; Almeida, F.; Roque-Barreira, M.C. Paracoccin Induces M1 Polarization of Macrophages via Interaction with TLR4. Front. Microbiol. 2016, 7, 1003. [Google Scholar] [CrossRef]
- Brauer, V.S.; Pessoni, A.M.; Bitencourt, T.A.; de Paula, R.G.; de Oliveira Rocha, L.; Goldman, G.H.; Almeida, F. Extracellular Vesicles from Aspergillus flavus Induce M1 Polarization In Vitro. mSphere 2020, 5, e00190-20. [Google Scholar] [CrossRef]
- Baltazar, L.M.; Zamith-Miranda, D.; Burnet, M.C.; Choi, H.; Nimrichter, L.; Nakayasu, E.S.; Nosanchuk, J.D. Concentration-dependent protein loading of extracellular vesicles released by Histoplasma capsulatum after antibody treatment and its modulatory action upon macrophages. Sci. Rep. 2018, 8, 8065. [Google Scholar] [CrossRef]
- Green, L.C.; Wagner, D.A.; Glogowski, J.; Skipper, P.L.; Wishnok, J.S.; Tannenbaum, S.R. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 1982, 126, 131–138. [Google Scholar] [CrossRef]
- Wang, X.Z.; Zhang, S.Y.; Xu, Y.; Zhang, L.Y.; Jiang, Z.Z. The role of neutrophils in triptolide-induced liver injury. Chin. J. Nat. Med. 2018, 16, 653–664. [Google Scholar] [CrossRef]
- Huang, J.; Zhou, Q. CD8+T Cell-Related Gene Biomarkers in Macular Edema of Diabetic Retinopathy. Front. Endocrinol. 2022, 13, 907396. [Google Scholar] [CrossRef]
- Ip, W.K.; Medzhitov, R. Macrophages monitor tissue osmolarity and induce inflammatory response through NLRP3 and NLRC4 inflammasome activation. Nat. Commun. 2015, 6, 6931. [Google Scholar] [CrossRef]
- Pruchniak, M.P.; Demkow, U. Potent NETosis inducers do not show synergistic effects in vitro. Cent. Eur. J. Immunol. 2019, 44, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Aratani, Y.; Kura, F.; Watanabe, H.; Akagawa, H.; Takano, Y.; Suzuki, K.; Dinauer, M.C.; Maeda, N.; Koyama, H. Relative contributions of myeloperoxidase and NADPH-oxidase to the early host defense against pulmonary infections with Candida albicans and Aspergillus fumigatus. Med. Mycol. 2002, 40, 557–563. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim-Granet, O.; Philippe, B.; Boleti, H.; Boisvieux-Ulrich, E.; Grenet, D.; Stern, M.; Latge, J.P. Phagocytosis and intracellular fate of Aspergillus fumigatus conidia in alveolar macrophages. Infect. Immun. 2003, 71, 891–903. [Google Scholar] [CrossRef] [PubMed]
- Philippe, B.; Ibrahim-Granet, O.; Prevost, M.C.; Gougerot-Pocidalo, M.A.; Sanchez Perez, M.; Van der Meeren, A.; Latge, J.P. Killing of Aspergillus fumigatus by alveolar macrophages is mediated by reactive oxidant intermediates. Infect. Immun. 2003, 71, 3034–3042. [Google Scholar] [CrossRef]
- Bhatia, S.; Fei, M.; Yarlagadda, M.; Qi, Z.; Akira, S.; Saijo, S.; Iwakura, Y.; van Rooijen, N.; Gibson, G.A.; St Croix, C.M.; et al. Rapid host defense against Aspergillus fumigatus involves alveolar macrophages with a predominance of alternatively activated phenotype. PLoS ONE 2011, 6, e15943. [Google Scholar] [CrossRef]
