Next Article in Journal
Insights into a Renowned Fishery: Distinct Spatial Patterns, Environmental Predictors and Species Associations of Trophy-Class Spotted Seatrout (Cynoscion nebulosus [Cuvier 1830])
Previous Article in Journal
Transcriptome Analysis of the Effect of Acute Ammonia Stress on Pseudobagrus ussuriensis Liver Tissue
Previous Article in Special Issue
Two Genotypes of Streptococcus iniae Are the Causative Agents of Diseased Ornamental Fish, Green Terror Cichlid (Aequidens rivulatus)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Establishment of Gill-Derived Primary Cell Cultures from Largemouth Bass (Micropterus salmoides) as an Alternative Platform for Studying Host–Virus Interactions

1
State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, School of Marine Sciences, Ningbo University, Ningbo 315211, China
2
Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Ningbo University, Ningbo 315211, China
3
Key Laboratory of Aquaculture Biotechnology of Ministry of Education, Ningbo University, Ningbo 315211, China
*
Authors to whom correspondence should be addressed.
Fishes 2025, 10(1), 18; https://doi.org/10.3390/fishes10010018
Submission received: 26 November 2024 / Revised: 31 December 2024 / Accepted: 31 December 2024 / Published: 2 January 2025
(This article belongs to the Special Issue Advances in Aquatic Diseases and Immunity in Aquaculture)

Abstract

:
A primary cell culture derived from the gill tissues of largemouth bass (Micropterus salmoides) was successfully established and characterized, providing a physiologically relevant model for virological research. Gill tissues were enzymatically dissociated, and their cells were cultured in M199 supplemented with 20% fetal bovine serum at 25 °C, yielding optimal growth. Viral replication within these primary cells was confirmed by transmission electron microscopy, and further qRT-PCR demonstrated the upregulation of antiviral genes (IFN1, Mx1, ISG15, and Viperin). These primary gill cells of spindle-like morphology exhibited significantly higher susceptibility to Micropterus salmoides rhabdovirus (MSRV) compared to established cell lines, as evidenced by higher viral titers, thus establishing their suitability for studying host–virus interactions. Furthermore, these cells were amenable to genetic manipulation, with the successful transfection of an mCherry reporter gene using commercially available reagents. These findings highlight the utility of the largemouth bass gill-derived primary cell culture as an alternative in vitro system for investigating MSRV pathogenesis and host immune responses, which serves as a stepping stone for improved antiviral strategies in largemouth bass aquaculture.
Key Contribution: This study established a robust protocol for isolating and culturing primary gill cells from largemouth bass, serving as a valuable platform for understanding host–virus interactions in a more physiologically relevant context.

1. Introduction

Largemouth bass (Micropterus salmoides) is native to North America and has been introduced into multiple countries as a popular farmed fish species due to its wide temperature tolerance, adaptability to various environments, and robust growth rates [1,2]. With the continuous expansion of the largemouth bass farming industry, an increasing incidence of disease outbreaks has been reported, hindering its sustainable development [3,4]. Among all pathogenic microorganisms, viruses remain a major constraint for largemouth bass aquaculture production due to the lack of effective vaccines and drug treatment [5]. In particular, viral diseases caused by Micropterus salmoides rhabdovirus (MSRV) result in significant economic losses to the farming industry, with a mortality rate of ~40% [6]. Consequently, a range of in vitro models have been developed as primary platforms to understand viral pathogenicity and host–virus interactions [7,8].
Established cell lines have long been used as invaluable models in virology research and serve as surrogates for understanding viral entry and replicating mechanisms [9,10,11]. These cell lines are normally maintained under controlled conditions, and thus offer several advantages, such as ease of maintenance and reproducibility [12,13]. In the context of MSRV research, a range of cell lines derived from the ovary, caudal fin and heart of largemouth bass have been established and utilized for MSRV propagation and researching pathogenicity [9,11,14]. Despite these advantages, cell lines possess inherent limitations. For example, it remains technically challenging to establish permanent cell lines, which may account for the fact that only several cell lines derived from largemouth bass tissues have been reported [9,11,14]. Further, continuous culturing can cause genetic and phenotypic drift, leading to deviations from original tissue characteristics [15,16]. Consequently, this drift can reduce physiological relevance and limit the accuracy of extrapolating data to in vivo conditions.
Contrary to established cell lines, primary cells are directly derived from tissues and retain many of the characteristics and functionalities of their in vivo counterparts. Primary cell cultures derived from fish tissues, such as the skin, kidney, liver and spleen, have been widely used in virology research for understanding host–pathogen interactions. Among these, primary gill cell cultures are of great interest due to the fact that gill tissues are constantly exposed to waterborne pathogens, making them a primary target for many fish viruses [17]. For instance, the infectious salmon anemia virus (ISAV) shows a specific tropism for gill epithelial cells in Atlantic salmon (Salmo salar), leading to severe gill damage and respiratory distress [18]. These studies demonstrated that gill-derived primary cell cultures can provide an accurate representation of the natural infection environment, thereby facilitating the study of host–virus interactions and improving our understanding of fish virology. In the present study, we established a robust protocol for primary cell cultures from gill tissues of largemouth bass, and further characterization of these primary cells was conducted to assess their suitability for virological research, particularly for studying MSRV infections. Our results showed that primary gill cells exhibited a significantly higher susceptibility to MSRV infection compared to established cell lines, as evidenced by increased viral replication and cytopathic effects. Overall, this study represents a significant step forward in developing more physiologically relevant in vitro models for largemouth bass virology research. The establishment of gill-derived primary cell cultures offers a valuable platform for studying viral infections, and could potentially aid in the development of more effective antiviral strategies for largemouth bass aquaculture.

