Recovery and Detection of Enteric Viruses from Non-Traditional Irrigation Water Sources
Abstract
:1. Introduction
2. Experimental Design
2.1. Materials
2.1.1. Filtration
2.1.2. Elution and Concentration
- Sodium Phosphate Dibasic (Na2HPO4) (Millipore Sigma, Burlington, MA, USA; Cat. no.: S9390)
- Potassium Phosphate Monobasic (KH2PO4) (MP Biomedicals, Solon, OH, USA; Cat. no.: 195453)
- Sodium Polyphosphate (NaPP) (Fisher Scientific, Hampton, NH, USA; Cat. no.: 390932500)
- Glycine (Fisher ScientificCat. no.: G48-500)
- 6N NaOH for pH Adjustment
- 100 kDa Centricon Plus-70 Centrifugal Filters (MilliporeSigma; Cat. no.: UFC710008)
2.1.3. Extraction
- Tulane Virus (a gift from Dr. Xi Jiang, University of Cincinnati College of Medicine, Cincinnati, OH, USA)
- AllPrep PowerViral RNA/DNA Kit (Qiagen, Hilden, Germany; Cat. no.: 28000-50)
- RNase-Free DNase Set (Qiagen; Cat. no.: 79254)
2.1.4. Detection
- tris-EDTA (TE) Buffer (Thermo Fisher Scientific, Waltham, MA, USA; Cat. no.: AM9858)
- QuantiNova Probe RT-PCR Kit (Qiagen; Cat. no.: 208354)
- Strip Tubes and Caps, 0.1 mL (Qiagen; Cat. no.: 981103)
- Custom Probe-Based qPCR Assays, Primers and Probes (Integrated DNA Technologies, Coralville Iowa, USA)
- Norovirus GI synthetic RNA Segment (ATCC, Manassas, VA, USA; Cat. no.: VR-3234SD)
- Norovirus GII synthetic RNA Segment (ATCC; Cat. no.: VR-3235SD)
2.2. Equipment
2.2.1. Collection
2.2.2. Filtration and Concentration
- 3.8 GPM FloJet Pump (Xylem, Rye Brook, NY, USA; Cat. no.: 04300042)
- Hydronix Filter Housing Units (iFilters, Ontario, CA, USA; Cat. no.: HF2-5CLWH12)
- Allegra X-12R Centrifuge (Beckman Coulter, Pasadena, CA, USA; Cat. no.: 392302)
2.2.3. Extraction
2.2.4. Detection
3. Procedure
3.1. Sample Collection. Time for Completion: 00:15 Minutes
- Collect water samples using sterile 20 liter carboys. Submerge the carboy below the water surface, without disrupting sediment, use a pump to pump water into the carboy, or place beneath a tap and allow the carboy to fill.
- Transport samples to the laboratory and process immediately or refrigerate for up to 24 h.
3.2. Filtration and Elution. Time for Completion: 01:00 H
- Place a new sterile unused filter into a housing unit and connect the tubing (as seen in Figure 2)
- Connect two pieces of tubing to the filter housing unit and insert one piece of tubing into the carboy and attach the other to the pump.
- Turn on the pump and allow the water to flow through the filter until filtration is complete.i OPTIONAL STEP More than one filter may be used in this step if the filter becomes clogged.
- Disconnect the tubing and perform elution or freeze filters for up to 24 hours.
- Continue with the elution or repeat Steps 1–4 for additional samples.a) CRITICAL STEP New tubing should be used (between A and B in Figure 1) or previously used tubing should be bleached to reduce to risk of contamination between samples.
- Add 300 mL of sodium polyphosphate (NaPP) buffer to each housing unit and invert the unit 10 times.
- Allow the unit to incubate at room temperature for 15 min.
- Invert the unit 10 times and transfer the eluate to a sterile container.
- Transfer the eluate to the housing unit to rinse the filter and again to the container.
- Adjust the pH of eluates to 7.2 ± 0.2 using NaOH.CRITICAL STEP Add NaOH slowly to avoid loss of virus and decreasing the pH below the desired range.
- Concentrate the eluate immediately or refrigerate for up to 24 h.
3.3. Concentration. Time for Completion: 00:45 Min
- Add 60 mL of eluate to the top compartment of each centrifugal filter. Four filters are used to concentrate up to 240 mL of eluate. The remainder of eluate is stored at −80 °C or additional filters may be used to concentrate the entire volume.
- Place the lid securely on the filter and centrifuge at 1900 x g for 8 min.
- Remove the filtrate from the bottom compartmenta) OPTIONAL STEP If all of the 60 mL does not pass through the filter, an additional filter may be used.