- Schittenhelm, L.; Hilkens, C.M.; Morrison, V.L. beta2 Integrins As Regulators of Dendritic Cell, Monocyte, and Macrophage Function. Front. Immunol. 2017, 8, 1866. [Google Scholar] [CrossRef]
- Smith, D.F.Q.; Casadevall, A. Fungal immunity and pathogenesis in mammals versus the invertebrate model organism Galleria mellonella. Pathog. Dis. 2021, 79, ftab013. [Google Scholar] [CrossRef] [PubMed]
- Freitas, M.S.; Bonato, V.L.D.; Pessoni, A.M.; Rodrigues, M.L.; Casadevall, A.; Almeida, F. Fungal Extracellular Vesicles as Potential Targets for Immune Interventions. mSphere 2019, 4, e00747-19. [Google Scholar] [CrossRef] [PubMed]
- Cleare, L.G.; Zamith, D.; Heyman, H.M.; Couvillion, S.P.; Nimrichter, L.; Rodrigues, M.L.; Nakayasu, E.S.; Nosanchuk, J.D. Media matters! Alterations in the loading and release of Histoplasma capsulatum extracellular vesicles in response to different nutritional milieus. Cell. Microbiol. 2020, 22, e13217. [Google Scholar] [CrossRef] [PubMed]
- Souza, J.A.M.; Baltazar, L.M.; Carregal, V.M.; Gouveia-Eufrasio, L.; de Oliveira, A.G.; Dias, W.G.; Campos Rocha, M.; Rocha de Miranda, K.; Malavazi, I.; Santos, D.A.; et al. Characterization of Aspergillus fumigatus Extracellular Vesicles and Their Effects on Macrophages and Neutrophils Functions. Front. Microbiol. 2019, 10, 2008. [Google Scholar] [CrossRef]
- Phadke, A.P.; Mehrad, B. Cytokines in host defense against Aspergillus: Recent advances. Med. Mycol. 2005, 43 (Suppl. S1), S173–S176. [Google Scholar] [CrossRef]
- Souza, J.A.M.; Gurgel, I.; Malacco, N.; Martins, F.R.B.; Queiroz-Junior, C.M.; Teixeira, M.M.; Soriani, F.M. Pre-Exposure with Extracellular Vesicles from Aspergillus fumigatus Attenuates Inflammatory Response and Enhances Fungal Clearance in a Murine Model Pulmonary Aspergillosis. Front. Cell. Infect. Microbiol. 2022, 12, 898619. [Google Scholar] [CrossRef]
- Vargas, G.; Rocha, J.D.; Oliveira, D.L.; Albuquerque, P.C.; Frases, S.; Santos, S.S.; Nosanchuk, J.D.; Gomes, A.M.; Medeiros, L.C.; Miranda, K.; et al. Compositional and immunobiological analyses of extracellular vesicles released by Candida albicans. Cell. Microbiol. 2015, 17, 389–407. [Google Scholar] [CrossRef]
- Vargas, G.; Honorato, L.; Guimaraes, A.J.; Rodrigues, M.L.; Reis, F.C.G.; Vale, A.M.; Ray, A.; Nosanchuk, J.D.; Nimrichter, L. Protective effect of fungal extracellular vesicles against murine candidiasis. Cell. Microbiol. 2020, 22, e13238. [Google Scholar] [CrossRef] [PubMed]
- Zamith-Miranda, D.; Heyman, H.M.; Couvillion, S.P.; Cordero, R.J.B.; Rodrigues, M.L.; Nimrichter, L.; Casadevall, A.; Amatuzzi, R.F.; Alves, L.R.; Nakayasu, E.S.; et al. Comparative Molecular and Immunoregulatory Analysis of Extracellular Vesicles from Candida albicans and Candida auris. mSystems 2021, 6, e00822-21. [Google Scholar] [CrossRef]
- Oliveira, D.L.; Freire-de-Lima, C.G.; Nosanchuk, J.D.; Casadevall, A.; Rodrigues, M.L.; Nimrichter, L. Extracellular vesicles from Cryptococcus neoformans modulate macrophage functions. Infect. Immun. 2010, 78, 1601–1609. [Google Scholar] [CrossRef]
