Next Article in Journal
Effects of Three Microalgal Diets Varying in LC-PUFA Composition on Growth, Fad, and Elovl Expressions, and Fatty Acid Profiles in Juvenile Razor Clam Sinonovacula constricta
Next Article in Special Issue
The Eel Ascending: The Influence of Lateral Slope, Climbing Substrate and Flow Rate on Eel Pass Performance
Previous Article in Journal
In Silico Chromosome Mapping of the Male-Specific/Linked Loci in the Jade Perch (Scortum barcoo) Suggests Chromosome 19 as the Putative Y Sex Chromosome
Previous Article in Special Issue
Estuarine-Specific Migration of Glass Eels in the Ems Estuary
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 10
10.3390/fishes8100483
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detecting Japanese Eels (Anguilla japonica) and Revealing Their Distribution in Taiwanese Rivers by Environmental DNA Analysis

by
Hsiang-Yi Hsu
†,
Kai-Jen Wu
† and
Yu-San Han
*
Institute of Fisheries Science, College of Life Science, National Taiwan University, 1, Sec. 4, Roosevelt Rd., Taipei 10617, Taiwan
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2023, 8(10), 483; https://doi.org/10.3390/fishes8100483
Submission received: 13 September 2023 / Revised: 26 September 2023 / Accepted: 26 September 2023 / Published: 27 September 2023
(This article belongs to the Special Issue Biology and Ecology of Eels)
Browse Figures
Versions Notes

Abstract

:
The Japanese eel (Anguilla japonica) is the most prevalent freshwater eel species in Taiwan. However, its population has undergone a significant decline in recent decades due to factors such as overfishing, habitat destruction, and the effects of climate change. Urgent action is needed to conserve this species. Before implementing conservation measures, it is imperative to ascertain the distribution of Japanese eels in Taiwan’s rivers. This study’s primary objective was to assess the effectiveness of eDNA analysis as a method for detecting Japanese eels. To achieve this goal, we compared eDNA analysis data with results obtained from electrofishing, with the Fengshan and Shimen Rivers serving as our designated test sites. Additionally, we collected water samples from 34 other rivers across Taiwan to comprehensively assess the species’ wider distribution using eDNA analysis. Our findings demonstrated eDNA analysis’s viability for detecting Japanese eels. Of the 36 rivers tested, Japanese eel DNA was detected in samples from 21 rivers, scattered across northern, eastern, southern, and western Taiwan, with no specific concentration in any region. We also noted reduced detectability of Japanese eel DNA in highly polluted rivers, indicating that river pollution may have a potential impact on their population. In the future, expanding eDNA analysis to more rivers could identify additional rivers that Japanese eels inhabit. Subsequently, resource management and conservation efforts can be focused on these identified habitats. Furthermore, developing advanced eDNA-based methods for estimating the abundance or biomass of Japanese eels could enhance the flexibility of management and conservation measures.
Keywords:
conservation; distribution; eDNA analysis; electrofishing; pollution
Key Contribution: Our findings confirm the effectiveness of eDNA analysis in detecting Japanese eels in Taiwan. Japanese eel DNA was found in samples from 21 of 36 tested rivers, spread across different regions but with reduced detectability in highly polluted rivers, suggesting a possible impact of pollution on their population.

Graphical Abstract

1. Introduction

Freshwater eels, belonging to the genus Anguilla, exhibit a catadromous life cycle: growing in freshwater rivers and estuaries but spawning in the open ocean [1,2,3,4]. This complex life cycle encompasses five principal stages: leptocephalus, glass eel, elver, yellow eel, and silver eel [1,5]. While the leptocephalus and glass eel stages primarily inhabit oceans, the elver, yellow eel, and silver eel stages are mainly found in estuaries and freshwater environments. There are a total of 19 recognized species and subspecies within the freshwater eel genus [6,7,8].
Among these species, Anguilla japonica, commonly known as the Japanese eel, is prevalent in East Asia, encompassing Japan, Taiwan, China, South Korea, and North Korea. It also represents a relatively abundant freshwater eel species in Taiwan [9,10,11]. The recruitment of Japanese glass eels in Taiwan occurs during the winter months, spanning from October to February [5,9]. However, Japanese eel populations have undergone a drastic decline of more than 90% in recent decades, attributed to overfishing, habitat degradation, and the global impact of climate change [12,13]. River pollution is also believed to negatively affect freshwater eels [14,15]. Consequently, the International Union for Conservation of Nature included the Japanese eel on the Red List of Threatened Species in 2014 as an endangered species [16,17]. Urgent measures are now required to manage and conserve Japanese eel resources.
Investigating the distribution and habitat utilization of endangered or rare species is crucial for their resource management and conservation efforts [18]. Traditional capture-based methods, such as electrofishing, traps, and nets, have been employed to assess fish distribution [19,20], but these methods are labor-intensive and time-consuming. Moreover, the data collected through these means can often be sporadic and unevenly distributed [16].
Recently, environmental DNA (eDNA) extracted from soil or water has emerged as a valuable tool for detecting endangered fish species without the need for direct capture and for assessing biodiversity in specific aquatic environments [21,22,23,24,25,26,27,28]. All fish release DNA into their surrounding environment through slime, scales, epidermal cells, and feces. Compared to capture-based methods, eDNA analysis offers an efficient and non-invasive approach for tracing fish species in aquatic ecosystems [26,29,30].
Freshwater eels exhibit conspicuous hiding behaviors during the daytime [31] and migrate between saline and freshwater habitats during their growth stages [32,33,34], making them challenging to find using traditional capture-based methods. Consequently, eDNA analysis holds promise as a potential method for detecting freshwater eels in rivers [35,36,37]. In the past, there has been a lack of comprehensive national-scale surveys of the distribution of Japanese eels in Taiwan’s rivers. Furthermore, there has been limited investigation into the precise impact of river pollution on Japanese eel distributions and populations.
In this study, we collected water samples from designated study sites along the Fengshan and Shimen Rivers for eDNA analysis. Subsequently, electrofishing was conducted at these sites to find Japanese eels. To gauge the effectiveness of eDNA analysis, we compared the data obtained from eDNA analysis with those from electrofishing. Additionally, we extended our water sampling efforts to encompass an additional 34 rivers across Taiwan, enabling us to provide an overall assessment of Japanese eel distributions and to better understand the influence of river pollution.