2. Materials and Methods

2.1. Cell Culture and Fish Rearing

Epithelioma papulosum cyprini (EPC) cells were preserved in our laboratory and cultured as previously described (REF). Briefly, cells were grown in medium 199 (M199; HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; SIJIQING, Hangzhou, China), penicillin (100 IU/mL) and streptomycin (100 μg/mL; Gibco, Grand Island, NY, USA) at 25 °C and 5% CO2.
Juvenile largemouth bass (47.46 ± 5.30 mm in length) were purchased from the Yangyang Fishery Breeding Company in Guangdong, China, and all fish were maintained at 28 °C ± 0.5 °C in a flow-through water system. Fish were acclimated to this environment for at least two weeks prior to any experiment. All experiments involving animals were approved by the Ningbo University Institutional Animal Care and Use Committee and were carried out in compliance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals.

2.2. Establishment of Largemouth Bass Gill-Derived Primary Cells

Juvenile fish were transferred to a beaker containing 100 mL of sterilized water supplemented with penicillin (100 IU/mL) and streptomycin (100 μg/mL), and after 24 h, fish gills were aseptically removed and cut into approximately 1 mm3 pieces that were further soaked in 75% ethanol for ~15 s followed by two washes (~30 s for each wash) in sterile PBS containing penicillin (100 IU/mL) and streptomycin (100 μg/mL). Gill pieces (~1 g) were then digested in 1 mL trypsin (Gibco, NY, USA) of indicated concentrations (i.e., 0.125% and 0.25%). After 30 or 60 min digestion on a rotator, 5 mL of M199 (Meilun Bio, Dalian, China) supplemented with 20% FBS and 1% penicillin–streptomycin was added to inactivate trypsin. Cell suspensions were then filtered through a 100-mesh filter (NEST, Wuxi, China) followed by centrifugation at 100× g for 2 min before re-suspension in culturing medium. Cell suspensions were mixed with an equal volume of trypan blue (Sigma Aldrich, St. Louis, MO, USA), and viable cells and cell aggregates were manually counted under an optical microscope (Olympus, Tokyo, Japan).
To optimize culturing conditions, isolated primary gill cells were seeded at a density of ~1 × 104 cells in a 24-well plate and cultured under different conditions. Specifically, to test the optimal culturing medium for the growth of primary gill cells, cells were cultured in M199, L-15 or MEM supplemented with 20% FBS at 25 °C; to examine the effects of FBS concentration, cells were cultured in M199 supplemented with different concentration of FBS (i.e., 10%, 15% and 20%) at 25 °C; to investigate the impact of temperature, cells were cultured in M199 supplemented with 20% FBS at 18 °C, 25 °C and 32 °C. All cells were cultured in the presence of penicillin (100 IU/mL), streptomycin (100 μg/mL) and 5% CO2. Cells were counted every day under an optical microscope until ~100% confluency was reached, and the number of cells was recorded to plot growth kinetics for each condition.

2.3. Viral Infection

Supernatants containing viral particles were originally stored at −80 °C and thawed before viral infection. Specifically, primary gill-derived cells and EPC cells were seeded in 96-well plates at a density of 1 × 105 cells/well and were cultured as aforementioned at 25 °C, with the exception that the FBS concentration in the culturing medium was reduced to 2%. On the day of infection, virus-containing supernatants were serially diluted from 10−1 to 10−12 at a 10-fold interval and 100 μL of diluted supernatants were then added to each well. After 2 h of infection, cells were washed in sterile PBS three times and the culturing medium containing 2% FBS was added. Cells were then monitored every day for cytopathic effects (CPE), and the tissue culture infectious dose 50 (TCID50) value was calculated using the Reed–Muench method [19].

2.4. Transmission Electron Microscopy

To observe the propagation of viral particles, primary cells were infected with MSRV at a dose of 103 TCID50/0.1 mL, as aforementioned. After 24 h of infection, cells were gently scraped off the plate, followed by centrifugation at 200× g for 5 min. A cell pellet was then fixed in 2% glutaraldehyde for 2 h at room temperature, after which cells were post-fixed in 1% osmium tetroxide and then dehydrated in graded concentrations of ethanol for 10 min in each solution. Dehydrated cells were embedded in epoxy resin, and after polymerization, ultrathin sections of 70 nm were cut using ultramicrotome (Leica EM UC7, Leica microsystems, Wetzlar, Germany) and imaged using a transmission electron microscope JEOL 1400 (JEOL Ltd., Tokyo, Japan) at 80 kV.

2.5. qRT-PCR

Largemouth bass gill-derived primary cells and EPC cells were cultured and infected with MSRV as detailed above. Cells were collected at indicated time points and total RNA was extracted using TriQuick Reagent (Solarbio, Beijing, China) and reverse transcribed with HiScript® III All-in-one RT SuperMix Perfect for qPCR (Vazyme, Nanjing, China) as previously described, with minor modifications [20,21,22,23]. Obtained cDNAs were analyzed by RT-qPCR using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) for expressions of selected viral-inducible genes, including interferon 1 (IFN1), interferon-stimulated gene 15 (ISG15), myxovirus resistance 1 (Mx1) and Viperin in MSRV-infected primary cells; further, the relative expression of the MSRV G gene was also examined and compared between primary and EPC cells. qRT-PCR was performed on an ABI QuantStudio 3 real-time PCR System (Applied Biosystems, Foster City, CA, USA). Thermocycling parameters were 95 °C for 30 s, followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C. Relative mRNA expression was calculated using the 2−△△Ct method, and gene expressions were normalized to the endogenous control (i.e., β-actin) and expressed as fold changes relative to the respective control. Primers used in this study are listed in Table 1.

