Next Article in Journal
Three-Stage Solid-State Fermentation Technology for Distillers’ Grain Feed Protein Based on Different Microorganisms Considering Oxygen Requirements
Previous Article in Journal
In Situ Enrichment of Anammox Bacteria from Pig Farm Anoxic Sludge Through Co-Cultivation with a Quorum-Sensing Functional Strain Pseudomonas aeruginosa
Previous Article in Special Issue
Impacts of Slow-Release Urea in Ruminant Diets: A Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fermentation
Volume 10
Issue 11
10.3390/fermentation10110549
fermentation-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ferulic Acid and Clinoptilolite Affect In Vitro Rumen Fermentation Characteristics and Bacterial Abundance

by
Ana Tánori-Lozano
1,
M. Ángeles López-Baca
2,
Adriana Muhlia-Almazán
1,
Maricela Montalvo-Corral
1,
Araceli Pinelli-Saavedra
1,
Thalia Y. Islava-Lagarda
1,
José Luis Dávila-Ramírez
1,
Martín Valenzuela-Melendres
1 and
Humberto González-Rios
1,*
1
Centro de Investigación en Alimentación y Desarrollo, A.C (CIAD, A.C.), Carretera Gustavo Enrique Astiazarán # 46, Colonia La Victoria, Hermosillo Sonora 83304, Mexico
2
Instituto de Ciencias Agrícolas, Universidad Autónoma de Baja California, Valle de Mexicali, Baja California 21705, Mexico
*
Author to whom correspondence should be addressed.
Fermentation 2024, 10(11), 549; https://doi.org/10.3390/fermentation10110549
Submission received: 21 September 2024 / Revised: 22 October 2024 / Accepted: 25 October 2024 / Published: 26 October 2024
(This article belongs to the Special Issue Ruminal Fermentation)
Browse Figures
Versions Notes

Abstract

:
This study evaluated the effects of clinoptilolite (CTL) and ferulic acid (FA) supplementation on in vitro ruminal fermentation characteristics, gas production, and bacterial abundance. Treatments were arranged in a 2 × 2 factorial design (FA: 0 or 300 ppm; CTL: 0 or 1%) with repeated measures over time (2, 4, 8, 12, 24, 36, 48, and 72 h). Throughout the incubation period, the CTL and FAZ treatments recorded the highest pH values (p ≤ 0.05), maintaining levels closest to neutrality after 72 h. After 48 and 72 h, FA and CTL decreased (p ≤ 0.05) the ammonia concentrations while increasing (p ≤ 0.05) acetate and propionate. The methane, butyrate, and iso-VFA concentrations were unaffected (p > 0.05) by any treatment. FA increased the total gas production throughout the experimental period (p ≤ 0.05). Additionally, FA and CTL significantly reduced the relative abundance of Ruminococcus albus and Streptococcus bovis (p ≤ 0.05), while no significant effects were observed for Selenomonas ruminantium (p > 0.05). These findings suggest that both additives can positively modify the rumen fermentation characteristics and microbial composition, which could significantly contribute to animal nutrition by providing a promising strategy for enhancing rumen fermentation.

1. Introduction

One challenge that livestock production must overcome is meeting the growing demand for animal protein sources without compromising food safety, animal welfare, and environmental sustainability [1]. This challenge has led to an interest in using natural feed additives to enhance ruminant production by manipulating rumen fermentation [1]. In this regard, phytochemicals (PCHs) have appeared as promising strategic feed additives due to their potential as an alternative to conventional growth promoters [2,3,4]. PCHs are secondary bioactive metabolites found in plants or vegetable extracts, known for their positive effects on growth performance and animal health [5]. Some PCHs possess antimicrobial properties. Thus, it has been suggested that rumen fermentation be modulated by altering the composition of microbial communities and improving nutrient utilization, methanogenesis, and fermentation metabolites [2,5,6]. Ferulic acid (FA) is a PCH with bioactive properties that have shown high antimicrobial properties, antioxidant activity, and effectiveness in enhancing animal growth and reproductive health [3,7]. However, there is a lack of studies focusing on using FA to modulate ruminal fermentation.
On the other hand, zeolites such as clinoptilolite (CTL) are mineral feed additives known for their ion-exchange and adsorption properties, which can improve rumen fermentation efficiency and potentially mitigate some of the negative effects associated with high-concentrate diets [8,9,10]. Previous research has reported that CTL enhances nitrogen utilization, increases volatile fatty acid (VFA) concentrations, and stabilizes the rumen pH [9,10,11]. Moreover, some authors found an increase in the whole cellulolytic bacteria population and fiber digestibility in CTL-supplemented lambs [9,10].
The bioactive properties of FA and CTL have the potential to alter the rumen environment, which could modify the rumen microbiota. This microbial consortium works synergistically to degrade dietary substrates, such as fibrous feeds or non-protein nitrogen [12]. Although describing the complete microbiome is important, specific bacterial species have been studied to understand better the effects of supplementation on rumen function and its relationship with productivity. Among these species are Ruminococcus albus, Selenomonas ruminantium, and Streptococcus bovis. R. albus is a bacterium linked to fiber digestibility and is involved in the production of acetate and H2 [12]. Meanwhile, S. ruminantium has been commonly associated with starch digestion and contributing to the production of lactate, acetate, and propionate [2,13]. Finally, S. bovis is a bacterium responsible for rapidly fermenting starch, with lactate production as the final product. The reduced abundance of S. bovis has been linked to the most efficient rumen fermentation profile [2,14].
While the solo effects of FA and CTL on ruminant production have been explored, there is limited information on their combined effects on rumen fermentation. As mentioned, we hypothesized that including these feed additives would improve the fermentation characteristics by manipulating the ruminal bacterial composition. Therefore, the present research aimed to evaluate the combined effects of CTL and FA on the in vitro rumen fermentation characteristics and bacterial abundance.

2. Materials and Methods

2.1. Experimental Design

A randomized complete design with a 2 × 2 factorial arrangement of treatments was used to evaluate the interaction effect of FA and CTL on the in vitro rumen fermentation characteristics and microbial abundance. The treatments included two doses of FA (0 or 300 ppm) and CTL (0 or 1%). Factor levels were chosen based on a previous in vivo study with lambs from our workgroup [15,16]. The treatment combinations were as follows: (a) control (experimental diet without additives), (b) FA (only FA, Laboratorios Minkab, Guadalajara, Jalisco, Mexico), (c) CTL (only CTL, Zeolex®; Grupo Sanfer, Ciudad de Mexico, Mexico), and FAZ (with FA and CTL). The in vitro fermentation experiment was conducted using graduated syringes according to the guidelines described by Menke and Steingass [17]. Duplicate syringes were used for each treatment combination, and incubations were repeated twice over two weeks. Additionally, two blanks (containing only ruminal inoculum) were included in each experimental replicate. Furthermore, two syringes of each treatment were incubated within each run to assess the effects of both additives on bacterial abundance.