2. Materials and Methods

2.1. Study Area

According to previous studies, the sizes of the Fengshan and Shimen Rivers were found to be suitable for electrofishing [35,36]. Therefore, we initially selected these two rivers to conduct eDNA analysis and electrofishing to assess the effectiveness of eDNA analysis in detecting Japanese eels. In each river, a total of four study sites were selected, spanning from the lower reaches to the upper reaches (Figure 1). The specific coordinates of the study sites are listed in Tables S1 and S2. Water sampling and electrofishing were conducted at all study sites in the Fengshan and Shimen Rivers on sunny days. Because rainy weather prevents electrofishing and can dampen both equipment and survey personnel, increasing the risk of electric shock, we prefer clear and sunny days for our surveys in Taiwan. Rainfall can also raise river water levels, dilute eDNA concentrations, increase water turbidity, and complicate water sample filtration, adding complexity to our eDNA analysis. At each study site, water sampling and electrofishing were carried out simultaneously and repeated at three different time points between December 2021 and February 2022. Consequently, a total of 24 surveys, encompassing both water sampling and electrofishing, were carried out in the course of this research.
Furthermore, water samples were collected from an additional 34 rivers in Taiwan to perform eDNA analysis to detect Japanese eels. In each river, water samples were collected from a single site, all of which were located in the lower reaches of the rivers, offering a greater likelihood of detecting Japanese eel DNA. The precise coordinates of these sites can be found in Table S3. The fieldwork in these rivers, including water sampling and electrofishing, was approved by the Fisheries Agency of the Council of Agriculture, Executive Yuan, Taiwan (approval code: FA-1101254481, granted on 12 April 2021), in accordance with the objectives of scientific research.

2.2. Water Sampling and eDNA Extraction

The water sampling methodology in this study was adapted from a previous study [36]. In the Fengshan and Shimen Rivers, sampling was carried out at the downstream end of all study sites due to the electrofishing. In 34 other rivers, sampling was conducted at accessible locations in the lower reaches. A total of two replicates, each consisting of 1 L of water, were collected at the center of the river by submerging a Kartell PP bottle (Kartell, Noviglio, MI, Italy) to a depth of approximately 10 cm.
Upon collection, each water sample was immediately field filtered using a 47-mm mixed cellulose ester membrane filter (pore size: 0.8 μm; ADVANTEC®, Toyo Roshi Kaisha, Ltd., Tokyo, Japan) with a filtering device, encompassing a water filter funnel (MF 47 mm, 500 mL Magnetic Filter Funnel, Rocker Scientific, Kaohsiung, Taiwan) and a dry vacuum pump (Welch™ U2511C-02 Dry Vacuum Pump, Welch Allyn, New York, NY, USA). Following filtration, the membrane filter was placed into a 2-mL Eppendorf tube containing 600 μL of Longmire’s solution to prevent eDNA degradation [38]. The Eppendorf tube, containing the membrane in Longmire’s solution, was then stored at room temperature for two days to facilitate the dissolution of eDNA into Longmire’s solution for subsequent eDNA extraction. To maintain aseptic conditions, the used bottles, filter funnels, and measuring cups were decontaminated using 0.1% sodium hypochlorite and were rinsed twice with double distilled water before their next use. Additionally, 1 L of double distilled water was vacuum-filtered through a membrane filter to serve as a negative control.
Total eDNA was extracted from each 2-mL Eppendorf tube containing the filter membrane and Longmire’s solution using the EasyPure Genomic DNA Spin kit (Bioman, Taipei, Taiwan), following the manufacturer’s instructions. The purified eDNA was stored at −20 °C until the real-time PCR analysis was conducted.

2.3. Electrofishing

Electrofishing was conducted for a duration of 1 to 1.5 h at each study site along the Fengshan and Shimen Rivers during each investigation. A battery-powered electroshocker, carried in a backpack, was utilized for electrofishing, inducing temporary incapacitation in eels. The electrofishing procedure at each study site followed a zigzag survey pattern within a 200 m-long section, per established protocols.
Skin coloration (marbled and plain) and fin difference ratio (dorsal and anal fins) can assist in distinguishing Japanese eels from other eel species in Taiwan [1,39,40]. The Japanese eel belongs to the plain eels, and its fin difference ratio is approximately 9. Moreover, the growth stages of the captured Japanese eels were determined based on morphometric characteristics, as outlined in previous studies [41,42]. Subsequently, the captured Japanese eels were released back into the same locations where they were initially caught.

2.4. Real-Time PCR

All the eDNA samples, including those extracted from river water samples and the negative controls, underwent real-time PCR analysis targeting the mitochondrial cytochrome b (cytb) gene, with three replicates conducted on a Bio-Rad MyIQ system (Bio-Rad, Hercules, CA, USA). The Japanese eel’s cytb gene was amplified using a species-specific primer pair (Table 1). The primer design process involved selecting a nucleotide variation interval that exhibited relatively higher divergence and determining the sequences of the primer pair using the Primer-BLAST tool on NCBI. The highly variable nucleotide interval was identified through a comparative analysis of cytb sequences from four distinct Anguillid eel species available in Genbank: A. japonica (Accession Number: AB021772.1), A. bicolor pacifica (Accession Number: AB021774.1), A. marmorata (Accession Number: AB021778.1), and A. luzonensis (Accession Number: FJ170073.1) (Figure S1). Utilizing the highly variable nucleotide interval as a reference, we determined the sequences of the primer pairs using the Primer-BLAST tool. Parameters were set as follows: primer melting temperature ranged from 57 to 63 °C, and the desired PCR product size fell within the range of 50 to 200 base pairs. In addition, we conducted PCR (polymerase chain reaction) experiments by mixing the Japanese eel-specific primer pair with DNA from other eel species, including A. bicolor pacifica, A. marmorata, and A. luzonensis. Through gel electrophoresis results, it was confirmed that the Japanese eel-specific primer pair did not exhibit cross-reactivity with the DNA from these eel species, namely A. bicolor pacifica, A. marmorata, and A. luzonensis (Figure S2). Furthermore, we validated the sequence of PCR products derived from the combination of the Japanese eel-specific primer pair and Japanese eel DNA through Sanger sequencing.
Each real-time PCR reaction was carried out in a 20-μL mixture, which included 10 μL of 2x SYBR green supermix (Bionova, Fremont, CA, USA), 0.5 μL each of the forward and reverse primers (resulting in a final concentration of 250 nM each), 2 μL of the eDNA sample, and 7 μL of double distilled water. The real-time PCR conditions consisted of the following steps: (1) pre-incubation at 95 °C for 3 min; and (2) amplification (40 cycles) at 95 °C for 30 s and 60 °C for 30 s.
All the real-time PCR data from the eDNA samples were reported as the mean Cq (quantification cycle) values ± standard deviations [43], calculated based on the Cq values obtained from six real-time PCR replicates across two sample replicates. It is important to note that the negative control did not yield a detectable Cq value.