- Brown, E.J. Integrins of Macrophages and Macrophage-Like Cells. In The Macrophage as Therapeutic Target; Gordon, S., Ed.; Springer: Berlin/Heidelberg, Germany, 2003; pp. 111–130. [Google Scholar]
- Jawhara, S.; Pluskota, E.; Cao, W.; Plow, E.F.; Soloviev, D.A. Distinct Effects of Integrins αXβ2 and αMβ2 on Leukocyte Subpopulations during Inflammation and Antimicrobial Responses. Infect. Immun. 2017, 85, e00644-16. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Su, X.; Li, Z.; Liu, Y.; Wang, S.; Zhu, M.; Zhang, C.; Yang, F.; Zhao, J.; Li, X.; et al. Complement receptor 3 mediates Aspergillus fumigatus internalization into alveolar epithelial cells with the increase of intracellular phosphatidic acid by activating FAK. Virulence 2021, 12, 1980–1996. [Google Scholar] [CrossRef]
- Silva, J.C.; Rodrigues, N.C.; Thompson-Souza, G.A.; Muniz, V.S.; Neves, J.S.; Figueiredo, R.T. Mac-1 triggers neutrophil DNA extracellular trap formation to Aspergillus fumigatus independently of PAD4 histone citrullination. J. Leukoc. Biol. 2020, 107, 69–83. [Google Scholar] [CrossRef] [PubMed]
- Gazendam, R.P.; van Hamme, J.L.; Tool, A.T.; Hoogenboezem, M.; van den Berg, J.M.; Prins, J.M.; Vitkov, L.; van de Veerdonk, F.L.; van den Berg, T.K.; Roos, D.; et al. Human Neutrophils Use Different Mechanisms to Kill Aspergillus fumigatus Conidia and Hyphae: Evidence from Phagocyte Defects. J. Immunol. 2016, 196, 1272–1283. [Google Scholar] [CrossRef] [PubMed]
- Urban, C.F.; Nett, J.E. Neutrophil extracellular traps in fungal infection. Semin. Cell Dev. Biol. 2019, 89, 47–57. [Google Scholar] [CrossRef] [PubMed]
- McCormick, A.; Heesemann, L.; Wagener, J.; Marcos, V.; Hartl, D.; Loeffler, J.; Heesemann, J.; Ebel, F. NETs formed by human neutrophils inhibit growth of the pathogenic mold Aspergillus fumigatus. Microbes Infect. 2010, 12, 928–936. [Google Scholar] [CrossRef]
- Borman, A.M. Of mice and men and larvae: Galleria mellonella to model the early host-pathogen interactions after fungal infection. Virulence 2018, 9, 9–12. [Google Scholar] [CrossRef]
- Pereira, T.C.; de Barros, P.P.; Fugisaki, L.R.O.; Rossoni, R.D.; Ribeiro, F.C.; de Menezes, R.T.; Junqueira, J.C.; Scorzoni, L. Recent Advances in the Use of Galleria mellonella Model to Study Immune Responses against Human Pathogens. J. Fungi 2018, 4, 128. [Google Scholar] [CrossRef]
- Slater, J.L.; Gregson, L.; Denning, D.W.; Warn, P.A. Pathogenicity of Aspergillus fumigatus mutants assessed in Galleria mellonella matches that in mice. Med. Mycol. 2011, 49 (Suppl. S1), S107–S113. [Google Scholar] [CrossRef] [PubMed]