2.2. Ruminal Inoculum and Experimental Diet Preparation

Whole rumen contents were collected at a slaughterhouse from three male hair-breed lambs (5 months old) previously fed a concentrate-type diet consisting of 10% alfalfa hay, 15% wheat straw, 62% wheat grain, 11% soybean meal, and 2% mineral/vitamin premix. The lambs were slaughtered at the Institute of Agricultural Science-UABC slaughterhouse. The rumen contents were first pooled and strained through a four-layered cheesecloth, and then the ruminal fluid was buffered using a buffer solution as described by McDougall [18] at a 1:2 ratio. The pH of the buffered ruminal fluid was adjusted to 6.8 using a 1 N HCl solution. The ruminal inoculum was kept in a 39 °C water bath, continuously flushed with CO2, and constantly shaken throughout use.
The experimental diet was a grain-based finishing diet formulated according to our previous study (10% wheat straw, 12% alfalfa hay, 61% corn grain, 8% soybean meal, 3% cane molasses, 0.5% mineral premix, 0.3% salt, and 5% poultry manure; 12.9% crude protein and 1.44 Mcal/kg of net energy for gain) [15]. The feed mixture was oven-dried at 60 °C for 24 h, ground through a 1 mm screen, and stored until needed.

2.3. In Vitro Incubation, Sampling, and Chemical Analysis

The in vitro incubations were conducted over 72 h in 60 mL syringes fitted with plungers. The syringes were filled under a stream of CO2 with 30 mL of ruminal inoculum and 200 mg of each experimental diet. The syringes were placed at 39 °C in a water bath. Gas production was recorded at 2, 4, 8, 12, 24, 36, 48, and 72 h during the in vitro fermentation period. Incubations were stopped at 12, 24, 48, or 72 h to measure the rumen fermentation characteristics and only at 24 h for the microbiome analysis.
The cumulative gas produced (mL) at each stage was recorded before incubation was stopped by reading the position of the piston [19]. In brief, all pistons were placed at an initial position. Before the piston reached the top, the syringe was purged (without breaking the anaerobiosis) and placed again at the initial position. The whole content of each syringe was collected in a 50 mL polypropylene tube, and the pH was immediately measured using a portable pH meter (Waterproof pHTestr 10, Eutech instruments, Singapore). Samples were immersed into liquid nitrogen and stored at −20 °C until analysis (−80 °C for the microbiome analysis). The total gas production was expressed as mL/g of dry matter of the substrate incubated and was corrected for the blanks.
Frozen samples were thawed at 4 °C overnight and centrifuged at 14,000× g for 10 min. The supernatant measured the ammonia-N (NH3-N) and volatile fatty acid (VFA) concentrations. The NH3-N concentration was analyzed by the phenol-hypochlorite color reaction method [20] at a wavelength of 630 nm using a spectrophotometer (Cary 60 UV-vis, Agilent Technologies Inc. Santa Clara, CA, USA). VFA concentrations were detected by gas chromatography (Hewlett Packard model 6890, Waldbronn, Germany) following the sample preparation procedure previously reported by Zhang et al. [21]. The gas chromatograph was fitted with an FID and a capillary column (0.25 mm × 60 m; 0.25 μm film thickness; Agilent J&W DB23) with the following conditions: 0.8 μL injection volume at a split ratio of 100:1 at the injection port (160 °C), an initial column temperature of 80 °C for 0 min, ramped to 115 °C (held for 3 min) at a rate of 15 °C/min, then increased at a rate of 3 °C/min to 130 °C for 0 min, and finally increased at a rate of 5 °C/min to a final temperature of 200 °C (held for 3 min) with a total running time of 27 min. The FID was maintained at 240 °C with a 40 mL/min flow rate of helium. An external standard mix was used to detect individual VFAs and quantitative calibration (Supelco Volatile Free Acid Mix, 46.975-U, Sigma-Aldrich, St. Louis, MO, USA). Additionally, a stock solution that included analytical grade acetate (71251, Sigma-Aldrich), propionate (94425, Sigma-Aldrich), and butyrate (19215, Sigma-Aldrich) was prepared with an initial concentration of 100 mmol/L of each acid. Standard calibration curves were used to calculate the concentrations of each VFA. The acetate to propionate ratio (A:P) was also estimated. CH4 production was calculated based on stoichiometry equations of VFA products [22]:
CH4 (mmol/mol of VFA) = 0.5a − 0.25p + 0.5b
where a, p, and b are the proportions (mmol/mol) of acetate, propionate, and butyrate, respectively.