2.5. River Pollution Index (RPI) in Taiwan

A comprehensive measure, known as the River Pollution Index (RPI), serves as an indicator of river water quality in Taiwan. The methodology for calculating the RPI and the corresponding RPI values for rivers in Taiwan are sourced from the website of the Environmental Protection Agency, Taiwan Executive Yuan (https://wq.epa.gov.tw/EWQP/zh/EnvWaterMonitoring/River.aspx, accessed on 25 September 2022). The RPI is determined based on four key parameters: dissolved oxygen (DO), biochemical oxygen demand (BOD), suspended solids (SS), and ammonia nitrogen (NH3-N). These parameters collectively assess the level of pollution in river water (see Table S4). The formula for calculating the RPI is as follows:
River   Pollution   Index   RPI = 1 4 ∑ i = 1 4 S i
where Si represents the pollution score for each water parameter i, with scores ranging from 1 to 10. The degree of water pollution is categorized into four levels: non/mildly polluted (score range: S ≤ 2.0), lightly polluted (score range: 2.0 < S ≤ 3.0), moderately polluted (score range: 3.1 ≤ S ≤ 6.0), and severely polluted (score range: S > 6.0).

2.6. Data Analysis

To evaluate the efficacy of eDNA analysis in detecting Japanese eels in the Fengshan and Shimen Rivers, the occupied percentage of surveys in which Japanese eels were captured or not captured by electrofishing, within the surveys showing positive or negative Japanese eel eDNA detection, was calculated and visually represented using pie charts. Additionally, binary logistic regression analysis was employed to determine whether positive or negative Japanese eel eDNA detection (independent variable; x-axis) could predict the capture or non-capture of Japanese eels (dependent variable; y-axis) at the study sites. Furthermore, binary logistic regression analysis was also employed to investigate whether the River Pollution Index (RPI) values of the study sites across 21 rivers (independent variable; x-axis) could predict positive or negative Japanese eel eDNA detection (dependent variable; y-axis). The binary logistic regression analyses were conducted using SPSS statistical software (version 27).

3. Results

3.1. eDNA Analysis and Electrofishing at Fengshan and Shimen Rivers Study Sites

OF all 24 surveys, Japanese eel eDNA was detected in 11 of these surveys, while it was not detected in the remaining 13 surveys (Table 2). Remarkably, in the 11 surveys in which Japanese eel eDNA was detected, Japanese eels were successfully captured in 10 of them, representing a capture proportion of 90.9% (Figure 2A). Conversely, in the 13 surveys where Japanese eel eDNA was not detected, no Japanese eels were captured (Figure 2B). The binary logistic regression analysis affirmed a significant correlation between the presence or absence of Japanese eel eDNA detection and the capture or non-capture of Japanese eels (p < 0.001; Exp (B) = 1.615 × 1010; 95% confidence interval for Exp (B): upper = no value, lower = 0). The Exp (B) value of 1.615 × 1010 indicates that the probability of capturing Japanese eels at a site with positive eDNA detection is 1.615 × 1010 times that at a site with negative eDNA detection.
Among the eight study sites in the Fengshan and Shimen Rivers, Japanese eel eDNA was detected at four study sites, namely FS1, FS3, SM1, and SM2, where Japanese eels were also successfully captured. These four study sites are primarily situated in the lower and middle reaches, suggesting a preference for Japanese eels to inhabit these areas within the Fengshan and Shimen Rivers. Specifically, 15 Japanese eels were captured in the Fengshan River and 37 Japanese eels in the Shimen River (Table 2), all of which were in the yellow eel stage.

3.2. Survey of Japanese Eel Distribution across Taiwan’s Rivers

To assess the distribution of Japanese eels across Taiwan’s rivers, water samples were collected from the lower reaches of 34 rivers for eDNA analysis. Among these 34 rivers, Japanese eel eDNA was detected in 19 of them (Figure 3). This discovery indicates that Japanese eels are distributed widely across Taiwan, spanning the northern, eastern, western, and southern regions. Detailed information regarding the detected Cq values of Japanese eel eDNA in each river can be found in Table 3.

3.3. RPI and Cq Values for Taiwan’s Lower Reaches of Thirty-Six Study Rivers

The RPI values for the lower reaches of the study river basins were sourced from the website of the Environmental Protection Agency, Taiwan Executive Yuan. Among the 36 study rivers, RPI values were available for 21 of them (Table 3). These 21 river basins were categorized into four levels of water pollution based on their pollution point: non/mildly polluted (nine river basins), lightly polluted (three river basins), moderately polluted (seven river basins), and severely polluted (two river basins).
Within the nine non/mildly polluted rivers, Japanese eel eDNA was detected in seven of them. In the three lightly polluted rivers, Japanese eel eDNA was detected in all cases. Among the seven moderately polluted rivers, Japanese eel eDNA was detected in three. However, in the two severely polluted rivers, Japanese eel eDNA was not detected in either of them. Binary logistic regression analysis revealed a significant correlation between the RPI values of the study sites and the presence or absence of Japanese eel eDNA detection at those sites (p < 0.05; Exp (B) = 0.539; 95% confidence interval for Exp (B): upper = 0.990, lower = 0.294). The Exp (B) value of 0.539 indicates that, for every one-unit increase in RPI, the probability of detecting Japanese eel eDNA as positive was 0.539 times that of detecting it as negative.