2.6. Cellular Transfection

To investigate transfection efficiency, largemouth bass gill-derived primary cells were seeded in 24-well plates at a density of 2 × 105 cells/well, and on the day of transfection, culturing medium was replaced with opti-MEM (Gibco, NY, USA) and 1 μg of pcDNA3.1-mCherry plasmid was transfected into primary cells using 2 μL of polyethylenimine (50 μg/mL; Polysciences) or Lipofectamine 3000 (Thermo fisher scientific, MD, USA) according to the manufacturers’ instructions. After 24 and 48 h of transfection, cells were collected and fixed in 1% paraformaldehyde (Sigma Aldrich, St. Louis, MO, USA) prior to analysis using flow cytometry (Miltenyi MACSQuant Analyzer 10, Bergisch Gladbach, Germany).

2.7. Statistics

Data are shown as mean ± standard error (SEM) and all statistical analyses were performed on Graphpad Prism 10 (GraphPad software, Boston, MA, USA) using the student’s t test. p values less than 0.05 were considered statistically significant: **, p < 0.01; *, p < 0.05.

3. Results

3.1. Establishment of Largemouth Bass Gill-Derived Primary Cells

To generate single-cell suspensions for subsequent culturing, isolated gill tissues were incubated in dissociation solution (i.e., 0.125% and 0.25% trypsin) for 30 and 60 min. Microscopic analysis revealed a reduction in cell aggregates with increasing trypsin concentrations and extended incubation times (Figure 1A). A further live cell counting assay demonstrated that gill tissues subjected to 0.25% trypsin treatment for 60 min yielded a significantly higher number of viable cells (Figure 1B). Consistently, a significantly lower number of cell aggregates was noted under this condition (Figure 1C).
To further optimize culturing conditions, cell proliferation kinetics were monitored under different conditions. Results showed that the culturing medium selected in our study had a slight impact on cell proliferation, with M199 providing the best support for sustained cell growth over time (Figure 2A). However, isolated primary cells exhibited higher proliferation rates in media supplemented with 20% FBS compared to lower concentrations (Figure 2B). Additionally, cells cultured at 25 °C demonstrated optimal growth, with slower proliferation observed at both lower and higher temperatures (Figure 2C). Subsequently, primary gill cells were cultured in M199 supplemented with 20% FBS at 25 °C. Further light microcopic analysis showed that primary gill cells exhibited spindle morphology and reached ~100% confluency after three days (Figure 2D).

3.2. Largemouth Bass Gill-Derived Primary Cells Are More Susceptible to MSRV Infections

To examine the susceptibility of largemouth bass gill-derived primary cells to MSRV infections, transmission electronic microscopy analysis demonstrated the propagation of viral particles within host cells (Figure 3A). Further qRT-PCR results showed that primary cells were responsive to viral infections and expressions of anti-viral genes, and IFN1, Mx1, Viperin and ISG15 were all significantly up-regulated, with Viperin exhibiting the highest increase of ~582 fold (Figure 3B). We further compared expression levels of viral G genes in MSRV-infected primary cells to those of CPE cells; qRT-PCR analysis showed a significant increase in viral G genes expression at early time points (i.e., 12 and 24 hpi) compared to CPE cells, whereas at 48 hpi, the expression level of viral G genes was not significantly different, even though a slightly higher expression was observed in largemouth bass gill-derived primary cells (Figure 3C). A viral titration assay further confirmed that the TCID50 of largemouth bass gill-derived primary cells was significantly higher than that of EPC cells, indicating a higher susceptibility of the primary cells to MSRV infection (Figure 3D).

3.3. Optimization of Exogenous Transfection in Largemouth Bass Gill-Derived Primary Cells

To investigate the possibility of exogenous gene manipulations, largemouth bass gill-derived primary cells were transfected with mCherry plasmid using polyethylenimine and Lipofectamine 3000. Flow cytometry analysis demonstrated an increase in percentages of mCherry-positive cells with extended transfection times; of the two transfection reagents tested in this study, Lipofectamine 3000 exhibited the highest transfection efficiency compared to polyethylenimine at both time points, with 14.2 ± 0.5% and 27.65 ± 3.95% mCherry-positive cells at 24 and 48 h, respectively (Figure 4).