2.4. DNA Extraction and Relative Abundance of Bacterial Species by qPCR Analysis

Before DNA extraction, bacterial cells were harvested from the liquid and solid fractions according to the procedure described by Larue et al. [23] with some modifications. Briefly, the frozen samples were thawed on ice overnight, and the bacterial cells were precipitated by centrifugation at 12,000× g 10 min at 4 °C. The pellet was resuspended in 15 mL of PBS solution (0.1% Tween 80, pH 7.4), vortexed for 2 min, and centrifuged at 300× g 1 min (4 °C) to sediment the plant particles. This mixture was re-centrifugated (500× g 10 min) after a 30 min ice-incubation step to elute the adherent bacteria fraction. The supernatant was carefully recovered, and the bacterial biomass was collected by centrifugation at 14,000× g 15 min (4 °C). The pellets were resuspended in 4 mL of sterile TE buffer (10× Tris-HCl: EDTA, pH 8.0) and harvested by high-speed centrifugation (14,000× g 15 min at 4 °C). The pellets were resuspended in 1 mL of TE buffer and stored at −80 °C before DNA extraction.
Genomic DNA was extracted from each sample using the improved repeated bead-beating plus column purification protocol described by Yu and Morrison [24]. The total DNA yield and purity were measured spectrophotometrically using a Nanodrop 1000 (Thermo Fisher Scientific Inc., Wilmington, DE, USA), and the DNA quality was confirmed by gel electrophoresis (0.8% agarose gel).
The relative abundances of the target bacterial species were analyzed using SYBR Green-based qPCR on the StepOne thermocycler (Applied BioSystems, Foster City, CA, USA). The amplifications were performed in triplicate using a total reaction volume of 20 µL, which consisted of 10 µL of 2× SYBR Green PCR Master Mix (Applied Applied BioSystems), 1 µL of each forward and reverse primer (5 µM), 7 µL of sterile DNA-free water, and 1 µL of template gDNA (30 ng).
The primers for the bacterial species were either newly designed using the Primer3Plus software (https://www.primer3plus.com/index.html, accessed on 20 February 2024) or selected from the literature (Table 1). The primers were tested for specificity and performance. The oligonucleotides were synthesized by Integrated DNA (Technologies Inc., Coralville, IA, USA). Before the qPCR assay, each primer set’s amplification efficiency (E) was evaluated using a series of five 3-fold dilutions of the gDNA templates. The CT (threshold cycle) values were plotted against the logarithmic values of each DNA concentration to obtain the slope of the standard curve, and the amplification efficiency was calculated using the formula E = 10−1/slope.
The qPCR assay was performed under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 10 s, 58–63 °C (depending on the annealing T° of each primer set) for 30 s, and 72 °C for 35 s. A final melting analysis confirmed the PCR product specificity. Three negative controls were included in each assay. The relative abundance was calculated using the 2−∆∆CT method [25].
Table 1. Primer sequences used for qPCR assay.
Table 1. Primer sequences used for qPCR assay.
Target NamePrimer Sequences (5′–3′) aAnnealing Temperature (°C)Amplicon Size (bp)Source of Primer
Bacteria Universal
(GOR) b		F: ACACTGGAACTGAGACACGG62222This study
R: ATTACCGCGGCTGCTGG
Streptococcus bovisF: GAGTGCTAGGTGTTAGGCCC58184This study
R: ATCGGGATGTCAAGACCTGG
Ruminococcus albusF: ACATTGGGACTGAGACACGG62248This study
R: CCTACGCTCCCTTTACACCC
Selenomonas ruminantiumF: GGCGGGAAGGCAAGTCAGTC6383Khafipour et al. [26]
R: CCTCTCCTGCACTCAAGAAAGACAG
a Primers were based on 16S rRNA. b Gene of internal reference.

2.5. Statistical Analysis

The in vitro rumen fermentation variables (including the pH, gas production, CH4, NH3-N, VFAs, and A:P ratio) were analyzed using a 2 × 2 factorial design under a completely randomized design with repeated measures over time, using the PROC MIXED procedure from the SAS software (version 9.4). The model considered the fixed effect of the treatments, time of incubation, and their interaction. The most suitable model was selected based on the lowest AIC and BIC values to choose the appropriate covariance structure. A Tukey–Kramer test was used to evaluate the differences among the means at p ≤ 0.05.
For the qPCR assay, statistical analysis was conducted using SAS software (version 9.4). The PROC UNIVARIATE procedure was used to determine normality, and the variances homogeneity was tested using Levene’s test within the GLM procedure. Data were then analyzed as a 2 × 2 factorial design under a completely randomized design using the PROC GLM procedure, followed by the Tukey–Kramer test for means comparison. Statistical significance was declared at p ≤ 0.05.

3. Results

In Vitro Rumen Fermentation Characteristics

The effects of FA and CTL on gas production during the in vitro fermentation are shown in Figure 1. No significant interactions between time and treatment (p > 0.05) were observed for the cumulative gas production (Figure 1A). However, significant differences were observed for the time of incubation (p ≤ 0.05) at each time point throughout all treatments, reflecting the accumulation of fermentation products during the entire incubation period. Significant differences were detected for the main effect of FA (p = 0.014) and the FA × CTL interaction (p = 0.040) regarding the total gas production over the entire incubation stage (Figure 1B). The total gas production was significantly higher (p ≤ 0.05) for the FA group than for the other treatments.
Table 2 shows the changes in pH, NH3-N concentration, and CH4 production during the 72 h incubation. The FA main effect (p > 0.05) had no significant effects on the pH or NH3-N concentration. However, significant treatment × time interactions were observed for both the pH and NH3-N concentrations. Regarding the pH, the CTL and FAZ groups maintained the highest pH values (p = 0.03) during the incubation, and both groups recorded higher pH levels after the 72 h incubation. The NH3-N concentrations changed over time (p < 0.0001), with the CTL group showing the highest concentrations (p ≤ 0.05) at 12 h and the lowest at the end of the incubation (p ≤ 0.05). In contrast, the control recorded the lowest NH3-N values (p ≤ 0.05) at 12 h but reached the maximum concentrations (p ≤ 0.05) at 72 h among treatments. A similar trend was observed for the FAZ group regarding the NH3-N concentrations. CH4 production was not affected by any treatment or time x treatment interaction (p > 0.05). This indicates that neither FA nor CTL have significantly influenced CH4 production. An average CH4 production remained between 22.5 and 29.9 moles/mol VFA at 12 h and 72 h, respectively.
Table 3 shows the results for the concentrations of VFAs during the in vitro incubation. Butyrate, isobutyrate, isovalerate concentrations, and the A/P ratio were not altered by any treatment or time by treatment interaction (p > 0.05). There were no significant effects (p > 0.05) of the main factors on the individual or total VFA concentrations. However, the FA × CTL × T interaction was significant for concentrations of acetate (p = 0.002), propionate (p = 0.006), valerate (p = 0.012), and total VFAs (p = 0.0009). These changes (p ≤ 0.05) were detected only between 48 and 72 h of fermentation. At 48 h, acetate and propionate increased in response to the FA (~25%), CTL (~23%), and FAZ (~19%) inclusion. This increment remained constant at 72 h only for the FA and CTL groups. A similar trend was observed for the valerate concentrations at 72 h, reaching the highest values among treatments with FA and CTL inclusion. The increases in acetate, propionate, and valerate concentrations were reflected in the total VFAs.
Figure 2 presents the relative abundance of three target bacterial species. The relative abundance of Selenomonas ruminantium was not significantly affected by any of the treatments (p > 0.05). However, FA and CTL reduced the relative abundance of Ruminococcus albus (p ≤ 0.05), with the combination of FA and CTL resulting in the lowest abundance of this species. The abundance of Streptococcus bovis was lower in CTL and FAZ (p ≤ 0.05) compared to the control and FA treatments.