4. Discussion

Environmental DNA (eDNA) analysis is a non-invasive method widely utilized for tracing aquatic species, and its effectiveness has been substantiated in numerous studies [24,36,37,44,45,46]. However, the accuracy and detection probability of eDNA analysis can be influenced, and conducting multiple sample repeats can enhance its effectiveness [47]. Additionally, the precision of eDNA analysis may be susceptible to false negatives or false positives, typically arising during sample collection [48]. Nevertheless, our eDNA survey results in the Fengshan and Shimen Rivers appear to be free from false negatives or positives. Among our surveys, Japanese eel eDNA was detected in only one instance, specifically at SM2, without any accompanying captures of Japanese eels. This occurrence can likely be attributed to the low population density of Japanese eels, their migratory behavior, their tendency to hide, or their reduced activity during daytime, diminishing the likelihood of their detection via electrofishing [49]. Consequently, this fact could explain why Japanese eel eDNA was detected in only one survey at SM2, but no captures were made. Based on our survey findings in the Fengshan and Shimen Rivers, eDNA analysis may exhibit superior sensitivity in detecting the presence and distribution of Japanese eels compared to capture-based methods. This finding suggests that eDNA analysis could potentially offer a more reliable means of assessment.
Following our field survey of the Fengshan and Shimen Rivers, it became evident that Japanese eels exhibit a preference for inhabiting the lower and middle reaches of these rivers. This finding aligns with numerous studies that have reported a decrease in the abundance of Japanese eels with increasing distance from the river mouth [10,36,50,51]. Furthermore, several studies have indicated a habitat partition between Japanese eels and giant-mottled eels (Anguilla marmorata) within river basins, with the latter primarily occupying the middle and upper reaches [10,36]. Subsequently, this habitat partition can be substantiated through eDNA analysis, and understanding the habitat distribution of Japanese and giant-mottled eels holds significant implications for their conservation efforts.
Evaluating the abundance of eels in rivers is a critical aspect of eel resource conservation. If eDNA analysis proves capable of estimating eel abundance in rivers, it could offer a highly convenient and practical approach for assessing eel resources. Several prior studies have indicated a significant, positive correlation between eDNA concentrations and the abundance of anguillid eels in rivers [35,36]. Additionally, some research has revealed a positive association between eDNA concentration and fish biomass in experimental ponds [52,53]. However, it is important to note that eDNA concentrations in river water can be influenced by numerous factors, including fish species shedding rates, population size, population structure, water temperature, food availability, water velocity, and chemical constituents [54]. The inherent complexities of these variables pose challenges in quantitatively assessing fish species abundance using the current eDNA analytical framework. Therefore, it should be acknowledged that eDNA analysis may not entirely replace the need for catch per unit effort (CPUE) data [55]. In our forthcoming research, we will continue to investigate whether eel eDNA concentration in rivers accurately reflects eel abundance or biomass in those rivers. We aim to develop a method for estimating eel resources in freshwater habitats.
Numerous studies have consistently reported a greater abundance of eels in the lower reaches of river basins [36,56,57,58]. Additionally, it has been observed that higher salinity levels, increased ionic content, a stable pH, and temperature conditions can enhance the preservation of eDNA [59]. This finding aligns with our findings from the Fengshan and Shimen Rivers survey, which demonstrated a greater likelihood of detecting Japanese eel eDNA in the lower reaches. Consequently, for the nationwide eDNA analysis, we collected water samples exclusively from the lower reaches of 34 river basins. The results of our national survey revealed that Japanese eel eDNA was not uniformly detected in all rivers, but it was present in rivers spanning the north, east, south, and west regions of Taiwan. In our previous research, we explored the transport and distribution mechanisms of Japanese glass eels through ocean currents [9,60]. The outcomes of these studies indicated that Japanese glass eels have the potential to disperse throughout the entirety of Taiwan.
Water pollution in rivers can significantly impact the survival and abundance of aquatic organisms, including anguillid eels [14,56,61]. In the present investigation, we employed the River Pollution Index (RPI) as the metric for assessing the pollution levels of the rivers. However, among the 36 study rivers, only 21 provided measurable RPI values, categorizing them as non/mildly polluted (nine rivers), lightly polluted (three rivers), moderately polluted (seven rivers), and severely polluted (two rivers). The results of binary logistic regression indicated that Japanese eel eDNA was less detectable in more polluted rivers. This phenomenon may be attributed to the smaller population sizes of Japanese eels in highly polluted rivers. Furthermore, previous research has suggested that pollutants can negatively influence eDNA analysis [26,27,62]. Organic substances in the water can inhibit the qPCR reaction, and these substances may indirectly lower the water’s pH, accelerating the degradation of eDNA [63]. Consequently, the probability of detecting Japanese eel eDNA in polluted water may be significantly reduced. It is worth noting that Taiwan still has many rivers that are severely impacted by industrialization and pollution. Therefore, further studies are necessary to comprehensively examine the effects of water pollution on Japanese eel resources and eDNA detection.

5. Conclusions

The findings from the surveys conducted in the Fengshan and Shimen Rivers indicate that eDNA analysis is a viable method for detecting Japanese eels. Notably, this study marks the inaugural nationwide investigation into the distribution of Japanese eels in Taiwan’s rivers utilizing eDNA analysis. The eDNA analysis outcomes unveiled a potential presence of Japanese eels across the river basins spanning the entirety of Taiwan. However, Japanese eel eDNA was less discernible in severely polluted rivers, hinting at potential correlations between water pollution and both the population sizes of Japanese eels and the detectability of their eDNA. In the broader context of East Asia, the management and conservation of Japanese eel resources hold paramount and urgent significance. Developing effective methods to detect Japanese eels and accurately assess their abundance or biomass show great potential in supporting the sustainable management and conservation efforts for this species.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes8100483/s1, Figure S1: Comparison of cytb sequences among four different Anguillid eel species found in Taiwan and the location of Anguilla japonica-specific primers for real-time PCR of cytb; Figure S2: Gel electrophoresis following polymerase chain reaction (PCR) with the A. japonica-specific cytb primer pair; Table S1: Detail coordinates of the study sites at Fengshan River; Table S2: Detail coordinates of the study sites at Shimen River; Table S3: Detail coordinates of the water sampling sites of 34 river basins in a national scale survey; Table S4: Calculation and comparison benchmark of River Pollution Index.

Author Contributions

Conceptualization, Y.-S.H.; data curation, K.-J.W.; formal analysis, H.-Y.H. and K.-J.W.; funding acquisition, Y.-S.H.; investigation, H.-Y.H. and K.-J.W.; methodology, H.-Y.H. and K.-J.W.; project administration, Y.-S.H.; supervision, Y.-S.H.; validation, H.-Y.H.; writing—original draft, H.-Y.H.; writing—review and editing, H.-Y.H., K.-J.W. and Y.-S.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science and Technology Council, Executive Yuan, Taiwan (MOST 109-2313-B-002-001-MY2 and MOST 111-2313-B-002-016-MY3).

Institutional Review Board Statement

The fieldwork in rivers, including water sampling and electrofishing, was approved by the Fisheries Agency of the Council of Agriculture, Executive Yuan, Taiwan (approval code: FA-1101254481, granted on 12 April 2021), in accordance with the objectives of scientific research.