4. Discussion

Fish gills are constantly exposed to the surrounding aquatic environment, making them a critical interface between the fish and potential pathogens, and therefore an excellent model for studying host–pathogen interactions [24,25,26,27]. In the context of largemouth bass, numerous studies have demonstrated that gills are highly responsive to viral infections, showing a substantial viral load followed by a rapid increase in the expression of immune-related genes [28,29]. To date, gill-derived cell lines were yet to be established in largemouth bass; in the present study, we successfully established a primary cell culture system derived from largemouth bass gill tissues. This represents the first report of the development of a physiologically relevant in vitro model that may serve as a promising surrogate for understanding viral infections in largemouth bass and also provide a valuable tool for screening anti-viral drugs.
Trypsin-based methods are commonly employed techniques in dissociating tissues into single-cell suspensions [30,31]. Various enzyme concentrations and durations of enzyme exposure have been reported in establishing primary cultures and permanent cell lines [32]. Our results indicated that increasing enzyme concentration and extending incubation time reduced cell aggregates, thus increasing the yield of viable single cells. Of note, the number of dead cells also increased at high enzyme concentrations and prolonged incubation time, demonstrating that trypsinization damages cells; thus, digestion conditions could be further optimized for different scenarios. In our study, maximizing the number of viable cells was critical for subsequent culturing, and therefore a high concentration of trypsin and long duration of exposure were optimal in this context.
The successful maintenance of primary cell cultures relies heavily on optimizing culturing conditions. To date, several culturing mediums, specifically MEM, M199 and L-15, have been selected for culturing permanent cell lines derived from the ovary, heart and caudal fin of largemouth bass [9,11,14]. Therefore, we tested these medium for culturing primary gill cells, and our results indicate that the choice of culturing medium has a negligible impact on cell growth, with cells in M199 medium exhibiting slightly higher cell numbers. Consistent with other studies [33], the cell proliferation rate was positively correlated with FBS content, and cell proliferation lagged when cultured at 10 and 15% FBS; in comparison, primary cells reached ~100% confluency after three days when cultured in medium supplemented with 20% FBS. Further, we investigated temperature, and similar to findings that fish cell lines are adapted to a wide range of temperatures [34], primary gill cells were capable of proliferating between 18 to 32 °C, with the optimal temperature being 25 °C.
Cell models are valuable tools in virology research and aid in studying host–virus interactions, virus replication and pathogenic mechanisms [35,36]. To date, a range of cell models derived from largemouth bass and other fish species has been established for MSRV research. Cell models derived from largemouth bass tissues, including heart, skin and caudal fins, have all been validated for MSRV replication [11,14,37]. However, the availability of established cell lines is somewhat restricted. Alternatively, commercially available cell lines from other teleost species, e.g., EPC, are widely employed in MSRV research [38,39]. Likewise, EPC cells have inherent limitations, in that they originates from the fathead minnow (Pimephales promelas), which is less likely a natural host of MSRV [38]. Instead, primary cell cultures overcome the aforementioned drawbacks and present an alternative model system for MSRV research. Indeed, in comparison to EPC cells, a higher viral load, particularly at early time points, was pronounced in largemouth bass gill-derived primary cells following MSRV infection, which was likely due to the fact that primary cells more closely represent the physiological environment of MSRV propagation. Similar observations have been made in Zika, norovirus and respiratory syncytial virus when primary cells were used for in vitro infection [40,41,42].
Exogenous expression is one popular technique for investigating protein functions in cell models. We further investigated the transfection efficiency of largemouth bass gill-derived primary cells using two transfection reagents (i.e., PEI and Lipofectamine 3000). Our results indicated that primary cells were amenable to genetic manipulation using both reagents, with Lipofectamine 3000 exhibiting higher transfection efficiency. Although primary gill cells were demonstrated to be amenable to transfection, one limitation in this study was that observed transfection efficiency was not compared to that of an established fish cell line (e.g., EPC), thus making it less likely to draw the conclusion that primary gill cells are favored in exogenous expression studies. Further, the highest transfection efficiency in this study was ~25%, which was consistent with studies using teleost fish cells, but pronouncedly lower than when using mammalian counterparts [43]. This was likely due to the fact that commonly used plasmid and transfection reagents are tailored to mammalian systems, and therefore might limit applications of primary gill cells in scenarios when a high expression of exogenous proteins is required [44]. Further optimizations, e.g., alternative transfection methods, such as electroporation and viral transduction, are needed to improve transfection efficiency in non-mammalian models.

5. Conclusions

In conclusion, our results provide a valuable primary cell system for virology research in largemouth bass, offering enhanced physiological relevance and susceptibility to viral infections. The successful establishment of gill-derived primary cells, combined with their amenability to gene manipulation, represents an important step forward in aquaculture research, paving the way for more effective antiviral strategies and a deeper understanding of host–virus interactions.

Author Contributions

Conceptualization, C.F. and J.C.; methodology, Z.W.; software, Z.W.; validation, Z.W. and C.F.; formal analysis, Z.W. and L.N.; investigation, Z.W.; resources, J.C.; data curation, Z.W.; writing—original draft preparation, Z.W. and C.F.; writing—review and editing, C.F., L.N. and J.C.; visualization, Z.W. and L.N.; supervision, C.F. and J.C.; project administration, J.C.; funding acquisition, L.N. and J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science and Technology Innovation Yongjiang 2035 Key Research and Development Project of Ningbo, grant number 2024Z279, and the Natural Science Foundation of Zhejiang Province, grant number LY23C190002. The APC was funded by the Science and Technology Innovation Yongjiang 2035 Key Research and Development Project of Ningbo, grant number 2024Z279.

Institutional Review Board Statement

This study was approved by the ethics committee of Ningbo University (approval code: 13728, date: 16 Septmeber 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data supporting findings of this study are available from the corresponding author upon request.