4. Discussion

To our knowledge, few studies have investigated the effects of FA and CTL on the rumen fermentation profile, despite evidence suggesting that PCH and zeolites show promise as natural feed additives to manipulate rumen fermentation, reduce methane production, and enhance digestion in ruminants [10,27,28,29]. However, their exact mechanism of action remains unclear. In this study, we examined the effects of FA and CTL supplementation on the in vitro rumen fermentation profile and the abundance of key bacterial species in finishing diets.
Gas production during in vitro fermentation is closely associated with feed digestibility, mainly carbohydrate fermentation. It indicates VFA and methane production, providing valuable insights into animal performance and feed utilization [30]. In the present study, the observed increase in total gas production with FA inclusion suggests a positive effect on the grade and rate of the in vitro feed degradability. Although no studies have evaluated the effects of FA on ruminal fermentation or gas production, current reports indicate that moderate use of phenolic compounds can enhance the in vitro feed degradability and increase acetate and propionate production [31,32]. These changes may be attributed to reduced rumen oxidative stress or enhanced activity of specific bacterial species, potentially leading to improved energy utilization and VFA production in an in vivo model [32,33,34]. Moreover, FA may be metabolized by rumen bacteria such as B. fibrisolvens, Megasphaera elsdenii, or R. albus, which possess feruloyl esterases, leading to the production of acetate or propionate [35,36,37]. However, our findings partially support this premise, as we observed a reduction in the abundance of R. albus. On the other hand, although the abundance of M. elsdenii was not measured, another notable change in the AGV profile was an increase in valerate production because of FA and CTL. In normal conditions, low valerate concentrations are produced in the rumen; thus, an increase in the abundance of M. elsdenii could help explain why we found higher valerate production. M. elsdenii is a bacteria known to produce valerate and propionate from lactate [38]; hence, this could explain the increased concentrations of acetate, propionate, and valerate observed in the present study following FA inclusion, which may be reflected in the total gas production and total VFA concentrations.
Another factor closely associated with more intense carbohydrate fermentation is the rumen pH, which decreases as VFA production increases, particularly acetic and propionic acids. In this study, FA inclusion resulted in a lower pH than the CTL-supplemented diets. Several authors have highlighted CTL’s buffering properties, attributed to its ability to exchange H+ ions [39,40]. Stabilizing the pH closer to neutral supports the microbial growth rates and enhanced microbial protein synthesis. Therefore, the pH stabilization observed with CTL inclusion suggests that CTL may protect the rumen from pH fluctuations, mitigating the metabolic disorders commonly observed in finishing diets, especially during the initial hours post-feeding.
Supplementation with PCH and clinoptilolite in ruminant diets has been shown to influence nitrogen metabolism, particularly the N-NH3 and iso-VFA concentrations, both related to protein degradation [6,9,10,29,41]. Differences in the N-NH3 concentrations between treatments became more evident after 48 and 72 h of incubation. The reduction in N-NH3 concentrations due to CTL and FA inclusion may result from modified proteolysis, likely due to a shift in the rumen bacteria composition. Additionally, the decrease in N-NH3 concentrations in response to CTL may be associated with its ion-exchange properties, where clinoptilolite removes ammonium ions and releases them during rumination, contributing to more efficient rumen microorganisms’ growth [10,41,42,43,44]. According to our findings, other studies have reported a decrease in protein degradation with the use of essential oils and phenolic compounds, attributing this effect to the formation of reversible protein complexes or the inhibition of proteolytic or hyper-ammonia-producing bacteria, such as Butyrivibrio sp., S. bovis, or S. ruminantium, which is supported by the changes observed in the N-NH3 and iso-VFA concentrations [41,44,45]. Although FA did not alter the iso-VFA molar proportions in this study, it reduced the abundance of S. bovis, a known ammonia-producing bacteria. In previous studies, S. bovis has been reported to be sensitive to PCH [2,32], and its presence has been associated with a lower efficiency in ruminant fermentation profiles [14]. These findings suggest that, unlike higher molecular weight phenolic compounds, FA may not form protein complexes. Instead, it could modulate the growth rate of certain bacterial species through its antimicrobial properties.
Moreover, our results showed that FA and CTL significantly increased acetate and propionate concentrations in the in vitro fermentation profile, contributing to an overall increase in total VFA production. The effects of the CTL on VFA profiles have been inconsistent across studies. According to our findings, McCollum and Galyean [29] and Mahdavirad et al. [11] reported increased proportions of propionate and acetate in CTL-supplemented steers (2.5%) and lambs (2%), respectively. In contrast, Kardaya et al. [46] and Dschaak et al. [47] observed no effect on the VFA concentrations when supplementing lambs and dairy cows with 1% zeolite. These discrepancies may be due to differences in the dose or chemical composition of CTL. Regarding FA, as mentioned above, the observed changes in acetate and propionate concentrations might be due to the metabolization of FA into VFA by certain rumen bacterial species [35,36]. Hence, we suggest that the simultaneous rise of acetate and propionate (typically produced through different fermentation pathways) might be due to modulations in the rumen environment and bacterial activity induced by both additives through different action mechanisms, which could promote a syntropy between hydrogen-producing and hydrogen-consuming bacteria. Furthermore, we hypothesize that a greater proportion of carbohydrates in the finishing diet were converted to pyruvate, which was subsequently transformed into acetate or propionate in the FA and CTL treatments. However, further research on rumen microbiome characterization must confirm these speculations.
In this study, using FA and CTL decreased the relative abundance of R. albus and S. bovis. Previous research has shown that phenolic compounds can alter bacterial metabolism in various ways, first, by disrupting bacterial membranes, and second, by forming ion channels in the cell membranes, which affects bacterial growth and enzymatic activity depending on the compound and bacterial species [35,37]. However, not all bacterial species are equally affected. Phenolic compounds exert a greater effect on Gram-positive bacteria such as R. albus, R. flavefaciens, B. fibrisolvens, and S. bovis compared to species like S. ruminantium [35,37]. S. ruminantium has been shown to metabolize various phenolic compounds and use them as an energy source for its metabolism [2]. This bacterium’s multiple carbon flux metabolic pathways enable it to adapt to different rumen conditions and utilize a wide range of substrates [13,48]. These mechanisms may explain the reduction in the relative abundance of R. albus and S. bovis observed in this study and the tendency to increase the abundance of S. ruminantium in response to FA.
On the other hand, to our knowledge, this is the first study to report the effects of CTL on the in vitro bacterial relative abundance. The exact mechanism by which CTL affects rumen bacteria remains unknown. However, to explain the results observed in this study, we propose that the ion-exchange capacity of clinoptilolite enables this zeolite to absorb and reduce the availability of various molecules, such as ammonia, cations, or fermentation end-products, thereby influencing the rumen environment and potentially altering bacterial populations [8]. R. albus relies on N-NH3 as a primary source for protein synthesis [12,49], so a lower availability of this nutrient could limit its growth, which aligns with the reduced N-NH3 concentrations observed in our study. Additionally, CTL is well known for its buffering effect in the rumen, which could explain the reduction in the relative abundance of S. bovis. CTL helped maintain a more neutral ruminal pH. S. bovis typically proliferate in more acidic conditions [12,50]. Therefore, future studies analyzing the bacterial abundance in response to FA or CTL must elucidate how these additives modulate rumen bacterial populations.