Data Availability Statement

All the data are provided within this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Tesch, F.W. The Eel; Blackwell Science: Oxford, UK, 2003. [Google Scholar]
  2. Aoyama, J.; Wouthuyzen, S.; Miller, M.J.; Sugeha, H.Y.; Kuroki, M.; Watanabe, S.; Syahailatua, A.; Tantu, F.Y.; Hagihara, S.; Triyanto; et al. Reproductive Ecology and Biodiversity of Freshwater Eels around Sulawesi Island Indonesia. Zool. Stud. 2018, 57, e30. [Google Scholar] [PubMed]
  3. Chen, S.C.; Chang, C.R.; Han, Y.S. Seaward Migration Routes of Indigenous Eels, Anguilla japonica, A. marmorata, and A. bicolor pacifica, via Satellite Tags. Zool. Stud. 2018, 57, e21. [Google Scholar]
  4. Higuchi, T.; Watanabe, S.; Manabe, R.; Kaku, T.; Okamura, A.; Yamada, Y.; Miller, M.J.; Tsukamoto, K. Tracking Anguilla japonica Silver Eels Along the West Marina Ridge Using Pop-up Archival Transmitting Tags. Zool. Stud. 2018, 57, e24. [Google Scholar]
  5. Han, Y.S.; Wu, C.R.; Iizuka, Y. Batch-like Arrival Waves of Glass Eels of Anguilla japonica in Offshore Waters of Taiwan. Zool. Stud. 2016, 55, e36. [Google Scholar] [PubMed]
  6. Arai, T. Taxonomy and Distribution. In Biology and Ecology of Anguillid Eels; Arai, T., Ed.; CRC Press: Boca Raton, FL, USA, 2016; pp. 1–20. [Google Scholar]
  7. Kaifu, K.; Stein, F.; Dekker, W.; Walker, N.; Dolloff, C.A.; Steele, K.; Aguirre, A.A.; Nijman, V.; Siriwat, P.; Sasal, P. Global exploitation of freshwater eels (genus Anguilla): Fisheries, stock status and illegal trade. In Proceedings of the First International Eel Science Symposium, Zoological Society of London, London, UK, 13–15 June 2017; 5m Books Ltd.: Essex, UK, 2017; pp. 377–422. [Google Scholar]
  8. Watanabe, S.; Aoyama, J.; Tsukamoto, K. A new species of freshwater eel Anguilla luzonensis (Teleostei: Anguillidae) from Luzon Island of the Philippines. Fish. Sci. 2009, 75, 387–392. [Google Scholar] [CrossRef]
  9. Han, Y.S.; Yambot, A.V.; Zhang, H.; Hung, C.L. Sympatric Spawning but Allopatric Distribution of Anguilla japonica and Anguilla marmorata: Temperature- and Oceanic Current-Dependent Sieving. PLoS ONE 2012, 7, e37484. [Google Scholar] [CrossRef]
  10. Hsu, H.Y.; Chen, H.W.; Han, Y.S. Habitat Partitioning and its Possible Genetic Background Between Two Sympatrically Distributed Eel Species in Taiwan. Zool. Stud. 2019, 58, e27. [Google Scholar] [PubMed]
  11. Shiao, J.C.; Iizuka, Y.; Chang, C.W.; Tzeng, W.N. Disparities in habitat use and migratory behavior between tropical eel Anguilla marmorata and temperate eel A. japonica in four Taiwanese rivers. Mar. Ecol. Prog. Ser. 2003, 261, 233–242. [Google Scholar] [CrossRef]
  12. Chen, J.Z.; Huang, S.L.; Han, Y.S. Impact of long-term habitat loss on the Japanese eel Anguilla japonica. Estuar. Coast. Shelf Sci. 2014, 151, 361–369. [Google Scholar] [CrossRef]
  13. Tsukamoto, K.; Aoyama, J.; Miller, M.J. Present status of the Japanese eel: Resources and recent research. Am. Fish. Soc. Symp. 2009, 58, 21–35. [Google Scholar]
  14. Yamaguchi, N.; Gazzard, D.; Scholey, G.; Macdonald, D.W. Concentrations and hazard assessment of PCBs, organochlorine pesticides and mercury in fish species from the Upper Thames: River pollution and its potential effects on top predators. Chemosphere 2003, 50, 265–273. [Google Scholar] [CrossRef]
  15. Agradi, E.; Baga, R.; Cillo, F.; Ceradini, S.; Heltai, D. Environmental contaminants and biochemical response in eel exposed to Po river water. Chemosphere 2000, 41, 1555–1562. [Google Scholar] [CrossRef]
  16. Jacoby, D.M.P.; Casselman, J.M.; Crook, V.; DeLucia, M.B.; Ahn, H.; Kaifu, K.; Kurwie, T.; Sasal, P.; Silfvergrip, A.M.C.; Smith, K.G.; et al. Synergistic patterns of threat and the challenges facing global anguillid eel conservation. Glob. Ecol. Conserv. 2015, 4, 321–333. [Google Scholar] [CrossRef]
  17. IUCN. The IUCN Red List of Threatened Species; IUCN: Gland, Switzerland, 2014. [Google Scholar]
  18. Jackson, D.A.; Peres-Neto, P.R.; Olden, J.D. What controls who is where in freshwater fish communities—The roles of biotic, abiotic, and spatial factors. Can. J. Fish. Aquat. Sci. 2001, 58, 157–170. [Google Scholar]
  19. Murphy, B.R.; Willis, D.W. (Eds.) Fisheries Techniques, 2nd ed.; American Fisheries Society: Bethesda, MD, USA, 1996; p. 732. [Google Scholar]
  20. Snyder, D.E. Invited overview: Conclusions from a review of electrofishing and its harmful effects on fish. Rev. Fish. Biol. Fisher 2003, 13, 445–453. [Google Scholar] [CrossRef]
  21. Janosik, A.M.; Johnston, C.E. Environmental DNA as an effective tool for detection of imperiled fishes. Environ. Biol. Fish. 2015, 98, 1889–1893. [Google Scholar] [CrossRef]
  22. Bergman, P.S.; Schumer, G.; Blankenship, S.; Campbell, E. Detection of Adult Green Sturgeon Using Environmental DNA Analysis. PLoS ONE 2016, 11, e0153500. [Google Scholar] [CrossRef] [PubMed]
  23. Thomsen, P.F.; Kielgast, J.; Iversen, L.L.; Wiuf, C.; Rasmussen, M.; Gilbert, M.T.P.; Orlando, L.; Willerslev, E. Monitoring endangered freshwater biodiversity using environmental DNA. Mol. Ecol. 2012, 21, 2565–2573. [Google Scholar] [CrossRef] [PubMed]