Acknowledgments

We thank Yang Hu at Ningbo University for assisting in viral titration assays and providing critical comments on the preparation of this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Qi, Z.; Xu, Y.; Liu, Y.; Zhang, Q.; Wang, Z.; Mei, J.; Wang, D. Transcriptome analysis of largemouth bass (Micropterus salmoides) challenged with LPS and polyI:C. Fish Shellfish Immunol. 2023, 133, 108534. [Google Scholar] [CrossRef]
  2. Yang, S.; Zhao, J.; An, N.; Li, D.C.; Huang, M.M.; Fei, H. Updates on infectious diseases of largemouth bass: A major review. Fish Shellfish Immunol. 2024, 154, 109976. [Google Scholar] [CrossRef]
  3. Fu, X.; Luo, M.; Zheng, G.; Liang, H.; Liu, L.; Lin, Q.; Niu, Y.; Luo, X.; Li, N. Determination and Characterization of a Novel Birnavirus Associated with Massive Mortality in Largemouth Bass. Microbiol. Spectr. 2022, 10, e0171621. [Google Scholar] [CrossRef]
  4. Jin, Y.; Bergmann, S.M.; Mai, Q.; Yang, Y.; Liu, W.; Sun, D.; Chen, Y.; Yu, Y.; Liu, Y.; Cai, W.; et al. Simultaneous Isolation and Identification of Largemouth Bass Virus and Rhabdovirus from Moribund Largemouth Bass (Micropterus salmoides). Viruses 2022, 14, 1643. [Google Scholar] [CrossRef] [PubMed]
  5. Mugimba, K.K.; Byarugaba, D.K.; Mutoloki, S.; Evensen, Ø.; Munang’andu, H.M. Challenges and Solutions to Viral Diseases of Finfish in Marine Aquaculture. Pathogens 2021, 10, 673. [Google Scholar] [CrossRef] [PubMed]
  6. Ma, D.; Deng, G.; Bai, J.; Li, S.; Yu, L.; Quan, Y.; Yang, X.; Jiang, X.; Zhu, Z.; Ye, X. A strain of Siniperca chuatsi rhabdovirus causes high mortality among cultured Largemouth Bass in South China. J. Aquat. Anim. Health 2013, 25, 197–204. [Google Scholar] [CrossRef] [PubMed]
  7. Fei, H.; Yi, S.F.; Zhang, H.M.; Cheng, Y.; Zhang, Y.Q.; Yu, X.; Qian, S.C.; Huang, M.M.; Yang, S. Transcriptome and 16S rRNA analysis revealed the response of largemouth bass (Micropterus salmoides) to Rhabdovirus infection. Front. Immunol. 2022, 13, 973422. [Google Scholar] [CrossRef]
  8. Luo, S.; Liang, J.; Yang, G.; Lu, J.; Chen, J. The laminin receptor is a receptor for Micropterus salmoides rhabdovirus. J. Virol. 2024, 98, e0069724. [Google Scholar] [CrossRef]
  9. Getchell, R.G.; Groocock, G.H.; Cornwell, E.R.; Schumacher, V.L.; Glasner, L.I.; Baker, B.J.; Frattini, S.A.; Wooster, G.A.; Bowser, P.R. Development and characterization of a largemouth bass cell line. J. Aquat. Anim. Health 2014, 26, 194–201. [Google Scholar] [CrossRef] [PubMed]
  10. Jiao, X.; Lu, Y.T.; Wang, B.; Guo, Z.Y.; Qian, A.D.; Li, Y.H. Infection of epithelioma papulosum cyprini (EPC) cells with spring viremia of carp virus (SVCV) induces autophagy and apoptosis through endoplasmic reticulum stress. Microb. Pathog. 2023, 183, 106293. [Google Scholar] [CrossRef]
  11. Zeng, W.; Dong, H.; Chen, X.; Bergmann, S.M.; Yang, Y.; Wei, X.; Tong, G.; Li, H.; Yu, H.; Chen, Y. Establishment and characterization of a permanent heart cell line from largemouth bass Micropterus salmoides and its application to fish virology and immunology. Aquaculture 2022, 547, 737427. [Google Scholar] [CrossRef]
  12. Dolskiy, A.A.; Grishchenko, I.V.; Yudkin, D.V. Cell Cultures for Virology: Usability, Advantages, and Prospects. Int. J. Mol. Sci. 2020, 21, 7978. [Google Scholar] [CrossRef] [PubMed]
  13. Maqsood, M.I.; Matin, M.M.; Bahrami, A.R.; Ghasroldasht, M.M. Immortality of cell lines: Challenges and advantages of establishment. Cell Biol. Int. 2013, 37, 1038–1045. [Google Scholar] [CrossRef] [PubMed]
  14. Yang, J.; Xu, W.; Wang, W.; Pan, Z.; Qin, Q.; Huang, X.; Huang, Y. Largemouth Bass Virus Infection Induced Non-Apoptotic Cell Death in MsF Cells. Viruses 2022, 14, 1568. [Google Scholar] [CrossRef]
  15. Salybekov, A.A.; Kobayashi, S.; Asahara, T. Characterization of Endothelial Progenitor Cell: Past, Present, and Future. Int. J. Mol. Sci. 2022, 23, 7697. [Google Scholar] [CrossRef] [PubMed]
  16. Yu, L.; Boström, C.; Franzenburg, S.; Bayer, T.; Dagan, T.; Reusch, T.B.H. Somatic genetic drift and multilevel selection in a clonal seagrass. Nat. Ecol. Evol. 2020, 4, 952–962. [Google Scholar] [CrossRef]
  17. Lee, L.E.; Dayeh, V.R.; Schirmer, K.; Bols, N.C. Applications and potential uses of fish gill cell lines: Examples with RTgill-W1. In Vitro Cell. Dev. Biol. Anim. 2009, 45, 127–134. [Google Scholar] [CrossRef] [PubMed]
  18. Weli, S.C.; Aamelfot, M.; Dale, O.B.; Koppang, E.O.; Falk, K. Infectious salmon anaemia virus infection of Atlantic salmon gill epithelial cells. Virol. J. 2013, 10, 5. [Google Scholar] [CrossRef]
  19. Pizzi, M. Sampling variation of the fifty percent end-point, determined by the Reed-Muench (Behrens) method. Hum. Biol. 1950, 22, 151–190. [Google Scholar] [PubMed]
  20. Fu, X.; Guo, M.; Liu, J.; Li, C. circRNA432 enhances the coelomocyte phagocytosis via regulating the miR-2008-ELMO1 axis in Vibrio splendidus-challenged Apostichopus japonicus. Commun. Biol. 2023, 6, 115. [Google Scholar] [CrossRef] [PubMed]
  21. Guo, M.; Li, X.; Tao, W.; Teng, F.; Li, C. Vibrio splendidus infection promotes circRNA-FGL1-regulated coelomocyte apoptosis via competitive binding to Myc with the deubiquitinase OTUB1 in Apostichopus japonicus. PLoS Pathog. 2024, 20, e1012463. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, H.; Qiu, T.X.; Lu, J.F.; Liu, H.W.; Hu, L.; Liu, L.; Chen, J. Potential aquatic environmental risks of trifloxystrobin: Enhancement of virus susceptibility in zebrafish through initiation of autophagy. Zool. Res. 2021, 42, 339–349. [Google Scholar] [CrossRef] [PubMed]
  23. Zhou, Y.; Qiu, T.X.; Hu, Y.; Liu, L.; Chen, J. Antiviral effects of natural small molecules on aquatic rhabdovirus by interfering with early viral replication. Zool. Res. 2022, 43, 966–976. [Google Scholar] [CrossRef] [PubMed]
  24. Matras, M.; Stachnik, M.; Borzym, E.; Maj-Paluch, J.; Reichert, M. Distribution of carp edema virus in organs of infected juvenile common carp. J. Vet. Res. 2023, 67, 333–337. [Google Scholar] [CrossRef]
  25. Novotny, L. Respiratory Tract Disorders in Fishes. Vet. Clin. N. Am. Exot. Anim. Pract. 2021, 24, 267–292. [Google Scholar] [CrossRef] [PubMed]
  26. Scheifler, M.; Magnanou, E.; Sanchez-Brosseau, S.; Desdevises, Y. Host specificity of monogenean ectoparasites on fish skin and gills assessed by a metabarcoding approach. Int. J. Parasitol. 2022, 52, 559–567. [Google Scholar] [CrossRef]
  27. Tartor, H.; Dahle, M.K.; Gulla, S.; Weli, S.C.; Gjessing, M.C. Emergence of Salmon Gill Poxvirus. Viruses 2022, 14, 2701. [Google Scholar] [CrossRef] [PubMed]
  28. Qin, Y.; Zhang, P.; Zhang, M.; Guo, W.; Deng, S.; Liu, H.; Yao, L. Isolation and identification of a new strain Micropterus salmoides rhabdovirus (MSRV) from largemouth bass Micropterus salmoides in China. Aquaculture 2023, 572, 739538. [Google Scholar] [CrossRef]
  29. Yi, S.; Wu, Y.; Gu, X.; Cheng, Y.; Zhang, Z.; Yuan, Z.; Xie, H.; Qian, S.; Huang, M.; Fei, H.; et al. Infection dynamic of Micropterus salmoides rhabdovirus and response analysis of largemouth bass after immersion infection. Fish Shellfish Immunol. 2023, 139, 108922. [Google Scholar] [CrossRef]
  30. Glazer, E.S.; Massey, K.L.; Curley, S.A. A protocol to effectively create single cell suspensions of adherent cells for multiparameter high-throughput flow cytometry. In Vitro Cell. Dev. Biol. Anim. 2010, 46, 97–101. [Google Scholar] [CrossRef]
  31. Lin, C.H.; Kao, Y.C.; Ma, H.; Tsay, R.Y. An investigation on the correlation between the mechanical property change and the alterations in composition and microstructure of a porcine vascular tissue underwent trypsin-based decellularization treatment. J. Mech. Behav. Biomed. Mater. 2018, 86, 199–207. [Google Scholar] [CrossRef]
  32. Pan, W.; Godoy, R.S.; Cook, D.P.; Scott, A.L.; Nurse, C.A.; Jonz, M.G. Single-cell transcriptomic analysis of neuroepithelial cells and other cell types of the gills of zebrafish (Danio rerio) exposed to hypoxia. Sci. Rep. 2022, 12, 10144. [Google Scholar] [CrossRef]
  33. Dharmaratnam, A.; Kumar, R.; Valaparambil, B.S.; Sood, N.; Pradhan, P.K.; Das, S.; Swaminathan, T.R. Establishment and characterization of fantail goldfish fin (FtGF) cell line from goldfish, Carassius auratus for in vitro propagation of Cyprinid herpes virus-2 (CyHV-2). PeerJ 2020, 8, e9373. [Google Scholar] [CrossRef] [PubMed]
  34. Ager-Wick, E.; Hodne, K.; Fontaine, R.; von Krogh, K.; Haug, T.M.; Weltzien, F.A. Preparation of a High-quality Primary Cell Culture from Fish Pituitaries. J. Vis. Exp. 2018, 28, 58159. [Google Scholar] [CrossRef]
  35. Avalos-Soriano, A.; García-Gasca, A.; Yáñez-Rivera, B. The Development and Evaluation of Brain and Heart Cell Lines from a Marine Fish for Use in Xenobiotic-Induced Cytotoxicity Testing. Altern. Lab. Anim. 2021, 49, 147–156. [Google Scholar] [CrossRef]
  36. Li, B.; Zheng, S.; Wang, Y.; Wang, Q.; Li, Y.; Yin, J.; Ren, Y.; Shi, C.; Zhao, Z.; Jiang, Z.; et al. Susceptibilities of ten fish cell lines to infection with Tilapia lake virus. Microb. Pathog. 2022, 166, 105510. [Google Scholar] [CrossRef] [PubMed]
  37. Gao, E.B.; Chen, G. Micropterus salmoides rhabdovirus (MSRV) infection induced apoptosis and activated interferon signaling pathway in largemouth bass skin cells. Fish Shellfish. Immunol. 2018, 76, 161–166. [Google Scholar] [CrossRef]
  38. Zhang, X.; Xue, M.; Liu, L.; Wang, H.; Qiu, T.; Zhou, Y.; Shan, L.; Wang, Z.; Liu, G.; Hu, Y.; et al. Rhein: A potent immunomodulator empowering largemouth bass against MSRV infection. Fish Shellfish Immunol. 2024, 144, 109284. [Google Scholar] [CrossRef] [PubMed]
  39. Wang, H.; Zhang, X.; Wang, Z.; Shan, L.; Zhu, S.; Liu, G.; Liu, L.; Hu, Y.; Chen, J. Palmatine as a potent immunomodulator: Enhancing resistance to Micropterus salmoides rhabdovirus in largemouth bass through innate immune activation and viral suppression. Fish Shellfish Immunol. 2024, 154, 109928. [Google Scholar] [CrossRef]
  40. Broadbent, L.; Villenave, R.; Guo-Parke, H.; Douglas, I.; Shields, M.D.; Power, U.F. In Vitro Modeling of RSV Infection and Cytopathogenesis in Well-Differentiated Human Primary Airway Epithelial Cells (WD-PAECs). Methods Mol. Biol. 2016, 1442, 119–139. [Google Scholar] [CrossRef] [PubMed]
  41. Ettayebi, K.; Crawford, S.E.; Murakami, K.; Broughman, J.R.; Karandikar, U.; Tenge, V.R.; Neill, F.H.; Blutt, S.E.; Zeng, X.L.; Qu, L.; et al. Replication of human noroviruses in stem cell-derived human enteroids. Science 2016, 353, 1387–1393. [Google Scholar] [CrossRef]
  42. Simonin, Y.; Loustalot, F.; Desmetz, C.; Foulongne, V.; Constant, O.; Fournier-Wirth, C.; Leon, F.; Molès, J.P.; Goubaud, A.; Lemaitre, J.M.; et al. Zika Virus Strains Potentially Display Different Infectious Profiles in Human Neural Cells. EBioMedicine 2016, 12, 161–169. [Google Scholar] [CrossRef] [PubMed]
  43. Lee, P.T.; Zou, J.; Holland, J.W.; Martin, S.A.; Collet, B.; Kanellos, T.; Secombes, C.J. Identification and characterisation of TLR18-21 genes in Atlantic salmon (Salmo salar). Fish Shellfish Immunol. 2014, 41, 549–559. [Google Scholar] [CrossRef]
  44. Kim, T.K.; Eberwine, J.H. Mammalian cell transfection: The present and the future. Anal. Bioanal. Chem. 2010, 397, 3173–3178. [Google Scholar] [CrossRef]
Figure 1. Increased trypsin concentration and prolonged exposure duration led to reduced cell aggregates and increased viable cell numbers. (A) Microscopic analysis of largemouth bass gill tissues following trypsin digestion of indicated concentration and time. Cells were stained in 0.4% trypan blue to exclude dead cells, and cell aggregates are indicated by red dotted circles. Cell aggregates and viable cells were counted, and their numbers are summarized in (B,C), respectively. Data are shown as mean ± SEM. *, p < 0.05.
Figure 1. Increased trypsin concentration and prolonged exposure duration led to reduced cell aggregates and increased viable cell numbers. (A) Microscopic analysis of largemouth bass gill tissues following trypsin digestion of indicated concentration and time. Cells were stained in 0.4% trypan blue to exclude dead cells, and cell aggregates are indicated by red dotted circles. Cell aggregates and viable cells were counted, and their numbers are summarized in (B,C), respectively. Data are shown as mean ± SEM. *, p < 0.05.
Fishes 10 00018 g001
Figure 2. Optimization of culturing conditions for largemouth bass primary gill cells. Primary gill cells were cultured under different conditions to assess impacts of culturing medium (A), FBS content (B) and temperature (C) on their growth kinetics. Cells were seeded at a density of 2 × 105 cells in a 6-well plate and designated as day 0, and cell numbers were counted in the following days. Data are shown as mean ± SEM for three independent experiments. (D) Morphology of primary gill cells over the course of culturing period from day 1 to ~100% confluency at day 3.
Figure 2. Optimization of culturing conditions for largemouth bass primary gill cells. Primary gill cells were cultured under different conditions to assess impacts of culturing medium (A), FBS content (B) and temperature (C) on their growth kinetics. Cells were seeded at a density of 2 × 105 cells in a 6-well plate and designated as day 0, and cell numbers were counted in the following days. Data are shown as mean ± SEM for three independent experiments. (D) Morphology of primary gill cells over the course of culturing period from day 1 to ~100% confluency at day 3.
Fishes 10 00018 g002
Figure 3. Largemouth bass gill primary cells were responsive and more susceptible to MSRV infection. (A) Primary gill cells were infected with MSRV at a dose of 103 TCID50, and after 24 h, cells were collected for transmission electronic microscope (A), and qRT-PCR analysis (B) to examine the expression of selected anti-viral genes. Viral particles are boxed in the black rectangle in (A) and further enlarged in the inset. (C) Primary gill cells and EPC cells were infected with MSRV at a dose of 103 TCID50 and supernatants were collected at indicated time points to assess the expression of the MSRV G gene. (D) Primary gill cells were more susceptible to MSRV infection. Primary gill cells and EPC were infected with serially diluted MSRV, cytopathic effects were monitored for up to four days, and viral titers were determined by the Reed–Muench method. Data are shown as mean ± SEM for three independent experiments. p values less than 0.05 were considered statistically significant; *, p < 0.05; **, p < 0.01. ns represents not significant.
Figure 3. Largemouth bass gill primary cells were responsive and more susceptible to MSRV infection. (A) Primary gill cells were infected with MSRV at a dose of 103 TCID50, and after 24 h, cells were collected for transmission electronic microscope (A), and qRT-PCR analysis (B) to examine the expression of selected anti-viral genes. Viral particles are boxed in the black rectangle in (A) and further enlarged in the inset. (C) Primary gill cells and EPC cells were infected with MSRV at a dose of 103 TCID50 and supernatants were collected at indicated time points to assess the expression of the MSRV G gene. (D) Primary gill cells were more susceptible to MSRV infection. Primary gill cells and EPC were infected with serially diluted MSRV, cytopathic effects were monitored for up to four days, and viral titers were determined by the Reed–Muench method. Data are shown as mean ± SEM for three independent experiments. p values less than 0.05 were considered statistically significant; *, p < 0.05; **, p < 0.01. ns represents not significant.
Fishes 10 00018 g003
Figure 4. Primary gill cells were amenable to genetic manipulation. Primary cells were transfected with mCherry-containing plasmid using PEI (blue histogram) and Lipofectamine 3000 (yellow histogram). Cells were collected after 24 h and 48 h transfection and immediately subjected to flow cytometry analysis. mCherry-positive cells were gated based on the mock transfection group (i.e., red histogram) and the percentage of positive cells was averaged from two independent experiments.
Figure 4. Primary gill cells were amenable to genetic manipulation. Primary cells were transfected with mCherry-containing plasmid using PEI (blue histogram) and Lipofectamine 3000 (yellow histogram). Cells were collected after 24 h and 48 h transfection and immediately subjected to flow cytometry analysis. mCherry-positive cells were gated based on the mock transfection group (i.e., red histogram) and the percentage of positive cells was averaged from two independent experiments.
Fishes 10 00018 g004
Table 1. Sequences of primer pairs used in the present study.
Table 1. Sequences of primer pairs used in the present study.
Gene NameForward (5′-3′)Reverse (5′-3′)
β-actinGCTATGTGGCTCTTGACTTCGACCGTCAGGCAGCTCATAGCT
MSRV-GAAGAGCCCGAGAGAAAAATTGAATAGCGGTCCATCAAC
IFN1ATGAAAACTCAAATGTGGACGTAGATAGTTTCCACCCATTTCCTTAA
ISG15GCCTGGTATCACAGACAGACATCTTGCACTGACATA
Mx1ATCTGGTGGATAAGGGAACCATCCTCTGTTAATGTGGC
ViperinGCAAAGCGAGGGTTACGACCTGCCATTACTAACGATGCTGAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Nie, L.; Fei, C.; Chen, J. Establishment of Gill-Derived Primary Cell Cultures from Largemouth Bass (Micropterus salmoides) as an Alternative Platform for Studying Host–Virus Interactions. Fishes 2025, 10, 18. https://doi.org/10.3390/fishes10010018

AMA Style

Wang Z, Nie L, Fei C, Chen J. Establishment of Gill-Derived Primary Cell Cultures from Largemouth Bass (Micropterus salmoides) as an Alternative Platform for Studying Host–Virus Interactions. Fishes. 2025; 10(1):18. https://doi.org/10.3390/fishes10010018

Chicago/Turabian Style

Wang, Ziwen, Li Nie, Chenjie Fei, and Jiong Chen. 2025. "Establishment of Gill-Derived Primary Cell Cultures from Largemouth Bass (Micropterus salmoides) as an Alternative Platform for Studying Host–Virus Interactions" Fishes 10, no. 1: 18. https://doi.org/10.3390/fishes10010018

APA Style

Wang, Z., Nie, L., Fei, C., & Chen, J. (2025). Establishment of Gill-Derived Primary Cell Cultures from Largemouth Bass (Micropterus salmoides) as an Alternative Platform for Studying Host–Virus Interactions. Fishes, 10(1), 18. https://doi.org/10.3390/fishes10010018

Article Metrics

Back to TopTop