5. Conclusions

This study provides novel data on how ferulic acid and clinoptilolite modulate the rumen fermentation characteristics and bacterial populations. Our results suggest that these additives can positively influence in vitro rumen fermentation, potentially enhancing animal productivity by improving rumen fermentation efficiency. Moreover, our findings indicate that both additives might alter rumen microbiome communities, which could affect nutrient digestibility. Further in vitro and in vivo research is needed to optimize both the additives’ dosage and exposure time to fully understand their impact on the ruminal fermentation parameters and achieve animal productive efficiency. Additionally, metagenomic approaches are recommended to determine the changes in the whole rumen microbiome composition and analyze the biological functions or interactions in response to ferulic acid and clinoptilolite supplementation.

Author Contributions

Conceptualization: González-Rios H. Data curation: A.T.-L., A.P.-S., A.M.-A., and M.Á.L.-B. Formal analysis: A.T.-L., M.Á.L.-B., J.L.D.-R., and A.M.-A. Methodology: A.T.-L., M.Á.L.-B., M.M.-C., M.V.-M., T.Y.I.-L., and H.G.-R. Investigation: A.T.-L., M.Á.L.-B., A.P.-S., T.Y.I.-L., and H.G.-R. Writing—original draft: A.T.-L., and H.G.-R. Writing—review and editing: A.T.-L., M.Á.L.-B., M.M.-C., A.P.-S., M.V.-M., J.L.D.-R., T.Y.I.-L., A.M.-A., and H.G.-R. All authors have read and agreed to the published version of the manuscript.

Funding

This current research was supported by the Centro de Investigación en Alimentación y Desarrollo A. C (Project 20208), the Institute of Agricultural Science (ICA-UABC), and Conahcyt (Mexico Government) awarded a postgraduate scholarship to the first author (871831).