  24. Miya, M.; Gotoh, R.O.; Sado, T. MiFish metabarcoding: A high-throughput approach for simultaneous detection of multiple fish species from environmental DNA and other samples. Fish. Sci. 2020, 86, 939–970. [Google Scholar] [CrossRef]
  25. Darling, J.A.; Mahon, A.R. From molecules to management: Adopting DNA-based methods for monitoring biological invasions in aquatic environments. Environ. Res. 2011, 111, 978–988. [Google Scholar] [CrossRef]
  26. Rees, H.C.; Maddison, B.C.; Middleditch, D.J.; Patmore, J.R.M.; Gough, K.C. The detection of aquatic animal species using environmental DNA—A review of eDNA as a survey tool in ecology. J. Appl. Ecol. 2014, 51, 1450–1459. [Google Scholar] [CrossRef]
  27. Dougherty, M.M.; Larson, E.R.; Renshaw, M.A.; Gantz, C.A.; Egan, S.P.; Erickson, D.M.; Lodge, D.M. Environmental DNA (eDNA) detects the invasive rusty crayfish Orconectes rusticus at low abundances. J. Appl. Ecol. 2016, 53, 722–732. [Google Scholar] [CrossRef] [PubMed]
  28. Yamamoto, S.; Masuda, R.; Sato, Y.; Sado, T.; Araki, H.; Kondoh, M.; Minamoto, T.; Miya, M. Environmental DNA metabarcoding reveals local fish communities in a species-rich coastal sea. Sci. Rep. 2017, 7, 40368. [Google Scholar] [CrossRef] [PubMed]
  29. Lodge, D.M.; Turner, C.R.; Jerde, C.L.; Barnes, M.A.; Chadderton, L.; Egan, S.P.; Feder, J.L.; Mahon, A.R.; Pfrender, M.E. Conservation in a cup of water: Estimating biodiversity and population abundance from environmental DNA. Mol. Ecol. 2012, 21, 2555–2558. [Google Scholar] [CrossRef]
  30. Bohmann, K.; Evans, A.; Gilbert, M.T.P.; Carvalho, G.R.; Creer, S.; Knapp, M.; Yu, D.W.; de Bruyn, M. Environmental DNA for wildlife biology and biodiversity monitoring. Trends Ecol. Evol. 2014, 29, 358–367. [Google Scholar] [CrossRef] [PubMed]
  31. Aoyama, J.; Watanabe, S.; Ishikawa, S.; Nishida, M.; Tsukamoto, K. Are morphological characters distinctive enough to discriminate between two species of freshwater eels, Anguilla celebesensis and A. interioris? Ichthyol. Res. 2000, 47, 157–161. [Google Scholar] [CrossRef]
  32. Moriarty, C. The Yellow Eel. In Eel Biology; Aida, K., Tsukamoto, K., Yamauchi, K., Eds.; Springer: Tokyo, Japan, 2003. [Google Scholar] [CrossRef]
  33. Tzeng, W.N.; Shiao, J.C.; Iizuka, Y. Use of otolith Sr: Ca ratios to study the riverine migratory behaviors of Japanese eel Anguilla japonica. Mar. Ecol. Prog. Ser. 2002, 245, 213–221. [Google Scholar] [CrossRef]
  34. Briones, A.A.; Yambot, A.V.; Shiao, J.C.; Iizuka, Y.; Tzeng, W.N. Migratory pattern and habitat use of tropical eels Anguilla spp. (Teleostei: Anguilliformes: Anguillidae) in the Philippines, as revealed by otolith microchemistry. Raffles B Zool. 2007, 14, 141–149. [Google Scholar]
  35. Itakura, H.; Wakiya, R.; Yamamoto, S.; Kaifu, K.; Sato, T.; Minamoto, T. Environmental DNA analysis reveals the spatial distribution, abundance, and biomass of Japanese eels at the river-basin scale. Aquat. Conserv. 2019, 29, 361–373. [Google Scholar] [CrossRef]
  36. Itakura, H.; Wakiya, R.; Sakata, M.K.; Hsu, H.Y.; Chen, S.C.; Yang, C.C.; Huang, Y.C.; Han, Y.S.; Yamamoto, S.; Minamoto, T. Estimations of Riverine Distribution, Abundance, and Biomass of Anguillid Eels in Japan and Taiwan Using Environmental DNA Analysis. Zool. Stud. 2020, 59, e17. [Google Scholar]
  37. Kasai, A.; Yamazaki, A.; Ahn, H.; Yamanaka, H.; Kameyama, S.; Masuda, R.; Azuma, N.; Kimura, S.; Karaki, T.; Kurokawa, Y.; et al. Distribution of Japanese Eel Anguilla japonica Revealed by Environmental DNA. Front. Ecol. Evol. 2021, 9, 621461. [Google Scholar] [CrossRef]
  38. Kelly, E.W.; Kathryn, P.H.; Antoinette, J.P. No filters, no fridges: A method for preservation of water samples for eDNA analysis. BMC Res. Notes 2016, 9, 298. [Google Scholar] [CrossRef]
  39. Hsu, H.Y.; Lin, Y.T.; Huang, Y.C.; Han, Y.S. Skin coloration and habitat preference of the freshwater Anguilla eels. Int. J. Aquac. Fish. Sci. 2020, 6, 96–101. [Google Scholar] [CrossRef]
  40. Aoyama, J.; Yoshinaga, T.; Shinoda, A.; Shirotori, F.; Yambot, A.V.; Han, Y.S. Seasonal Changes in Species Composition of Glass Eels of the Genus Anguilla (Teleostei: Anguillidae) Recruiting to the Cagayan River, Luzon Island, the Philippines. Pac. Sci. 2015, 69, 263–270. [Google Scholar] [CrossRef]
  41. Han, Y.S.; Liao, I.C.; Huang, Y.S.; He, J.T.; Chang, C.W.; Tzeng, W.N. Synchronous changes of morphology and gonadal development of silvering Japanese eel Anguilla japonica. Aquaculture 2003, 219, 783–796. [Google Scholar] [CrossRef]
  42. Lin, Y.S.; Tzeng, C.S.; Hwang, J.K. Reassessment of morphological characteristics in freshwater eels (genus Anguilla, Anguillidae) shows congruence with molecular phylogeny estimates. Zool. Scr. 2005, 34, 225–234. [Google Scholar] [CrossRef]
  43. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
  44. Sakata, M.K.; Maki, N.; Sugiyama, H.; Minamoto, T. Identifying a breeding habitat of a critically endangered fish, Acheilognathus typus, in a natural river in Japan. Sci. Nat-Heidelb. 2017, 104, 100. [Google Scholar] [CrossRef]