- Repeat Steps 1–3 using sterile water in the top compartment of each filter.
- Invert the filter and centrifuge at 800 x g for 2 min.
- Pool the virus concentrate and store at −80 °C until performing extractions. The volume of concentrate varies between 500 µL and 14,500 µL.
3.4. Extraction and DNA removal. Time for Completion: 02:00 H
- If frozen, remove the concentrate and allow to thaw at room temperature.
- Centrifuge the thawed concentrate for 1 minute at 12,000 x g.
- Remove 200 µL of the supernatant and add 4 µL of TV, 5 log(copies/reaction), to each sample.
- Perform extractions in duplicate using Qiagen’s AllPrep PowerViral kit according to the manufacturer’s instructions.
- Do not perform optional Steps 3–7 of Qiagen protocol for bead beating.
- Between Steps 13 and 14 of the Qiagen protocol perform the DNase protocol according to the manufacturer’s instructions.
3.5. Detection via RT-qPCR Assay. Time for Completion: 02:00 H
- Concentrations of primers and probes should be adjusted to a working concentration prior to combining reagents (Table 1) and each set added to the appropriate reaction mix.
- RT-qPCR reagents are prepared and combined according to the manufacturer’s instructions (Table 2).
- Perform detection for each sample in triplicate and include positive and negative controls for each RT-qPCR run.
- The qPCR thermocycler was programmed as follows: 45 °C for 10 min, 95 °C for 5 min, and fifty cycles of 95 °C for 5 seconds and 60 °C for 30 s.
4. Expected Results
- No samples exhibited inhibition during detection using this protocol.
- If RT-qPCR is performed using a standard curve and the positive results are detected above the limit of detection, a comparison of detected levels may be performed. In this study, results were reported only as positive or not detected (ND).
- Concentrated viruses were spiked with the TV control prior to extraction. For a more comprehensive idea of virus recovery, TV could be introduced prior to filtration. This will not allow for absolute quantification as all viruses vary structurally. This study utilized TV as a control for successful extraction and detection of nucleic acids only.
5. Reagents Setup
- NaPP buffer is prepared by combining 0.54 g/L Na2HPO4, 0.88 g/L KH2PO4, 3.75 g/L glycine, and 10 g/L NaPP. The final concentrations of reagents are 0.0038M Na2HPO4, 0.0065M KH2PO4, 0.050M glycine, and 0.027M NaPP. The buffer requires autoclaving and cooling prior to pH adjustment to 9.3 using 6N NaOH.
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- United States Environmental Protection Agency. Available online: https://www3.epa.gov/region9/water/recycling/ (accessed on 28 May 2019).
- Cashdollar, J.L. Water Sample Filtration Methods Using VIRADEL Procedures; United States Environmental Protection Agency: Cincinnati, OH, USA, 2009.
- Goyal, S.M.; Gerba, C.P. Viradel method for detection of rota virus from seawater. J. Virol. Methods 1983, 7, 279–285. [Google Scholar] [CrossRef]
- Toranzos, G.A.; Gerba, C.P. An improved method for the concentration of rotaviruses from large volumes of water. J. Virol. Methods 1989, 24, 131–140. [Google Scholar] [CrossRef]
- Soto-Beltran, M.; Ikner, L.A.; Bright, K.R. Effectiveness of Poliovirus Concentration and Recovery from Treated Wastewater by Two Electropositive Filter Methods. Food Environ. Virol. 2013, 5, 91–96. [Google Scholar] [CrossRef] [PubMed]
- Ikner, L.A.; Soto-Beltran, M.; Bright, K.R. New Method Using a Positively Charged Microporous Filter and Ultrafiltration for Concentration of Viruses from Tap Water. Appl. Environ. Microbiol. 2011, 77, 3500–3506. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iker, B.C.; Bright, K.R.; Pepper, I.L.; Gerba, C.P.; Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods 2013, 191, 24–30. [Google Scholar] [CrossRef] [PubMed]
- Haramoto, E.; Kitajima, M.; Hata, A.; Torrey, J.R.; Masago, Y.; Sano, D.; Katayama, H. A review on recent progress in the detection methods and prevalence of human enteric viruses in water. Water Res. 2018, 135, 168–186. [Google Scholar] [CrossRef] [PubMed]
- Kitajima, M.; Hata, A.; Yamashita, T.; Haramoto, E.; Minagawa, H.; Katayama, H. Development of a Reverse Transcription-Quantitative PCR System for Detection and Genotyping of Aichi Viruses in Clinical and Environmental Samples. Appl. Environ. Microbiol. 2013, 79, 3952–3958. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jothikumar, N.; Cromeans, T.L.; Sobsey, M.D.; Robertson, B.H. Development and Evaluation of a Broadly Reactive TaqMan Assay for Rapid Detection of Hepatitis A Virus. Appl. Environ. Microbiol. 2005, 71, 3359–3363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kageyama, T.; Kojima, S.; Schinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Takeda, N.; Katayama, K. Broadly Reactive and Highly Sensitive Assay for Norwalk-Like Viruses Based on Real-Time Quantitative Reverse Transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548–1557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, P.; Yang, D.; Quigley, C.; Chou, M.; Jiang, X. Inactivation of Tulane Virus, a Novel Surrogate for the Human Norovirus. J. Food Protect. 2013, 76, 712–718. [Google Scholar] [CrossRef] [PubMed]
- Qiagen.com. AllPrep PowerViral DNA/RNA Kit Handbook. Available online: https://www.qiagen.com/us/resources/resourcedetail?id=41a1323f-581c-4e65-8d66-2491be4c625e&lang=en (accessed on 27 May 2019).