Institutional Review Board Statement

For this research, no ethical approval or review was needed because rumen contents were taken from post-mortem animals only. The slaughter of lambs was carried out according to the official guidelines for animal care and slaughter in México.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The authors acknowledge the support and facilities provided in the field phase (ICA-UABC) by Ulises Macías, Germán Castillo, María Cisneros, and Marisol Galicia. A special thanks goes to Q.B. Sandra R. Araujo Bernal, and Hector Parra Sánchez for their technical assistance in the gene expression analysis.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Baldi, A.; Gottardo, D. Livestock production to feed the planet: Animal protein: A forecast of global demand over the next years. Beyond Anthr. 2017, 5, 65. [Google Scholar] [CrossRef]
  2. Grazziotin, R.; Halfen, J.; Rosa, F.; Schmitt, E.; Anderson, J.; Ballard, V.; Osorio, J. Altered rumen fermentation patterns in lactating dairy cows supplemented with phytochemicals improve milk production and efficiency. J. Dairy Sci. 2020, 103, 301–312. [Google Scholar] [CrossRef] [PubMed]
  3. Peña-Torres, E.F.; Dávila-Ramírez, J.L.; Peña-Ramos, E.A.; Valenzuela-Melendres, M.; Pinelli-Saavedra, A.; Avendaño-Reyes, L.; González-Ríos, H. Effects of dietary ferulic acid on growth performance, carcass traits and meat quality of heifers. J. Sci. Food Agric. 2021, 101, 548–554. [Google Scholar] [CrossRef] [PubMed]
  4. Liu, H.; Vaddella, V.; Zhou, D. Effects of chestnut tannins and coconut oil on growth performance, methane emission, ruminal fermentation, and microbial populations in sheep. J. Dairy Sci. 2011, 94, 6069–6077. [Google Scholar] [CrossRef]
  5. Singh, A.K.; Ojha, L.; Kumari, P.; Choubey, M.; Chaudhary, S.K. Phytochemicals as Natural Feed Additives for Ruminants. In Feed Additives and Supplements for Ruminants; Springer: Berlin/Heidelberg, Germany, 2024; pp. 167–196. [Google Scholar]
  6. Choi, Y.; Lee, S.J.; Kim, H.S.; Eom, J.S.; Jo, S.U.; Guan, L.L.; Seo, J.; Kim, H.; Lee, S.S.; Lee, S.S. Effects of seaweed extracts on in vitro rumen fermentation characteristics, methane production, and microbial abundance. Sci. Rep. 2021, 11, 24092. [Google Scholar] [CrossRef]
  7. Macías-Cruz, U.; Vicente-Pérez, R.; López-Baca, M.; González-Ríos, H.; Correa-Calderón, A.; Arechiga, C.; Avendano-Reyes, L. Effects of dietary ferulic acid on reproductive function and metabolism of pre-pubertal hairbreed ewes during the anestrous season. Theriogenology 2018, 119, 220–224. [Google Scholar] [CrossRef]
  8. Tánori-Lozano, A.L.; Dávila-Ramírez, J.L.; Medrano-Vazquez, L.S.; Hernández-Mendoza, E.; González-Rios, H. Properties and uses of clinoptilolite. In Agricultural Research Updates; Nova Science Publishers, Inc.: Hauppauge, NY, USA, 2024; Volume 47, pp. 33–81. [Google Scholar]
  9. Goodarzi, M.; Nanekarani, S. The effects of calcic and potassic clinoptilolite on ruminal parameters in Lori breed sheep. APCBEE Procedia 2012, 4, 140–145. [Google Scholar] [CrossRef]
  10. Ghoneem, W.M.A.; El-Tanany, R.R.; Mahmoud, A.E.M. Effect of Natural Zeolite as a Rumen Buffer on Growth Performance and Nitrogen Utilization of Barki Lambs. Pak. J. Zool. 2022, 54, 1199–1207. [Google Scholar] [CrossRef]
  11. Mahdavirad, N.; Chaji, M.; Bojarpour, M.; Dehghanbanadaky, M. Comparison of the effect of sodium bicarbonate, sodium sesquicarbonate, and zeolite as rumen buffers on apparent digestibility, growth performance, and rumen fermentation parameters of Arabi lambs. Trop. Anim. Health Prod. 2021, 53, 465. [Google Scholar] [CrossRef]
  12. Russell, J.B.; Rychlik, J.L. Factors that alter rumen microbial ecology. Science 2001, 292, 1119–1122. [Google Scholar] [CrossRef]
  13. Ricke, S.; Martin, S.; Nisbet, D. Ecology, metabolism, and genetics of ruminal selenomonads. Crit. Rev. Microbiol. 1996, 22, 27–65. [Google Scholar] [CrossRef] [PubMed]
  14. Elolimy, A.A.; Arroyo, J.M.; Batistel, F.; Iakiviak, M.A.; Loor, J.J. Association of residual feed intake with abundance of ruminal bacteria and biopolymer hydrolyzing enzyme activities during the peripartal period and early lactation in Holstein dairy cows. J. Anim. Sci. Biotechnol. 2018, 9, 43. [Google Scholar] [CrossRef] [PubMed]
  15. Tánori-Lozano, A.; Quintana-Romandía, A.I.; Montalvo-Corral, M.; Pinelli-Saavedra, A.; Valenzuela-Melendres, M.; Dávila-Ramírez, J.L.; Islava-Lagarda, T.Y.; González-Ríos, H. Influence of ferulic acid and clinoptilolite supplementation on growth performance, carcass, meat quality, and fatty acid profile of finished lambs. J. Anim. Sci. Technol. 2022, 64, 274–290. [Google Scholar] [CrossRef] [PubMed]
  16. Tánori-Lozano, A.L. Modulación de la Fermentación Ruminal por el uso Combinado de Zeolita y Ácido Ferúlico en Dieta de Ovinos. Ph.D. Thesis, Centro de Investigación en Alimentación y Desarrollo, Repositorio CIAD, Hermosillo, Mexico, 2023. [Google Scholar]
  17. Menke, K.H.; Raab, L.; Salewski, A.; Steingass, H.; Fritz, D.; Schneider, W. The estimation of the digestibility and metabolizable energy content of ruminant feedingstuffs from the gas production when they are incubated with rumen liquor in vitro. J. Agric. Sci. 1979, 93, 217–222. [Google Scholar] [CrossRef]
  18. McDougall, E.I. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochem. J. 1948, 43, 99. [Google Scholar] [CrossRef]
  19. Fleming, A.; Beck, M.R.; Bryant, R.H.; Dalley, D.; Edwards, G.; Gregorini, P. In vitro fermentation of fodder beet root increases cumulative gas production of methane and carbon dioxide. Livest. Sci. 2020, 241, 104225. [Google Scholar] [CrossRef]
  20. Weatherburn, M. Phenol-hypochlorite reaction for determination of ammonia. Anal. Chem. 1967, 39, 971–974. [Google Scholar] [CrossRef]
  21. Zhang, Z.; Xu, D.; Wang, L.; Hao, J.; Wang, J.; Zhou, X.; Wang, W.; Qiu, Q.; Huang, X.; Zhou, J. Convergent evolution of rumen microbiomes in high-altitude mammals. Curr. Biol. 2016, 26, 1873–1879. [Google Scholar] [CrossRef]
  22. Wolin, M.J. A theoretical rumen fermentation balance. J. Dairy Sci. 1960, 43, 1452–1459. [Google Scholar] [CrossRef]