  45. Jerde, C.L. Can we manage fisheries with the inherent uncertainty from eDNA? J. Fish. Biol. 2021, 98, 341–353. [Google Scholar] [CrossRef]
  46. Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Sepulveda, A.J.; Shepard, B.B.; Jane, S.F.; Whiteley, A.R.; Lowe, W.H.; Schwartz, M.K. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis. Biol. Conserv. 2016, 194, 209–216. [Google Scholar] [CrossRef]
  47. Mauvisseau, Q.; Burian, A.; Gibson, C.; Brys, R.; Ramsey, A.; Sweet, M. Influence of accuracy, repeatability and detection probability in the reliability of species-specific eDNA based approaches. Sci. Rep. 2019, 9, 580. [Google Scholar] [CrossRef] [PubMed]
  48. Buxton, A.; Matechou, E.; Griffin, J.; Diana, A.; Griffiths, R.A. Optimising sampling and analysis protocols in environmental DNA studies. Sci. Rep. 2021, 11, 11637. [Google Scholar] [CrossRef]
  49. Sint, D.; Kolp, B.; Rennstam Rubbmark, O.; Füreder, L.; Traugott, M. The amount of environmental DNA increases with freshwater crayfish density and over time. Environ. DNA 2022, 4, 417–424. [Google Scholar] [CrossRef]
  50. Yokouchi, K.; Sudo, R.; Kaifu, K.; Aoyama, J.; Tsukamoto, K. Biological characteristics of silver-phase Japanese eels, Anguilla japonica, collected from Hamana Lake, Japan. Coast. Mar. Sci. 2009, 33, 1–10. [Google Scholar]
  51. Kaifu, K.; Tamura, M.; Aoyama, J.; Tsukamoto, K. Dispersal of yellow phase Japanese eels Anguilla japonica after recruitment in the Kojima Bay-Asahi River system, Japan. Environ. Biol. Fish. 2010, 88, 273–282. [Google Scholar] [CrossRef]
  52. Doi, H.; Takahara, T.; Minamoto, T.; Matsuhashi, S.; Uchii, K.; Yamanaka, H. Droplet Digital Polymerase Chain Reaction (PCR) Outperforms Real-Time PCR in the Detection of Environmental DNA from an Invasive Fish Species. Environ. Sci. Technol. 2015, 49, 5601–5608. [Google Scholar] [CrossRef]
  53. Klymus, K.E.; Richter, C.A.; Chapman, D.C.; Paukert, C. Quantification of eDNA shedding rates from invasive bighead carp Hypophthalmichthys nobilis and silver carp Hypophthalmichthys molitrix. Biol. Conserv. 2015, 183, 77–84. [Google Scholar] [CrossRef]
  54. Iversen, L.L.; Kielgast, J.; Sand-Jensen, K. Monitoring of animal abundance by environmental DNA—An increasingly obscure perspective: A reply to Klymus et al., 2015. Biol. Conserv. 2015, 192, 479–480. [Google Scholar] [CrossRef]
  55. Johnsen, S.I.; Strand, D.A.; Rusch, J.C.; Vralstad, T. Environmental DNA (eDNA) Monitoring of Noble Crayfish Astacus astacus in Lentic Environments Offers Reliable Presence-Absence Surveillance—But Fails to Predict Population Density. Front. Environ. Sci. 2020, 8, 612253. [Google Scholar] [CrossRef]
  56. Itakura, H.; Kaino, T.; Miyake, Y.; Kitagawa, T.; Kimura, S. Feeding, condition, and abundance of Japanese eels from natural and revetment habitats in the Tone River, Japan. Environ. Biol. Fish. 2015, 98, 1871–1888. [Google Scholar] [CrossRef]
  57. Itakura, H.; Miyake, Y.; Kitagawa, T.; Kimura, S. Site fidelity, diel and seasonal activities of yellow-phase Japanese eels (Anguilla japonica) in a freshwater habitat as inferred from acoustic telemetry. Ecol. Freshw. Fish. 2018, 27, 737–751. [Google Scholar] [CrossRef]
  58. Wakiya, R.; Kaifu, K.; Azechi, K.; Tsukamoto, K.; Mochioka, N. Evaluation of downward movements of Japanese eel Anguilla japonica inhabiting brackish water areas. J. Fish. Biol. 2020, 96, 516–526. [Google Scholar] [CrossRef] [PubMed]
  59. Collins, R.A.; Wangensteen, O.S.; O’Gorman, E.J.; Mariani, S.; Sims, D.W.; Genner, M.J. Persistence of environmental DNA in marine systems. Commun. Biol. 2018, 1, 185. [Google Scholar] [CrossRef] [PubMed]
  60. Hsiung, K.M.; Lin, Y.T.; Han, Y.S. Current Dependent Dispersal Characteristics of Japanese Glass Eel around Taiwan. J. Mar. Sci. Eng. 2022, 10, 98. [Google Scholar] [CrossRef]
  61. Dudgeon, D.; Arthington, A.H.; Gessner, M.O.; Kawabata, Z.I.; Knowler, D.J.; Leveque, C.; Naiman, R.J.; Prieur-Richard, A.H.; Soto, D.; Stiassny, M.L.J.; et al. Freshwater biodiversity: Importance, threats, status and conservation challenges. Biol. Rev. 2006, 81, 163–182. [Google Scholar] [CrossRef] [PubMed]
  62. Jane, S.F.; Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K.; Lowe, W.H.; Letcher, B.H.; Whiteley, A.R. Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams. Mol. Ecol. Resour. 2015, 15, 216–227. [Google Scholar] [CrossRef] [PubMed]
  63. Seymour, M.; Durance, I.; Cosby, B.J.; Ransom-Jones, E.; Deiner, K.; Ormerod, S.J.; Colbourne, J.K.; Wilgar, G.; Carvalho, G.R.; de Bruyn, M.; et al. Acidity promotes degradation of multi-species environmental DNA in lotic mesocosms. Commun. Biol. 2018, 1, 4. [Google Scholar] [CrossRef]
Fishes 08 00483 g001
Figure 1. Study sites in the Fengshan and Shimen Rivers FS indicates the study site in the Fengshan River, and SM indicates the study site in the Shimen River. There are four study sites in the Fengshan and Shimen Rivers, respectively.
Figure 1. Study sites in the Fengshan and Shimen Rivers FS indicates the study site in the Fengshan River, and SM indicates the study site in the Shimen River. There are four study sites in the Fengshan and Shimen Rivers, respectively.
Fishes 08 00483 g001
Fishes 08 00483 g002
Figure 2. Pie chart for assessing the effectiveness of eDNA analysis in detecting Japanese eels (A). The occupied percentage of the surveys in which Japanese eels have been captured or not captured by electrofishing within the surveys having positive Japanese eel eDNA detection (n = 11). (B) The occupied percentage of the surveys in which Japanese eels have been captured or not captured by electrofishing within the surveys having negative Japanese eel eDNA detection (n = 13).
Figure 2. Pie chart for assessing the effectiveness of eDNA analysis in detecting Japanese eels (A). The occupied percentage of the surveys in which Japanese eels have been captured or not captured by electrofishing within the surveys having positive Japanese eel eDNA detection (n = 11). (B) The occupied percentage of the surveys in which Japanese eels have been captured or not captured by electrofishing within the surveys having negative Japanese eel eDNA detection (n = 13).
Fishes 08 00483 g002
Fishes 08 00483 g003
Figure 3. Overview of the Japanese eel eDNA detection at 34 river basins in Taiwan.
Figure 3. Overview of the Japanese eel eDNA detection at 34 river basins in Taiwan.
Fishes 08 00483 g003
Table 1. Japanese eel-specific primer pair of mitochondrial cytb for real-time PCR (F: forward; R: reverse).
Table 1. Japanese eel-specific primer pair of mitochondrial cytb for real-time PCR (F: forward; R: reverse).
SpeciesPrimer SequencesAmplicon Size (bp)PCR Efficiency
A. japonicaAJ-F: 5′–ATGGATGATTCATCCGAAAT–3′
AJ-R: 5′−GTGTAGGTAGAGGCAGATAAAG−3′		6898.5%
Table 2. The number of captured Japanese eels and the data of eDNA detection at the study sites in the Fengshan and Shimen Rivers.
Table 2. The number of captured Japanese eels and the data of eDNA detection at the study sites in the Fengshan and Shimen Rivers.
Study SiteDateJapanese Eel
eDNA (Cq)Captures
FS1December 2021+, (30.3 ± 0.4)2
FS2−, (N/A)0
FS3−, (N/A)0
FS4−, (N/A)0
FS1January 2022+, (30.5 ± 0.3)3
FS2−, (N/A)0
FS3+, (28.4 ± 0.4)2
FS4−, (N/A)0
FS1February 2022+, (32.1 ± 0.3)5
FS2−, (N/A)0
FS3+, (31.8 ± 0.2)3
FS4−, (N/A)0
SM1December 2021+, (32.7 ± 0.3)3
SM2+, (31.5 ± 0.4)0
SM3−, (N/A)0
SM4−, (N/A)0
SM1January 2022+, (28.7 ± 0.4)4
SM2+, (30.2 ± 0.2)5
SM3−, (N/A)0
SM4−, (N/A)0
SM1February 2022+, (32.7 ± 0.5)13
SM2+, (32.1 ± 0.4)12
SM3−, (N/A)0
SM4−, (N/A)0
“+”: positive detection; “−”: negative detection; “N/A”: no Cq value.
Table 3. Cq values of Japanese eel eDNA and RPI values of waters at the sampling sites of 36 target rivers in this study.
Table 3. Cq values of Japanese eel eDNA and RPI values of waters at the sampling sites of 36 target rivers in this study.
Name of RivereDNA Detection of Japanese EelRPI ValueLevel of Pollution
Beishikeng River+, 35.0 ± 0.4NN
Hemei River−NN
Jingshawan River−NN
Daxi River+, 27.2 ± 0.31non/mildly polluted
Gengfang River+, 29.8 ± 0.3NN
Dezikou River−3.75moderately polluted
Xinchen River+, 28.9 ± 0.21non/mildly polluted
Dongao North River +, 27.8 ± 0.31non/mildly polluted
Liwu River+, 34.6 ± 0.41non/mildly polluted
Sanzhan River+, 31.5 ± 0.41non/mildly polluted
Shuliao River−NN
Xiuguluan River+, 38.1 ± 0.23.25moderately polluted
Ningpu River−NN
Dabin River−NN
Duwei River+, 32.3 ± 0.2NN
Fujia River+, 31.3 ± 0.31.25non/mildly polluted
Hsinkang River+, 33.3 ± 0.2NN
Mawu River−1.25non/mildly polluted
Taimali River+, 30.2 ± 0.3NN
Anshuo River+, 35.9 ± 0.4NN
Nanwan River−NN
Nankan River−4moderately polluted
Shuangxikou River−NN
Xinwu River+, 36.0 ± 0.32.25lightly polluted
Zhonggang River+, 32.5 ± 0.32non/mildly polluted
Oldzhuoshui River+, 34.5 ± 0.32.25lightly polluted
Newhuwei River+, 31.4 ± 0.24.25moderately polluted
Yanshui River−6.25severely polluted
Erren River−4.75moderately polluted
Tianliao River+, 31.1 ± 0.2NN
Dianbao River−7.25severely polluted
Gaoping River−3.25moderately polluted
Donggang River+, 37.9 ± 0.35.5moderately polluted
Linbian River−1.5non/mildly polluted
Fengshan River+, 30.5 ± 0.32.25lightly polluted
Shimen River+, 28.7 ± 0.3NN
“+”: positive detection; “−“: negative detection; “N”: no RPI value or unknown pollution level.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hsu, H.-Y.; Wu, K.-J.; Han, Y.-S. Detecting Japanese Eels (Anguilla japonica) and Revealing Their Distribution in Taiwanese Rivers by Environmental DNA Analysis. Fishes 2023, 8, 483. https://doi.org/10.3390/fishes8100483

AMA Style

Hsu H-Y, Wu K-J, Han Y-S. Detecting Japanese Eels (Anguilla japonica) and Revealing Their Distribution in Taiwanese Rivers by Environmental DNA Analysis. Fishes. 2023; 8(10):483. https://doi.org/10.3390/fishes8100483

Chicago/Turabian Style

Hsu, Hsiang-Yi, Kai-Jen Wu, and Yu-San Han. 2023. "Detecting Japanese Eels (Anguilla japonica) and Revealing Their Distribution in Taiwanese Rivers by Environmental DNA Analysis" Fishes 8, no. 10: 483. https://doi.org/10.3390/fishes8100483

Article Metrics

Back to TopTop