- Thomaz, L.; Garcia-Rodas, R.; Guimaraes, A.J.; Taborda, C.P.; Zaragoza, O.; Nosanchuk, J.D. Galleria mellonella as a model host to study Paracoccidioides lutzii and Histoplasma capsulatum. Virulence 2013, 4, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Scorzoni, L.; de Paula e Silva, A.C.; Singulani Jde, L.; Leite, F.S.; de Oliveira, H.C.; da Silva, R.A.; Fusco-Almeida, A.M.; Mendes-Giannini, M.J. Comparison of virulence between Paracoccidioides brasiliensis and Paracoccidioides lutzii using Galleria mellonella as a host model. Virulence 2015, 6, 766–776. [Google Scholar] [CrossRef]
- Coleman, J.J.; Muhammed, M.; Kasperkovitz, P.V.; Vyas, J.M.; Mylonakis, E. Fusarium pathogenesis investigated using Galleria mellonella as a heterologous host. Fungal Biol. 2011, 115, 1279–1289. [Google Scholar] [CrossRef]
- Firacative, C.; Duan, S.; Meyer, W. Galleria mellonella model identifies highly virulent strains among all major molecular types of Cryptococcus gattii. PLoS ONE 2014, 9, e105076. [Google Scholar] [CrossRef] [PubMed]
- Bouklas, T.; Diago-Navarro, E.; Wang, X.; Fenster, M.; Fries, B.C. Characterization of the virulence of Cryptococcus neoformans strains in an insect model. Virulence 2015, 6, 809–813. [Google Scholar] [CrossRef] [PubMed]
- St Leger, R.J.; Screen, S.E.; Shams-Pirzadeh, B. Lack of host specialization in Aspergillus flavus. Appl. Environ. Microbiol. 2000, 66, 320–324. [Google Scholar] [CrossRef] [PubMed]
- Colombo, A.C.; Rella, A.; Normile, T.; Joffe, L.S.; Tavares, P.M.; de S. Araújo, G.R.; Frases, S.; Orner, E.P.; Farnoud, A.M.; Fries, B.C.; et al. Cryptococcus neoformans Glucuronoxylomannan and Sterylglucoside Are Required for Host Protection in an Animal Vaccination Model. mBio 2019, 10, e02909-18. [Google Scholar] [CrossRef]
Gene | Sequence 5′–3′ | Concentration (nM) | Efficiency (%) | Ref. |
---|---|---|---|---|
iNOS2 | FWD: CCGAAGCAAACATCACATTCA REV: GGTCTAAAGGCTCCGGGCT | 70 | 110.11 | [18] |
arginase-1 | FWD: GTTCCCAGATGTACCAGGATTC REV: CGATGTCTTTGGCAGATATGC | 100 | 99.33 | [18] |
CD11b | FWD: TACTTCGGGCAGTCTCTGAGTG REV: ATGGTTGCCTCCAGTCTCAGCA | 300 | 94 | [22] |
CD18 | FWD: CTTTCCGAGAGCAACATCCAGC REV: GTTGCTGGAGTCGTCAGACAGT | 300 | 105.5 | [23] |
Gapdh | FWD: GGTGCTGAGTATGTCGTGGA REV: CGGAGATGATGACCCTTTTG | 300 | 108.76 | [24] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Freitas, M.S.; Bitencourt, T.A.; Rezende, C.P.; Martins, N.S.; Dourado, T.d.M.H.; Tirapelli, C.R.; Almeida, F. Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages. J. Fungi 2023, 9, 541. https://doi.org/10.3390/jof9050541
Freitas MS, Bitencourt TA, Rezende CP, Martins NS, Dourado TdMH, Tirapelli CR, Almeida F. Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages. Journal of Fungi. 2023; 9(5):541. https://doi.org/10.3390/jof9050541
Chicago/Turabian StyleFreitas, Mateus Silveira, Tamires Aparecida Bitencourt, Caroline Patini Rezende, Nubia Sabrina Martins, Thales de Mileto Henrique Dourado, Carlos R. Tirapelli, and Fausto Almeida. 2023. "Aspergillus fumigatus Extracellular Vesicles Display Increased Galleria mellonella Survival but Partial Pro-Inflammatory Response by Macrophages" Journal of Fungi 9, no. 5: 541. https://doi.org/10.3390/jof9050541