  23. Larue, R.; Yu, Z.; Parisi, V.A.; Egan, A.R.; Morrison, M. Novel microbial diversity adherent to plant biomass in the herbivore gastrointestinal tract, as revealed by ribosomal intergenic spacer analysis and rrs gene sequencing. Environ. Microbiol. 2005, 7, 530–543. [Google Scholar] [CrossRef]
  24. Yu, Z.; Morrison, M. Improved extraction of PCR-quality community DNA from digesta and fecal samples. Biotechniques 2004, 36, 808–812. [Google Scholar] [CrossRef] [PubMed]
  25. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  26. Khafipour, E.; Li, S.; Plaizier, J.C.; Krause, D.O. Rumen microbiome composition determined using two nutritional models of subacute ruminal acidosis. Appl. Environ. Microbiol. 2009, 75, 7115–7124. [Google Scholar] [CrossRef] [PubMed]
  27. Menci, R.; Coppa, M.; Torrent, A.; Natalello, A.; Valenti, B.; Luciano, G.; Priolo, A.; Niderkorn, V. Effects of two tannin extracts at different doses in interaction with a green or dry forage substrate on in vitro rumen fermentation and biohydrogenation. Anim. Feed Sci. Technol. 2021, 278, 114977. [Google Scholar] [CrossRef]
  28. Nowak, B.; Moniuszko-Szajwaj, B.; Skorupka, M.; Puchalska, J.; Kozłowska, M.; Bocianowski, J.; Kołodziejski, P.A.; Szumacher-Strabel, M.; Patra, A.K.; Stochmal, A. Effect of Paulownia leaves extract levels on in vitro Ruminal fermentation, microbial population, methane production, and fatty acid biohydrogenation. Molecules 2022, 27, 4288. [Google Scholar] [CrossRef]
  29. McCollum, F.T.; Galyean, M.L. Effects of clinoptilolite on rumen fermentation, digestion and feedlot performance in beef steers fed high concentrate diets. J. Anim. Sci. 1983, 56, 517–524. [Google Scholar] [CrossRef]
  30. Getachew, G.; Robinson, P.; DePeters, E.; Taylor, S. Relationships between chemical composition, dry matter degradation and in vitro gas production of several ruminant feeds. Anim. Feed Sci. Technol. 2004, 111, 57–71. [Google Scholar] [CrossRef]
  31. Jin, L.; Dunière, L.; Lynch, J.; Zaheer, R.; Turkington, K.; Blackshaw, R.; Lupwayi, N.; O’Donovan, J.; Harker, K.; McAllister, T. Impact of ferulic acid esterase-producing lactobacilli and fibrolytic enzymes on ensiling and digestion kinetics of mixed small-grain silage. Grass Forage Sci. 2017, 72, 80–92. [Google Scholar] [CrossRef]
  32. Min, B.; Wright, C.; Ho, P.; Eun, J.; Gurung, N.; Shange, R. The effect of phytochemical tannins-containing diet on rumen fermentation characteristics and microbial diversity dynamics in goats using 16S rDNA amplicon pyrosequencing. Agric. Food Anal. Bacteriol. 2014, 4, 141909. [Google Scholar]
  33. Barakat, A.Z.; Hamed, A.R.; Bassuiny, R.I.; Abdel-Aty, A.M.; Mohamed, S.A. Date palm and saw palmetto seeds functional properties: Antioxidant, anti-inflammatory and antimicrobial activities. J. Food Meas. Charact. 2020, 14, 1064–1072. [Google Scholar] [CrossRef]
  34. Soltan, Y.; Hashem, N.; Morsy, A.; El-Azrak, K.; El-Din, A.N.; Sallam, S. Comparative effects of Moringa oleifera root bark and monensin supplementations on ruminal fermentation, nutrient digestibility and growth performance of growing lambs. Anim. Feed Sci. Technol. 2018, 235, 189–201. [Google Scholar] [CrossRef]
  35. Chesson, A.; Stewart, C.S.; Wallace, R.J. Influence of plant phenolic acids on growth and cellulolytic activity of rumen bacteria. Appl. Environ. Microbiol. 1982, 44, 597–603. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, Y.-L.; Wang, W.-K.; Wu, Q.-C.; Yang, H.-J. The release and catabolism of ferulic acid in plant cell wall by rumen microbes: A review. Anim. Nutr. 2022, 9, 335–344. [Google Scholar] [CrossRef] [PubMed]
  37. Borneman, W.S.; Akin, D.; VanEseltine, W. Effect of phenolic monomers on ruminal bacteria. J. Appl. Environ. Microbiol. 1986, 52, 1331–1339. [Google Scholar] [CrossRef]
  38. Weimer, P.; Digman, M. Fermentation of alfalfa wet-fractionation liquids to volatile fatty acids by Streptococcus bovis and Megasphaera elsdenii. Bioresour. Technol. 2013, 142, 88–94. [Google Scholar] [CrossRef]
  39. Amanzougarene, Z.; Fondevila, M. Rumen Fermentation of Feed Mixtures Supplemented with Clay Minerals in a Semicontinuous In Vitro System. Animals 2022, 12, 345. [Google Scholar] [CrossRef]
  40. White, J.L.; Ohlrogge, A.J. Ion Exchange Materials to Increase Consumption of Non-Protein Nitrogen by Ruminants. U.S. Patent 4,393,082, 12 July 1983. [Google Scholar]
  41. Zhang, X.; Ke, W.; Ding, Z.; Xu, D.; Wang, M.; Chen, M.; Guo, X. Microbial mechanisms of using feruloyl esterase-producing Lactobacillus plantarum A1 and grape pomace to improve fermentation quality and mitigate ruminal methane emission of ensiled alfalfa for cleaner animal production. J. Environ. Manag. 2022, 308, 114637. [Google Scholar] [CrossRef]
  42. Roque-Jiménez, J.; Pinos-Rodríguez, J.; Rojo-Rub, R.; Mendoza, G.; Vazquez, A.; De Jesus, J.C.; Lee-Rangel, H. Effect of natural zeolite on live weight changes, ruminal fermentation and nitrogen metabolism of ewe lambs. S. Afr. J. Anim. Sci. 2018, 48, 1148–1155. [Google Scholar] [CrossRef]
  43. Ebeid, H.M.; Mengwei, L.; Kholif, A.E.; Hassan, F.-u.; Lijuan, P.; Xin, L.; Chengjian, Y. Moringa oleifera oil modulates rumen microflora to mediate in vitro fermentation kinetics and methanogenesis in total mix rations. Curr. Microbiol. 2020, 77, 1271–1282. [Google Scholar] [CrossRef]
  44. Zhou, R.; Wu, J.; Lang, X.; Liu, L.; Casper, D.P.; Wang, C.; Zhang, L.; Wei, S. Effects of oregano essential oil on in vitro ruminal fermentation, methane production, and ruminal microbial community. J. Dairy Sci. 2020, 103, 2303–2314. [Google Scholar] [CrossRef]
  45. Hartinger, T.; Gresner, N.; Südekum, K.-H. Does intra-ruminal nitrogen recycling waste valuable resources? A review of major players and their manipulation. J. Anim. Sci. Biotechnol. 2018, 9, 33. [Google Scholar] [CrossRef] [PubMed]
  46. Kardaya, D.; Sudrajat, D.; Dihansih, E. Efficacy of dietary urea-impregnated zeolite in improving rumen fermentation characteristics of local lamb. Media Paternakan 2012, 35, 207. [Google Scholar] [CrossRef]
  47. Dschaak, C.; Eun, J.-S.; Young, A.; Stott, R.; Peterson, S. Effects of supplementation of natural zeolite on intake, digestion, ruminal fermentation, and lactational performance of dairy cows. Prof. Anim. Sci. 2010, 26, 647–654. [Google Scholar] [CrossRef]