- Qiagen.com. RNase-Free DNase Set Product Sheet. Available online: https://www.qiagen.com/us/resources/resourcedetail?id=b0ca9e5a-ff87-476e-811b-ff80e4f07b3f&lang=en (accessed on 27 May 2019).
- IDTNA.com.-resuspension. Available online: http// www.idtdna.com/Calc/resuspension/ (accessed on 27 May 2019).
- IDTNA.com.-dilution. Available online: http// www.idtdna.com/Calc/dilution/ (accessed on 27 May 2019).
Target | Primer Set | Sequence (5′-3′) | Stock Concentration (nM) | Reaction Concentration (nM) | Reference |
---|---|---|---|---|---|
AiV | Forward | GTCTCCACHGACACYAAYTGGAC | 8000 | 400 | [9] |
Reverse | GTTGTACATRGCAGCCCAGG | 8000 | 400 | ||
Probe | FAM-TTYTCCTTYGTGCGTGC-BHQ1 | 6000 | 300 | ||
HAV | Forward | GGTAGGCTACGGGTGAAAC | 5000 | 250 | [10] |
Reverse | AACAACTCACCAATATCCGC | 5000 | 250 | ||
Probe | FAM-CTTAGGCTAATACTTCTATGAAGAGATGC-BHQ1 | 3000 | 150 | ||
NoV GI | Forward | CGYTGGATGCGNTTYCATGA | 8000 | 400 | [11] |
Reverse | CTTAGACGCCATCATCATTYAC | 8000 | 400 | ||
Probe 1 | FAM-AGATYGCGATCYCCTGTCCA-BHQ1 | 6000 | 300 | ||
Probe 2 | FAM-AGATCGCGGTCTCCTGTCCA-BHQ1 | 2000 | 100 | ||
NoV GII | Forward | CARGARBCNATGTTYAGRTGGATGAG | 8000 | 400 | [11] |
Reverse | TCGACGCCATCTTCATTCACA | 8000 | 400 | ||
Probe | FAM-TGGGAGGGCGATCGCAATCT-BHQ1 | 6000 | 300 | ||
TV | Forward | GACGATGACCTTGCGTG | 6000 | 300 | [12] |
Reverse | TGGGATTCAACCATGATACAGTC | 6000 | 300 | ||
Probe | FAM-ACCCCAAAGCCCCAGAGTTGAT-BHQ1 | 2000 | 100 |
Reagent | Volume (µL) |
---|---|
Master Mix | 10.0 |
RT Mix | 0.2 |
Forward Primer | 1.0 |
Reverse Primer | 1.0 |
Probe * | 1.0 |
Template RNA ** | 2.0 |
RNase-Free Water | Balance |
Total | 20 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Anderson-Coughlin, B.L.; Kniel, K.E. Recovery and Detection of Enteric Viruses from Non-Traditional Irrigation Water Sources. Methods Protoc. 2019, 2, 55. https://doi.org/10.3390/mps2030055
Anderson-Coughlin BL, Kniel KE. Recovery and Detection of Enteric Viruses from Non-Traditional Irrigation Water Sources. Methods and Protocols. 2019; 2(3):55. https://doi.org/10.3390/mps2030055
Chicago/Turabian StyleAnderson-Coughlin, Brienna L., and Kalmia E. Kniel. 2019. "Recovery and Detection of Enteric Viruses from Non-Traditional Irrigation Water Sources" Methods and Protocols 2, no. 3: 55. https://doi.org/10.3390/mps2030055