  48. Wang, Y.; Alexander, T.W.; McAllister, T.A. In vitro effects of phlorotannins from Ascophyllum nodosum (brown seaweed) on rumen bacterial populations and fermentation. J. Sci. Food Agric. 2009, 89, 2252–2260. [Google Scholar] [CrossRef]
  49. Russell, J.B.; Wilson, D.B. Why are ruminal cellulolytic bacteria unable to digest cellulose at low pH? J. Dairy Sci. 1996, 79, 1503–1509. [Google Scholar] [CrossRef]
  50. Russell, J.B.; Wallace, R.J. Energy-yielding and energy-consuming reactions. Rumen Microb. Ecosyst. 1997, 246–282. [Google Scholar] [CrossRef]
Fermentation 10 00549 g001
Figure 1. Effects of ferulic acid (FA) and clinoptilolite (CTL) on in vitro gas production (mL/g DM). (A) Cumulative gas production throughout the in vitro fermentation period. (B) Total gas production during the fermentation period. Cumulative gas production was affected by incubation time (p ≤ 0.05). FA (p = 0.014) main effect and FA × CTL interaction (p = 0.040) on total gas production were significant. abcdef, means with different letters, are different (p ≤ 0.05).
Figure 1. Effects of ferulic acid (FA) and clinoptilolite (CTL) on in vitro gas production (mL/g DM). (A) Cumulative gas production throughout the in vitro fermentation period. (B) Total gas production during the fermentation period. Cumulative gas production was affected by incubation time (p ≤ 0.05). FA (p = 0.014) main effect and FA × CTL interaction (p = 0.040) on total gas production were significant. abcdef, means with different letters, are different (p ≤ 0.05).
Fermentation 10 00549 g001
Fermentation 10 00549 g002
Figure 2. Effect of ferulic acid (FA) and clinoptilolite (CTL) on relative abundance (relative units) of bacterial species. Different letters denote statistical differences at p ≤ 0.05. Bars represent mean values with standard error.
Figure 2. Effect of ferulic acid (FA) and clinoptilolite (CTL) on relative abundance (relative units) of bacterial species. Different letters denote statistical differences at p ≤ 0.05. Bars represent mean values with standard error.
Fermentation 10 00549 g002
Table 2. Effect of ferulic acid and clinoptilolite on in vitro ruminal fermentation products during 72 h incubation.
Table 2. Effect of ferulic acid and clinoptilolite on in vitro ruminal fermentation products during 72 h incubation.
ItemIncubation Time (h)No CTL CTL 2SEMp-Value 3
No FAFA 1No FAFAFACTLFA × CTLFA × CTL × T
pH126.4 a6.4 a6.45 b6.4 a0.011.0000.0300.030<0.0001
246.3 a6.4 b6.4 b6.3 a
486.4 a6.4 a6.4 a6.45 b
726.3 a6.3 a6.35 b6.35 b
NH3-N 4 (mg/L)1234.4 a39.17 ac48.96 b42.65 c1.840.1690.7070.008<0.0001
2450.84 a50.12 a49.80 a51.54 a
4840.34 a35.19 ab34.66 b39.07 ab
7257.19 a38.92 b37.81 b44.97 c
CH4 5 (moles/mol VFA)1222.5022.5622.3722.571.400.4320.8230.0930.1173
2426.1425.8825.3225.28
4824.3529.8029.0028.01
7228.8032.4330.4827.91
a–c Means within a row with unlike letters differ at p ≤ 0.05; 1 ferulic acid dose level of 300 ppm; 2 clinoptilolite dose level of 1%; 3 FA: main effect of ferulic acid; CTL: main effect of clinoptilolite; FA × CTL: interaction effect of FA and CTL; FA × CTL × T: interaction effect of FA × CTL through incubation period; 4 NH3-N: ammonia nitrogen; 5 CH4: methane.
Table 3. Effects of ferulic acid and clinoptilolite on volatile fatty acids (VFAs) during the in vitro incubation.
Table 3. Effects of ferulic acid and clinoptilolite on volatile fatty acids (VFAs) during the in vitro incubation.
VFA (mmol/L)Incubation Time (h)No CTL CTL 2SEMp-Value 3
No FAFA 1No FAFAFACTLFA × CTLFA × CTL × T
Acetate1243.05 a43.61 a42.87 a43.33 a2.1270.1850.8880.0030.002
2449.64 a49.43 a48.02 a48.15 a
4845.12 a56.87 b55.50 b53.72 b
7250.57 a61.96 b58.39 b48.96 a
Propionate1225.89 a26.55 a26.08 a26.25 a2.1010.5170.8790.1000.006
2428.60 a28.95 a27.84 a28.18 a
4824.27 a30.83 b30.63 b30.48 b
7225.06 a32.95 b31.51 b24.11a
Butyrate1214.8914.7814.9114.941.2760.7580.9170.8210.647
2416.9416.8016.5316.50
4815.7218.1417.8117.53
7219.5619.3718.3218.91
Isobutyrate122.862.812.702.750.1710.8860.9620.4020.862
243.593.553.603.57
483.533.533.583.59
723.613.403.443.62
Valerate123.55 a3.56 a3.61 a3.59 a0.7010.7840.9690.1780.012
244.31 a4.29 a4.15 a4.17 a
483.84 a5.06 a4.93 a4.77 a
723.56 a5.96 b5.67 b3.41 a
Isovalerate122.552.552.562.550.1270.5470.7780.1230.124
243.773.743.663.44
483.433.844.003.66
724.023.994.003.83
Total VFA1291.66 a92.76 a91.71 a92.34 a4.1160.2290.9960.0050.0009
24105.64 a105.56 a102.51 a102.75 a
4894.47 a117.33 b115.44 b112.69 b
72105.17 a126.92 b120.47 b101.52 a
A:P 4120.920.900.910.910.110.9270.8620.7660.594
240.940.920.940.93
481.041.011.000.97
721.131.031.021.15
a,b Means within a row with unlike letters differ at p ≤ 0.05; 1 ferulic acid dose level of 300 ppm; 2 clinoptilolite dose level of 1%; 3 FA: main effect of ferulic acid; CTL: main effect of clinoptilolite; FA × CTL: interaction effect of FA and CTL; FA × CTL × T: interaction effect of FA × CTL through incubation period; 4 A:P: acetate to propionate ratio.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tánori-Lozano, A.; López-Baca, M.Á.; Muhlia-Almazán, A.; Montalvo-Corral, M.; Pinelli-Saavedra, A.; Islava-Lagarda, T.Y.; Dávila-Ramírez, J.L.; Valenzuela-Melendres, M.; González-Rios, H. Ferulic Acid and Clinoptilolite Affect In Vitro Rumen Fermentation Characteristics and Bacterial Abundance. Fermentation 2024, 10, 549. https://doi.org/10.3390/fermentation10110549

AMA Style

Tánori-Lozano A, López-Baca MÁ, Muhlia-Almazán A, Montalvo-Corral M, Pinelli-Saavedra A, Islava-Lagarda TY, Dávila-Ramírez JL, Valenzuela-Melendres M, González-Rios H. Ferulic Acid and Clinoptilolite Affect In Vitro Rumen Fermentation Characteristics and Bacterial Abundance. Fermentation. 2024; 10(11):549. https://doi.org/10.3390/fermentation10110549

Chicago/Turabian Style

Tánori-Lozano, Ana, M. Ángeles López-Baca, Adriana Muhlia-Almazán, Maricela Montalvo-Corral, Araceli Pinelli-Saavedra, Thalia Y. Islava-Lagarda, José Luis Dávila-Ramírez, Martín Valenzuela-Melendres, and Humberto González-Rios. 2024. "Ferulic Acid and Clinoptilolite Affect In Vitro Rumen Fermentation Characteristics and Bacterial Abundance" Fermentation 10, no. 11: 549. https://doi.org/10.3390/fermentation10110549

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop