Effects of Three Microalgal Diets Varying in LC-PUFA Composition on Growth, Fad, and Elovl Expressions, and Fatty Acid Profiles in Juvenile Razor Clam Sinonovacula constricta

Abstract

The razor clam Sinonovacula constricta is the first marine mollusk demonstrated to possess the complete long-chain polyunsaturated fatty acids (LC-PUFA) biosynthetic pathway. This study explored the impact of different microalgae on growth, Fad and Elovl expressions, and fatty acid (FA) profiles in juvenile S. constricta. Results revealed that juveniles fed with Isochrysis galbana (rich in DHA) or Chaetoceros calcitrans (rich in EPA) consistently exhibited higher growth than those fed Chlorella sp. (rich in LA and ALA), underscoring the importance of dietary LC-PUFA in S. constricta’s development. Expression of most Fad and Elovl in C. calcitrans and I. galbana-fed juveniles were initially up-regulated, then down-regulated, suggesting LC-PUFA demand for faster growth. Although Chlorella sp.-fed juveniles exhibited decreased mRNA levels for most genes, levels were notably higher lately compared to those fed C. calcitrans or I. galbana, hinting at potential LC-PUFA biosynthesis induction. FA profiles in S. constricta generally mirrored those in ingested microalgae, implying direct FA accumulation from diets. Some microalgal FA were absent in farmed S. constricta, while others emerged, indicating S. constricta’s ability to selectively accumulate and synthesize FA. This study enhances the understanding of dietary FA metabolism in S. constricta, valuable for selecting appropriate microalgae in its farming practices.

1. Introduction

Long-chain polyunsaturated fatty acids (LC-PUFA) are characterized by carbon chains ≥20 and double bonds ≥3. Examples include docosahexaenoic acid (22:6n-3, DHA), eicosapentaenoic acid (20:5n-3, EPA), and arachidonic acid (20:4n-6, ARA), all of which are vital for human health [1]. Marine mollusks are valuable sources of LC-PUFA for humans [2,3]. LC-PUFA biosynthesis involves a range of enzymes, including fatty acyl desaturase (Fad) and elongase of very long-chain fatty acid (Elovl) [4]. Therefore, to determine the sources of LC-PUFA in marine mollusks, whether derived from exogenous diets or endogenous biosynthesis, researchers have identified and functionally characterized Fad and Elovl in several commercially valuable marine mollusks. These include Δ5 Fad from Haliotis discus hannai [5], Elovl4 from Sepia officinalis [6], Δ5 Fad, Δ8 Fad, Elovl2/5, and Elovl4 from Chlamys nobilis [7,8,9], Δ5 Fad, Elovl2/5, and Elovl4 from Octopus vulgaris [10,11,12], and Elovl2/5 from Crassostrea angulate [13]. Despite these convincing studies, which have demonstrated the potential for LC-PUFA biosynthesis in marine mollusks, it is widely reported that the fatty acid (FA) profiles of marine mollusks closely resemble those of their microalgal diets [14,15,16,17,18,19]. However, until now, the impact of dietary microalgae on LC-PUFA biosynthesis in marine mollusks has remained largely unexplored.

The razor clam Sinonovacula constricta (Lamarck 1818), also known as the Asian hard clam, is a bivalve mollusk native to the western Pacific coast [20]. It holds significant economic and nutritional value, with both farmed and wild-caught razor clams being harvested. In 2016, global production of S. constricta exceeded 823,000 tons, with a total value of USD 1.3 billion [21]. This bivalve species is particularly rich in nutrients [22], notably EPA and DHA, each accounting for 10% of the total FA at approximately 3.5 µg·mg⁻¹ (dry weight, DW) [23]. Our recent research demonstrated that S. constricta possesses a complete LC-PUFA biosynthetic pathway known as the Sprecher pathway [24]. This was confirmed through the functional characterization of key enzymes, including Δ5 Fad_a, Δ5 Fad_b, Δ6 Fad [25], and Elovl2/5, Elovl4_a, Elovl4_b, Elovl_c [26]. Importantly, to date, S. constricta is the first and only marine mollusk demonstrated to possess the complete LC-PUFA biosynthetic pathway. As a result, S. constricta serves as a valuable model organism for further investigating the regulation of LC-PUFA biosynthesis in marine mollusks.

The Chlorella sp., Chaetoceros calcitrans, and Isochrysis galbana are three common types of microalgae used in shellfish aquaculture, including S. constricta, each with distinct LC-PUFA compositions [27]. For instance, Chlorella sp. is rich in LC-PUFA precursors such as 18:2n-6 (LA, comprising 14.34 ± 0.38% of total FA, equivalent to 13.28 ± 0.24 µg·mg⁻¹ DW) and 18:3n-3 (ALA, 31.84 ± 1.28%, 29.30 ± 0.13 µg·mg⁻¹ DW), but lacks LC-PUFA content. C. calcitrans, on the other hand, is abundant in EPA (7.89 ± 0.73%, 12.42 ± 2.84 µg·mg⁻¹ DW) while having negligible DHA content (0.55 ± 0.02%, 0.57 ± 0.11 µg·mg⁻¹ DW). In contrast, I. galbana is rich in DHA (13.44 ± 0.65%, 24.32 ± 0.15 µg·mg⁻¹ DW) [27]. Therefore, in this study, we selected these three microalgae to investigate their impact on the growth, expressions of Fad and Elovl, and FA profiles in juvenile S. constricta. The primary objective of this study was to establish a theoretical foundation for selecting the most suitable microalgae for S. constricta aquaculture and to contribute to the efficient and sustainable utilization of its LC-PUFA resources.

2. Materials and Methods

2.1. Seawater Preparation

The natural seawater (~32 practical salinity units, PSU) was initially passed through a 1 m thick sand filter with a diameter of less than 1 mm. It was then allowed to settle for 2 d and subsequently passed through a 75 µm nylon cribrose sieve before use. The experimental seawater (23 PSU) was prepared by blending natural seawater with freshwater. For microalgae cultivation, the experimental seawater underwent additional filtration (0.45 µm), autoclaving (115 °C, 20 min), and enrichment with a nutritional medium composed of 3 mg·L⁻¹ Fe-citrate·5 H₂O, 10 mg·L⁻¹ KH₂PO₄, 100 mg·L⁻¹ KNO₃, 0.05 μg·L⁻¹ VB₁₂ and 6 μg·L⁻¹ VB₁. Specifically, the culture of C. calcitrans required an additional supplement of 20 mg·L⁻¹ sodium metasilicate. For the cultivation of juvenile S. constricta, the experimental seawater underwent further treatment with hypochlorite sterilization.

2.2. Cultivation of Microalgae

The three microalgae species with distinct LC-PUFA compositions (

Table 1. FA composition (µg·mg⁻¹) of Chlorella sp., C. calcitrans, and I. galbana. Values (mean ± SD, n = 3) sharing a common superscript are not significantly different (p ≥ 0.05).

FA	Chlorella sp.	C. calcitrans	I. galbana
14:0	- a	26.97 ± 1.49 b	24.43 ± 0.91 c
15:0	- a	0.81 ± 0.20 b	0.72 ± 0.02 b
16:0	19.07 ± 1.62 a	27.45 ± 2.33 b	20.50 ± 0.64 a
18:0	2.19 ± 0.20 a	3.32 ± 0.23 b	0.57 ± 0.05 c
20:0	5.23 ± 0.19 a	0.13 ± 0.03 b	- b
16:1n-7	3.03 ± 0.33 a	59.66 ± 12.1 b	7.51 ± 0.42 a
18:1n-9	2.61 ± 0.42 a	3.47 ± 0.16 b	19.51 ± 0.22 c
18:1n-7	1.43 ± 0.26 a	1.57 ± 0.09 a	2.80 ± 0.19 b
18:1n-6	- a	0.18 ± 0.02 b	0.67 ± 0.14 c
22:1n-9	- a	- a	0.37 ± 0.09 b
16:2n-6	4.92 ± 0.09 a	1.15 ± 0.09 b	0.12 ± 0.12 c
18:2n-6	13.28 ± 0.24 a	2.66 ± 0.05 b	4.52 ± 0.16 c
18:3n-6	- a	1.13 ± 0.17 b	0.29 ± 0.05 c
20:4n-6	- a	2.49 ± 0.47 b	- a
22:2n-6	- a	- a	0.02 ± 0.02 a
22:5n-6	- a	- a	1.35 ± 0.10 b
16:3n-3	- a	8.14 ± 1.75 b	- a
18:3n-3	29.30 ± 0.13 a	0.10 ± 0.02 b	10.84 ± 0.28 c
18:4n-3	- a	0.54 ± 0.06 a	50.35 ± 6.01 b
20:5n-3	- a	12.42 ± 2.84 b	1.01 ± 0.07 c
22:4n-3	- a	- a	0.13 ± 0.01 b
22:6n-3	- a	0.57 ± 0.11 b	24.32 ± 0.15 c
16:2n-4	- a	2.11 ± 0.27 b	0.90 ± 0.10 c
16:3n-4	11.12 ± 1.50 a	- b	- b
18:2n-7	- a	0.21 ± 0.08 b	- a
20:3n-7	- a	0.20 ± 0.02 a	10.45 ± 0.55 b
SFA	26.48 ± 2.00 a	58.67 ± 3.82 b	46.22 ± 1.62 c
MUFA	7.07 ±0.16 a	64.88 ± 11.93 b	30.86 ± 0.23 c
PUFA	58.62 ± 1.97 a	31.71 ± 5.93 b	104.30 ± 5.88 c
TFA	92.18 ± 4.13 a	155.26 ± 21.68 b	181.38 ± 7.73 b

SFA: total saturated FA; MUFA: total monounsaturated FA; PUFA: total polyunsaturated FA (double bonds ≥ 2); TFA: total FA; “-”: not detected.

), including I. galbana, C. calcitrans, and Chlorella sp. were sourced from the Microalgal Culture Laboratory at Ningbo University, Ningbo, China. Initially, the microalgae were cultured in 5 L Erlenmeyer flasks in a microalgal culture chamber at 20 ± 1 °C without aeration. Subsequently, the exponentially growing microalgae were inoculated into 50-L transparent white barrels (at a ratio of 1:1000, v/v) and cultivated in an open greenhouse with continuous aeration at room temperature (~20–29 °C). The microalgae in the stationary phase were then harvested for use as feed for juvenile S. constricta.

2.3. Cultivation of Juvenile S. constricta

Juvenile S. constricta were sourced from Fujian Baozhi Aquatic Science and Technology Co., Ltd., Zhangzhou, China. Initially, juveniles of similar size (9.35 ± 0.49 mm in shell length) were subjected to a 3 d fasting period to acclimate and empty their stomachs. Subsequently, 900 individuals were evenly distributed on the bottom of nine pre-prepared barrels, with 100 individuals per barrel to enhance sampling randomness. Each barrel had a volume of 500 L and a bottom diameter of 100 cm. They were pre-filled with 5 cm thick fresh sea mud (previously filtered through a 75 µm cribrose nylon sieve) and filled with seawater to a depth of 45 ± 1 cm. Given S. constricta’s benthic and burrowing behavior, sea mud was provided. The nine barrels were grouped into three sets of three barrels, each allocated to supply Chlorella sp., C. calcitrans, and I. galbana, respectively. The final microalgae concentration was maintained at ~40–60 cells·µL⁻¹, a level empirically determined to satisfy the feeding requirements of juvenile S. constricta. Microalgae concentrations were calculated using a hemocytometer. Juveniles were fed twice daily at 7:00 a.m. and 5:00 p.m. to ensure a continuous supply of food in the water. Continuous aeration was provided to ensure sufficient oxygen levels in the water. Notably, before the second feeding each day, half of the cultured seawater volume was renewed to maintain water quality. The sea mud was replaced every 8 d to prevent deterioration due to fecal deposition in the relatively closed barrels. The seawater depth was consistently maintained at 45 ± 1 cm. The entire experiment was performed in an open greenhouse at room temperature (~20–29 °C). The experiment lasted for 24 d.

2.4. Sampling and Processing

Sampling was conducted every 8 d, coinciding with the renewal of sea mud. It is worth noting that before each sampling event, the juveniles underwent a 1 d fasting period to facilitate digestion of ingested microalgae. After taking growth measurements of all juveniles, six individuals were randomly selected from each barrel and subjected to the following steps.

The shells were carefully removed using medical dissecting scissors and forceps. The dissected tissue was divided into two primary parts. The first part, referred to as the visceral mass, comprises the intestine, digestive glands, and gonads. These tissues are the primary sites for LC-PUFA synthesis in S. constricta [25,26]. The second part of the sample was designed as muscular tissues, encompassing the foot, siphons, labial palps, and gills. Subsequently, the visceral mass from six individuals in each barrel was combined, homogenized, and utilized for the analysis of Fad and Elovl expression. Additionally, the muscular tissues from six individuals in each barrel were pooled, homogenized, and used to analyze the FA composition. Furthermore, the FA composition of the visceral mass of juvenile S. constricta at both the beginning and end of the experiment was also analyzed.

2.5. Analysis of Fad and Elovl Expressions by Quantitative Real-Time PCR (qRT-PCR)

RNA was extracted from the homogenized visceral mass using the MiniBEST Universal RNA Extraction Kit (Takara, Shiga, Japan). Subsequently, RNA quality was assessed using a 1% agarose gel, and the quantity of RNA was determined using NanoDrop^® ND-1000 (NanoDrop, Waltham, MA, USA). To prepare the cDNA template for qRT-PCR, 1 µg of RNA was transcribed into cDNA using the PrimeScript RT Master Mix Kit (Perfect Real Time) (Takara, Shiga, Japan). The qRT-PCR was conducted using a quantitative thermal cycler (Mastercycler ep realplex) (Eppendorf, Hamburg, Germany) with SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara, Shiga, Japan) and the primers listed in

Table 2. Primers used for qRT-PCR of S. constricta Fad and Elovl.

Gene (GenBank No.)	Primer	Sequence (5′ → 3′)
Δ5 Fad_a (MH220404)	F (forward)	ACATCCCAGGCCCAAGGC
	R (reverse)	CCCTTGACAAACCCGGTCAA
Δ5 Fad_b (MH220405)	F	TTATTCCACATCCCAGGTACAGACT
	R	CCCTTTGTGAAGCCCATGGT
Δ6 Fad (MH220406)	F	CTAACGAGGTGGACTTTGATGG
	R	AGAGTGTTCCAAGGACCTGACC
Elovl2/5 (MK134691)	F	GCTCAACATTTGGTGGTGGGT
	R	GGAATGACTGCCAGACCGTAG
Elovl4_a (MK134692)	F	TTGGGATCATTCACGCAGCC
	R	GATGGTGAATGCGTAAAACACAAGA
Elovl4_b (MK134693)	F	TGCCGGTATGGTCTACGGTGT
	R	GATTGTGACACCGTATACAAGCGAG
Elovl_c (MK134694)	F	TGCTATCTACTCGGACTGTGGC
	R	GTTTTCTTGACGTGTGCAGAGC
β-actin (HQ693079.1)	F	CCATCTACGAAGGTTACGCCC
	R	TCGTAGTGAAGGAGTAGCCTCTTTC

. Briefly, after an initial denaturation step at 95 °C for 30 s, the amplifications were carried out with 35 cycles at a melting temperature of 95 °C for 5 s, an annealing temperature of 55 °C for 15 s, and an extension temperature of 72 °C for 20 s, followed by a melting curve analysis from 58 to 95 °C with an increment of 1.85 °C·min⁻¹. Finally, the relative expressions of Fad and Elovl were calculated with the housekeeping gene of β-actin using the 2^−ΔΔCT method [28]. The expression of each gene was normalized to that of the initial sample.

2.6. Analysis of FA Profiles by Gas Chromatography-Mass Spectrometry (GC-MS)

The preparation of fatty acid methyl esters (FAMEs) was conducted following the procedure outlined by Xu et al. [18]. Initially, the homogenized tissues were lyophilized and subsequently ground to a fine powder. Next, 30 mg of the powder sample was dissolved in 4 mL CHCl₃/CH₃OH/H₂O (1:2:0.8, v/v/v) for crude lipid extraction. The solution was vigorously shaken for 10 min. To this mixture, 0.3 mL of HCl (8%, w/v) in methanol/water (in a ratio of 85:15, v/v), 1.5 mL of methanol, 0.2 mL of toluene, and 15 µL of nonadecanoic acid 19:0 (1 µg·µL⁻¹, serving as the internal standard) (Cayman Chemicals, Ann Arbor, MI, USA) were added. This mixture was then incubated for 1 h at 100 °C to yield FAMEs. Subsequently, the FAMEs were extracted into 1 mL hexane-chloroform (in a ratio of 4:1, v/v), dried under nitrogen, re-diluted into 1 mL of chromatography-grade hexane (filtered through a 0.22 µm ultrafiltration membrane), and loaded onto a GC-MS platform (7890B/7000C) (Agilent, Santa Clara, CA, USA).

The GC-MS analysis was conducted using a CD-2560 capillary column (100 m × 250 μm × 0.2 μm, CNW, Frankfurt, Germany). Helium, of high purity, served as the carrier gas at a constant flow rate of 0.81 mL·min⁻¹. A 1 µL sample was injected in split-less mode. The initial precolumn pressure was 30.36 psi. The injector temperature was set at 250 °C. Initially, the GC oven temperature was maintained at 140 °C for 5 min and then increased to 240 °C over 20 min at a rate of 4 °C·min⁻¹. The MS ion source temperature was 230 °C, the quadrupole temperature was 150 °C, and the transmission line temperature was 255 °C. The mass spectrometer scanned from 40 to 600 m/z, and the collision energy was set at 70 eV.

FA were identified by matching the mass spectral data with the NIST 14.L mass spectral database, using characteristic mass spectrometry fragments and the relative retention times of commercially available FA standards. The composition of FA content was calculated using the following formula: (area of specific FA/area of the internal standard 19:0) × 15 μg of 19:0/weight (mg) of the lyophilized sample.

2.7. Statistical Analyses

Statistical analyses of S. constricta growth, relative expressions of Fad and Elovl, and FA composition were conducted using one-way ANOVA, followed by multiple pairwise comparisons using Tukey’s test (SPSS 22.0, Stanford, CA, USA). When the data did not meet the assumptions of normality (Kolmogorov–Smirnov test) or homoscedasticity (Levene’s test), log10 transformation was employed. Differences were considered statistically significant when p < 0.05.

To provide an overview of the changes in FA composition in S. constricta throughout the experiment, FA were treated as dependent data and subjected to the projection to latent structures with discriminant analysis (PLS-DA) using SIMCA-P+ software package (version 14.1, Umetrics; Umea, Sweden). Additionally, to further explore the correlation of FA composition between S. constricta and microalgal diets, FA were treated as dependent data and analyzed by ORIGINPRO^® 2021 (OriginLab, Northampton, MA, USA) to generate a Correlation Plot.

3. Results

3.1. Growth of Juvenile S. constricta

As depicted in Figure 1, the growth of juvenile S. constricta fed with Chlorella sp. consistently showed significantly lower values compared to those fed with C. calcitrans or I. galbana throughout the experiment. Specifically, at the end of the experiment, the shell length of the juveniles fed with Chlorella sp. was 13.99 ± 1.41 mm, in contrast to their initial measurement of 9.35 ± 0.49 mm. In contrast, the shell length of the juveniles fed with C. calcitrans and I. galbana reached 19.42 ± 1.49 mm and 20.29 ± 0.95 mm, respectively. Notably, no statistically significant differences in growth were observed between the juveniles fed with I. galbana and those fed with C. calcitrans throughout the course of the experiment.

3.2. Fad and Elovl Expressions in Visceral Mass of Juvenile S. constricta

Figure 2A–G depicts the expressions of Fad and Elovl in the visceral mass of juvenile S. constricta throughout the experiment. When fed with Chlorella sp., the expression of Δ5 Fad_a significantly increased on the 8th d compared to the initial sample, followed by a significant decrease on the 16th d, and no significant difference on the 24th d. Similarly, the expressions of Δ5 Fad_b and Elovl2/5 exhibited no significant differences on the 8th d compared to the initial sample, then significantly decreased on the 16th d, and exhibited a notable increase on the 24th d. In contrast, the expressions of Δ6 Fad and Elovl4_b remained relatively stable throughout the experiment, while Elovl4_a and Elovl_c showed no significant differences on the 8th d compared to the initial sample but decreased significantly on the 16th and 24th d. When fed with C. calcitrans, the expressions of Δ5 Fad_a, Δ5 Fad_b, Δ6 Fad, Elovl2/5, and Elovl_c significantly increased on the 8th and 16th d compared to the initial sample, followed by a significant decrease on the 24th d. Conversely, the expressions of Elovl4_a and Elovl4_b showed no significant differences on the 8th and 16th d compared to the initial sample, followed by a significant decrease on the 24th d. Finally, when fed with I. galbana, the expressions of Δ5 Fad_a, Elovl2/5, and Elovl4_a significantly increased on the 8th d compared to the initial sample, followed by a significant decrease on the 16th and 24th d. However, the expressions of other genes showed no significant differences on the 8th d compared to the initial sample and then decreased significantly on the 16th and 24th d.

In terms of the difference in Fad and Elovl expressions at the same sampling time point: on the 8th d, no significant differences were observed in Δ5 Fad_a expression among all samples. However, the expressions of other genes were significantly or noticeably lower in the samples of juveniles fed with Chlorella sp. Additionally, there were no significant differences between the samples of juveniles fed with C. calcitrans and I. galbana, except for Elovl4_a, which showed significantly higher expression in the sample of juveniles fed with I. galbana. On the 16th d, the highest expressions of all Fad and Elovl genes were found in the sample of juveniles fed with C. calcitrans. There were no significant differences observed between the samples of juveniles fed with Chlorella sp. and I. galbana, except for Δ6 Fad and Elovl4_a, which showed significantly higher expressions in the sample of juveniles fed with Chlorella sp. compared to those fed with I. galbana. On the 24th d, it was observed that the expressions of Δ5 Fad_a, Δ6 Fad, Elovl2/5, and Elovl4_b were significantly higher or noticeably higher in the sample of juveniles fed with Chlorella sp. compared to those fed with C. calcitrans or I. galbana. However, no significant differences were found in the expressions of other genes among all the samples.

3.3. Changes in FA Composition in S. constricta and Correlation with Dietary FA

The PLS-DA results for the FA composition in the muscular tissues of S. constricta over the experiment are shown in Figure 3A. A remarkable 97.2% of X variables were correlated with sample classification, demonstrating a high value of R²Y (0.816) and Q² (0.537). These values underscore the reliability of the data analysis. Each point on the graph represents the FA composition in a specific sample. Notably, the points are distributed across different areas of the plot, indicating that the FA compositions in the muscular tissues of S. constricta, when fed with different microalgae, were notably distinct from each other throughout the experiment. Furthermore, samples fed with the same microalgae tend to cluster closer together. Similarly, the FA compositions in the visceral mass of S. constricta fed with different microalgae also exhibited significant differences, as demonstrated by the scattered distribution of points in Figure 3B.

The correlation results for FA composition between S. constricta and microalgae diets are shown in Figure 4. Consistently, the FA composition of S. constricta exhibited a significantly higher correlation coefficient with that of the corresponding dietary FA. Notably, the FA composition in the muscular tissues of S. constricta fed with I. galbana also displayed a relatively higher correlation with that of Chlorella sp.

3.4. FA Composition in Muscular Tissues of Juvenile S. constricta

A total of 21 FA was identified in the muscular tissues of juvenile S. constricta (

Table 3. FA composition (µg·mg⁻¹) in muscular tissues of juvenile S. constricta fed with different microalgae during the experiment. Values (mean ± SD, n = 3) within the same sampling time sharing a common superscript are not significantly different (p ≥ 0.05).

FA	Initial	8 d			16 d			24 d
		Chlorella sp.	C. calcitrans	I. galbana	Chlorella sp.	C. calcitrans	I. galbana	Chlorella sp.	C. calcitrans	I. galbana
14:0	0.47 ± 0.02	0.22 ± 0.08 a	1.55 ± 0.12 b	0.68 ± 0.02 c	0.26 ± 0.07 a	1.78 ± 0.05 b	0.97 ± 0.07 c	0.45 ± 0.26 a	2.01 ± 0.20 b	1.59 ± 0.18 b
16:0	4.28 ± 0.51	6.25 ± 1.00 ab	7.60 ± 0.83 a	5.60 ± 0.60 b	7.40 ± 0.87 a	7.68 ± 0.74 a	5.15 ± 0.59 b	5.57 ± 0.20 a	7.90 ± 0.82 b	6.91 ± 0.43 ab
18:0	2.78 ± 0.26	3.39 ± 0.22 ab	4.19 ± 1.10 a	2.53 ± 0.05 b	4.29 ± 0.42 a	3.81 ± 0.30 a	2.48 ± 0.44 b	3.86 ± 0.02 a	3.63 ± 0.24 a	2.47 ± 0.11 b
16:1n-7	0.77 ± 0.25	0.30 ± 0.11 a	2.29 ± 0.36 b	0.68 ± 0.02 a	0.69 ± 0.20 a	4.16 ± 0.52 b	0.81 ± 0.08 a	0.55 ± 0.13 a	3.82 ± 0.43 b	1.09 ± 0.07 a
18:1n-9	0.58 ± 0.09	1.18 ± 0.14 a	0.85 ± 0.14 b	1.39 ± 0.01 a	1.13 ± 0.05 a	0.67 ± 0.01 b	2.00 ± 0.19 c	1.54 ± 0.23 a	0.75 ± 0.07 b	2.13 ± 0.28 a
18:1n-7	0.58 ± 0.04	0.52 ± 0.03 a	1.93 ± 0.30 b	0.82 ± 0.00 a	0.37 ± 0.04 a	3.59 ± 0.04 b	1.09 ± 0.21 c	0.70 ± 0.09 a	2.40 ± 0.29 b	0.99 ± 0.20a
20:1 n-9	1.25 ± 0.22	1.08 ± 0.17 a	1.62 ± 0.20 b	0.67 ± 0.02 c	1.14 ± 0.21 ab	1.44 ± 0.31 a	0.71 ± 0.04 b	0.90 ± 0.21 ab	1.15 ± 0.03 a	0.54 ± 0.10 b
20:1n-7	0.58 ± 0.12	0.35 ± 0.02 a	1.33 ± 0.15 b	0.38 ± 0.08 a	0.31 ± 0.06 a	1.59 ± 0.18 b	0.23 ± 0.02 a	0.14 ± 0.05 a	1.20 ± 0.20 b	0.21 ± 0.04 a
18:2n-6	0.14 ± 0.06	1.57 ± 0.09 a	0.19 ± 0.02 b	0.44 ± 0.01 c	0.38 ± 0.13 a	0.61 ± 0.13 a	0.98 ± 0.18 b	2.39 ± 0.17 a	0.52 ± 0.01 b	1.29 ± 0.31 c
20:2n-6	0.44 ± 0.09	1.64 ± 0.09 a	0.59 ± 0.15 b	1.12 ± 0.06 c	1.44 ± 0.13 a	0.70 ± 0.09 b	1.72 ± 0.16 a	1.40 ± 0.05 a	0.70 ± 0.04 b	1.86 ± 0.24 c
20:4n-6	1.32 ± 0.05	1.81 ± 0.11 a	1.69 ± 0.02 a	0.86 ± 0.11 b	1.36 ± 0.06 a	1.58 ± 0.09 b	0.87 ± 0.01 c	0.84 ± 0.12 a	1.71 ± 0.07 b	0.77 ± 0.20 a
22:4n-6	0.32 ± 0.01	0.42 ± 0.06 a	0.36 ± 0.03 a	0.13 ± 0.01 b	0.23 ± 0.05 a	0.46 ± 0.18 a	0.22 ± 0.02 a	0.19 ± 0.02 a	0.55 ± 0.02 b	0.23 ± 0.02 a
22:5n-6	0.48 ± 0.03	0.76 ± 0.05 a	0.22 ± 0.03 b	0.90 ± 0.05 c	0.60 ± 0.07 a	0.18 ± 0.02 b	1.58 ± 0.20 c	0.52 ± 0.05 a	0.18 ± 0.02 a	1.32 ± 0.25 b
18:2n-3	0.07 ± 0.02	0.12 ± 0.01 a	0.26 ± 0.06 b	0.14 ± 0.06 a	0.22 ± 0.01 a	0.62 ± 0.16 b	0.22 ± 0.06 a	0.25 ± 0.04 a	0.46 ± 0.03 b	0.39 ± 0.03 b
18:3n-3	0.40 ± 0.07	1.05 ± 0.02 a	0.49 ± 0.13 b	1.70 ± 0.02 c	0.78 ± 0.04 a	0.79 ± 0.04 a	2.29 ± 0.22 b	1.45 ± 0.12 a	0.52 ± 0.03 b	1.86 ± 0.17 c
18:4n-3	0.08 ± 0.01	0.16 ± 0.00 a	0.14 ± 0.01 a	0.22 ± 0.01 b	0.16 ± 0.05 a	0.15 ± 0.02 a	0.54 ± 0.19 b	0.12 ± 0.05 a	0.24 ± 0.06 a	0.16 ± 0.02 a
20:4n-3	0.37 ± 0.00	0.36 ± 0.02 a	0.75 ± 0.10 b	0.12 ± 0.00 c	0.19 ± 0.04 a	1.01 ± 0.23 b	0.11 ± 0.01 a	0.23 ± 0.05 a	0.96 ± 0.12 b	0.15 ± 0.06 a
20:5n-3	1.30 ± 0.03	1.40 ± 0.22 a	4.15 ± 0.32 b	0.76 ± 0.01 c	1.08 ± 0.11 a	6.04 ± 0.36 b	0.84 ± 0.13 a	1.10 ± 0.08 a	6.22 ± 0.18 b	0.74 ± 0.22 a
22:5n-3	0.50 ± 0.09	0.68 ± 0.05 a	0.81 ± 0.06 b	0.25 ± 0.04 c	0.69 ± 0.12 a	0.80 ± 0.09 a	0.21 ± 0.00 b	0.57 ± 0.15 a	0.69 ± 0.13 a	0.35 ± 0.06 a
22:6n-3	1.38 ± 0.10	4.45 ± 0.73 a	2.70 ± 0.12 b	3.61 ± 0.11 ab	4.78 ± 0.01 a	4.50 ± 0.58 a	5.64 ± 1.03 a	1.86 ± 0.21 a	4.88 ± 1.00 b	3.43 ± 0.70 ab
22:2(5,13)	0.25 ± 0.03	0.39 ± 0.14 a	0.29 ± 0.13 a	0.83 ± 0.04 b	0.31 ± 0.09 a	0.56 ± 0.08 a	1.37 ± 0.25 b	0.41 ± 0.18 a	0.64 ± 0.06 ab	1.00 ± 0.19 b
SFA	7.53 ± 0.75	9.86 ± 1.29 a	13.34 ± 1.82 b	8.82 ± 0.67 a	11.95 ± 1.37 a	13.27 ± 0.99 a	8.61 ± 0.21 b	9.88 ± 0.48 a	13.54 ± 1.26 b	10.97 ± 0.47 a
MUFA	3.76 ± 0.28	3.43 ± 0.47 a	8.01 ± 0.42 b	3.93 ± 0.11 a	3.62 ± 0.04 a	11.46 ± 0.44 b	4.85 ± 0.38 c	3.83 ± 0.46 a	9.32 ± 0.99 b	4.96 ± 0.46 a
PUFA	7.04 ± 0.02	14.80 ± 0.66 a	12.63 ± 0.42 b	11.09 ± 0.20 c	12.23 ± 0.19 a	17.99 ± 0.61 b	16.59 ± 1.91 b	11.33 ± 0.26 a	18.28 ± 1.02 b	13.55 ± 2.00 a
TFA	18.34 ± 1.02	28.09 ± 2.42 a	33.99 ± 2.66 b	23.84 ± 0.98 a	27.81 ± 1.60 a	42.72 ± 2.05 b	30.05 ± 2.50 a	25.04 ± 0.24 a	41.13 ± 3.27 b	29.48 ± 2.75 a

SFA: total saturated FA; MUFA: total monounsaturated FA; PUFA: total polyunsaturated FA (double bonds ≥ 2); TFA: total FA.

). The contents of nearly all types of FA increased to varying degrees in the three trials when compared to those of the initial sample. In particular, the content of total fatty acids (TFA) in the initial sample was 18.34 ± 1.02 µg·mg⁻¹. However, in the samples fed with Chlorella sp., C. calcitrans, and I. galbana, TFA fluctuated from ~25.04 to 28.09 µg·mg⁻¹, ~33.99 to 42.72 µg·mg⁻¹, and ~23.84 to 30.05 µg·mg⁻¹, respectively. Furthermore, the FA composition was primarily characterized by a predominance of polyunsaturated fatty acids (PUFA) of ~7.04–18.28 µg·mg⁻¹, followed by saturated fatty acids (SFA) of ~7.53–13.54 µg·mg⁻¹. Monounsaturated fatty acids (MUFA) were present at lower levels, ranging from ~3.43 to 11.46 µg·mg⁻¹.

In terms of PUFA, the dominant FA was DHA (~1.38–5.64 µg·mg⁻¹), followed by EPA (~0.74–6.22 µg·mg⁻¹), LA (~0.14–2.39 µg·mg⁻¹), ALA (~0.40–2.29 µg·mg⁻¹), 20:2n-6 (~0.44–1.86 µg·mg⁻¹), and ARA (~0.77–1.81 µg·mg⁻¹). The remaining PUFA were all below 1.32 ± 0.25 µg·mg⁻¹. Among MUFA, the primary component was 16:1n-7 (~0.55–4.16 µg·mg⁻¹), followed by 18:1n-7 (~0.37–3.59 µg·mg⁻¹), 18:1n-9 (~0.58–2.13 µg·mg⁻¹), 20:1n-9 (~0.54–1.62 µg·mg⁻¹), and 20:1n-7 (~0.14–1.59 µg·mg⁻¹). SFA were represented by 16:0 (~4.28–7.90 µg·mg⁻¹), 18:0 (~2.47–4.29 µg·mg⁻¹), and 14:0 (~0.22–2.01 µg·mg⁻¹).

Regarding DHA, it increased from the initial level of 1.38 ± 0.10 µg·mg⁻¹ to 4.45 ± 0.73 µg·mg⁻¹ and 4.78 ± 0.01 µg·mg⁻¹ in samples fed with Chlorella sp. after 8 and 16 d, respectively, but returned to the initial level at 1.86 ± 0.21 µg·mg⁻¹ after 24 d (Table 3). Similarly, samples fed with I. galbana showed an increase in DHA, reaching 3.61 ± 0.11 µg·mg⁻¹ and 5.64 ± 1.03 µg·mg⁻¹ after 8 and 16 d, respectively, followed by a slight decrease to 3.43 ± 0.70 µg·mg⁻¹ after 24 d. Conversely, samples fed with C. calcitrans exhibited a moderate increase in DHA, reaching 2.70 ± 0.12 µg·mg⁻¹ after 8 d and a more pronounced increase to 4.50 ± 0.58 µg·mg⁻¹ after 16 d, maintained at 4.88 ± 1.00 µg·mg⁻¹ after 24 d. As for EPA (Table 3), it started at 1.30 ± 0.03 µg·mg⁻¹ and notably decreased in samples fed with Chlorella sp. over the course of culture, reaching 1.40 ± 0.22 µg·mg⁻¹, 1.08 ± 0.11 µg·mg⁻¹, and 1.10 ± 0.08 µg·mg⁻¹ on the 8th, 16th, and 24th d, respectively. Similarly, EPA content decreased considerably in samples fed with I. galbana, with levels of 0.76 ± 0.10 µg·mg⁻¹, 0.84 ± 0.13 µg·mg⁻¹, and 0.74 ± 0.22 µg·mg⁻¹ on the 8th, 16th, and 24th d, respectively. Conversely, samples fed with C. calcitrans showed a significant increase in EPA, reaching 4.15 ± 0.32 µg·mg⁻¹, 6.04 ± 0.36 µg·mg⁻¹, and 6.22 ± 0.18 µg·mg⁻¹ on the 8th, 16th, and 24th d, respectively. When it comes to ARA (Table 3), which began at 1.32 ± 0.05 µg·mg⁻¹, it initially increased and then decreased in samples fed with Chlorella sp. (~0.84–1.81 µg·mg⁻¹), consistently increased in samples fed with C. calcitrans (~1.58–1.71 µg·mg-1) and decreased in samples fed with I. galbana (~0.77–0.87 µg·mg⁻¹). For LA and ALA (Table 3), their initial levels were 0.14 ± 0.06 µg·mg⁻¹ and 0.40 ± 0.07 µg·mg⁻¹, respectively. In samples fed with Chlorella sp., they showed a notable increase after 8 d (1.57 ± 0.09 µg·mg⁻¹ and 1.05 ± 0.02 µg·mg⁻¹, respectively) and 24 d (2.39 ± 0.17 µg·mg⁻¹ and 1.45 ± 0.12 µg·mg⁻¹, respectively) but exhibited relatively lower levels after 16 d (0.38 ± 0.13 µg·mg⁻¹ and 0.78 ± 0.04 µg·mg⁻¹, respectively). Samples fed with C. calcitrans showed less pronounced changes in LA and ALA, ranging from ~0.19 to 0.79 µg·mg⁻¹. In contrast, samples fed with I. galbana showed a remarkable increase in both LA and ALA, with LA levels ranging from ~0.44 to 1.29 µg·mg⁻¹ and ALA levels ranging from ~1.71 to 2.29 µg·mg⁻¹.

3.5. FA Composition in Visceral Mass of Juvenile S. constricta

A total of 24 FA was identified in the visceral mass of juvenile S. constricta (

Table 4. FA composition (µg·mg⁻¹) in the visceral mass of juvenile S. constricta before and after experiment. Values (mean ± SD, n = 3) within the same sampling time sharing a common superscript are not significantly different (p ≥ 0.05).

FA	Initial	Final
		Chlorella sp.	C. calcitrans	I. galbana
14:0	1.69 ± 0.20	3.00 ± 0.55 a	35.52 ± 1.25 b	30.58 ± 3.87 b
16:0	6.31 ± 0.25	19.89 ± 0.75 a	37.32 ± 1.44 b	42.21 ± 3.27 b
18:0	4.45 ± 0.17	9.75 ± 0.45 a	9.74 ± 1.06 a	8.41 ± 0.86 a
16:1n-7	1.45 ± 0.09	1.52 ± 0.60 a	52.25 ± 4.25 b	20.16 ± 1.07 c
18:1n-9	0.46 ± 0.11	4.30 ± 0.43 a	2.85 ± 0.37 b	31.19 ± 0.67 c
18:1n-7	1.13 ± 0.10	1.81 ± 0.07 a	27.19 ± 0.14 b	12.76 ± 1.29 c
20:1n-9	1.22 ± 0.01	2.59 ± 0.22 a	3.79 ± 0.43 b	1.93 ± 0.25 a
20:1n-7	0.80 ± 0.00	1.06 ± 0.19 a	7.45 ± 0.20 b	1.05 ±0.25 a
18:2n-6	-	5.62 ± 0.19 a	4.20 ± 0.28 b	26.03 ± 0.68 c
18:3n-6	-	- a	2.86 ± 0.01 b	3.60 ± 0.21 c
20:2n-6	0.82 ± 0.02	4.52 ± 1.08 a	3.50 ± 0.25 a	16.17 ± 1.73 b
20:4n-6	1.42 ± 0.30	3.23 ± 0.39 a	6.02 ± 0.56 b	2.33 ± 0.01 a
22:4n-6	0.42 ± 0.12	0.34 ± 0.16 a	- a	1.08 ± 0.24 b
22:5n-6	0.54 ± 0.04	1.82 ± 0.06 a	- b	11.33 ± 0.74 c
16:3n-3	-	- a	8.01 ± 0.10 b	- a
18:2n-3	-	0.58 ± 0.20 a	3.73 ± 0.24 b	- c
18:3n-3	0.67 ± 0.10	6.48 ± 1.28 a	4.42 ± 0.23 b	47.09 ± 0.03 c
18:4n-3	-	0.22 ± 0.13 a	- a	42.43 ± 0.48 b
20:4n-3	-	- a	- a	6.69 ± 0.43 b
20:5n-3	2.68 ± 0.10	4.20 ± 0.23 a	45.50 ± 1.62 b	7.78 ± 0.00 c
22:5n-3	0.70 ± 0.13	1.74 ± 0.14 a	2.80 ± 0.25 b	1.26 ± 0.07 c
22:6n-3	1.80 ± 0.34	15.86 ± 0.51 a	14.58 ± 0.20 a	73.49 ± 2.40 b
20:3n-7	-	- a	- a	3.63 ± 0.51 b
22:2(5,13)	0.29 ± 0.02	0.86 ± 0.12 a	2.32 ± 0.21 b	2.43 ± 0.56 b
SFA	12.45 ± 0.28	32.65 ± 0.65 a	82.58 ± 3.75 b	81.19 ± 8.00 b
MUFA	5.06 ± 0.11	11.28 ± 1.52 a	93.53 ± 5.39 b	67.09 ± 3.54 c
PUFA	9.35 ± 0.39	45.47 ± 3.53 a	97.95 ± 3.93 b	245.33 ± 1.07 c
TFA	26.87 ± 0.22	89.39 ± 4.39 a	274.07 ± 13.07 b	393.61 ± 12.61 c

SFA: total saturated FA; MUFA: total monounsaturated FA; PUFA: total polyunsaturated FA (double bonds ≥ 2); TFA: total FA; “-”: not detected.

), three more than the 21 FA mentioned above, including 16:3n-3, 18:3n-6, and 20:3n-7. The content of TFA was the lowest in the initial sample at 26.87 ± 0.22 µg·mg⁻¹, but increased significantly in samples of juveniles fed with Chlorella sp. (89.39 ± 4.39 µg·mg⁻¹) and was even more abundant in samples of juveniles fed with C. calcitrans and I. galbana (274.07 ± 13.07 µg·mg⁻¹ and 393.61 ± 12.61 µg·mg⁻¹, respectively). The content of PUFA was 9.35 ± 0.39 µg·mg⁻¹ in the initial sample and increased to 45.47 ± 3.53 µg·mg⁻¹, 97.95 ± 3.93 µg·mg⁻¹, and 245.33 ± 1.07 µg·mg⁻¹ in samples of juveniles fed with Chlorella sp., C. calcitrans, and I. galbana, respectively. MUFA content was notably higher in samples of juveniles fed with C. calcitrans at 95.53 ± 5.39 µg·mg⁻¹, while in other samples, it remained below 67.09 ± 3.54 µg·mg⁻¹. The content of SFA was particularly low in the initial sample at 12.45 ± 0.28 µg·mg⁻¹, with other samples ranging from ~32.65 to 82.56 µg·mg⁻¹.

Specifically, when fed with Chlorella sp., the dominant FA were 16:0 (19.89 ± 0.75 µg·mg⁻¹), DHA (15.86 ± 0.51 µg·mg⁻¹), 18:0 (9.75 ± 0.45 µg·mg⁻¹), ALA (6.48 ± 1.28 µg·mg⁻¹), and LA (5.62 ± 0.19 µg·mg⁻¹). The other FA had a content of less than 4.52 ± 1.08 µg·mg⁻¹. When fed with C. calcitrans, the dominant FA were 16:1n-7 (52.25 ± 4.25 µg·mg⁻¹), EPA (45.50 ± 1.62 µg·mg⁻¹), 16:0 (37.32 ± 1.44 µg·mg⁻¹), 14:0 (35.52 ± 1.25 µg·mg⁻¹), 18:1n-7 (27.19 ± 0.14 µg·mg⁻¹), and DHA (14.58 ± 0.20 µg·mg⁻¹). The other FA had a content of less than 9.74 ± 1.06 µg·mg⁻¹. When fed with I. galbana, the dominant FA were DHA (73.49 ± 2.40 µg·mg⁻¹), ALA (47.09 ± 0.03 µg·mg⁻¹), 18:4n-3 (42.43 ± 0.48 µg·mg⁻¹), 16:0 (42.21 ± 3.27 µg·mg⁻¹), 18:1n-9 (31.19 ± 0.67 µg·mg⁻¹), 14:0 (30.58 ± 3.87 µg·mg⁻¹), LA (26.03 ± 0.68 µg·mg⁻¹), and 16:1n-7 (20.16 ± 1.07 µg·mg⁻¹). The other FA had a content of less than 16.17 ± 1.73 µg·mg⁻¹.

More specifically, a remarkably high level of DHA was found in the sample of juveniles fed with I. galbana (73.49 ± 2.40 µg·mg⁻¹), while that in the other samples was less than 15.86 ± 0.51 µg·mg⁻¹. By contrast, a significantly high level of EPA was detected in the sample of juveniles fed with C. calcitrans (45.50 ± 1.62 µg·mg⁻¹), while that in the other samples was less than 7.78 ± 0.00 µg·mg⁻¹. Moreover, the level of ARA was also significantly higher in the sample of juveniles fed with C. calcitrans (6.02 ± 0.56 µg·mg⁻¹), while that in the other samples was less than 3.23 ± 0.39 µg·mg⁻¹. In addition, LA and ALA levels were detected particularly high in the sample fed with I. galbana at 26.03 ± 0.68 µg·mg⁻¹ and 47.09 ± 0.03 µg·mg⁻¹, respectively, while they were less than 6.48 ± 1.28 µg·mg⁻¹ in the other samples. Furthermore, a significantly higher level of 18:1n-9 (31.39 ± 0.67 µg·mg⁻¹) was found in the sample fed with I. galbana. Meanwhile, the contents of 16:1n-7 (52.25 ± 4.25 µg·mg⁻¹), 18:1n-7 (27.19 ± 0.14 µg·mg⁻¹), and 20:1n-7 (7.45 ± 0.20 µg·mg⁻¹) were significantly higher in the sample fed with C. calcitrans than those in the other samples (less than 20.16 ± 1.07 µg·mg⁻¹, 12.76 ± 1.29 µg·mg⁻¹, and 1.06 ± 0.19 µg·mg⁻¹, respectively). Moreover, 16:3n-3 (8.01 ± 0.10 µg·mg⁻¹) was only detected in the sample of juveniles fed with C. calcitrans, while 20:3n-7 (3.63 ± 0.51 µg·mg⁻¹) and 20:4n-3 (6.69 ± 0.43 µg·mg⁻¹) were only identified in the sample of juveniles fed with I. galbana.

4. Discussion

4.1. Dietary LC-PUFA Composition Significantly Affects S. constricta Growth

In the present study, the growth of juvenile S. constricta fed with Chlorella sp. was significantly lower than those fed with C. calcitrans or I. galbana. However, there was no significant difference in the growth of juveniles fed with C. calcitrans and I. galbana (Figure 1). Similar results have been observed in larval S. constricta [27] and other marine mollusks, such as Tegillarca granosa [18] and Ostrea edulis [29]. The differences in the effects of the three microalgae on feeding might be mainly due to their different LC-PUFA compositions (Table 1), which are critical for the development of marine mollusks [30]. However, it is worth noting that other factors, such as size, other nutrients apart from FA, and the energetic content of the three microalgae, might also have a significant impact on the feeding rate and digestive capability of S. constricta, therefore affecting the growth of this bivalve. Further studies are needed to investigate the possible effects of these factors.

4.2. Fad and Elovl Expressions of S. constricta Are Regulated by Dietary LC-PUFA

Interestingly, the expressions of almost all Fad and Elovl in the samples of juveniles fed with Chlorella sp. decreased significantly with an increase in culture days compared to the initial sample. In contrast, the expressions in the samples of juveniles fed with C. calcitrans increased significantly on the 8th and 16th d and then decreased significantly on the 24th d, whereas those in the samples of juveniles fed with I. galbana increased significantly on the 8th d and then decreased significantly with subsequent culture days (Figure 2). Moreover, the expressions of almost all Fad and Elovl genes in the samples of juveniles fed with Chlorella sp. were significantly higher than those in the samples of juveniles fed with C. calcitrans or I. galbana on the 24th d. These results were unexpected, because, logically, throughout the experiment, especially in the early stages, the expressions of Fad and Elovl should have been highest in the sample fed with Chlorella sp., which is rich in LC-PUFA precursors like LA and ALA but lacks LC-PUFA (Table 1). Further studies are necessary to understand the reasons behind this unexpected pattern of gene expression.

This phenomenon can be attributed to several factors. First, it is well known that marine mollusks tend to accumulate LC-PUFA in their tissues as reserves. Thus, S. constricta fed with C. calcitrans and I. galbana may also need to synthesize LC-PUFA for their rapid growth. Over time, the group fed with I. galbana gradually accumulated enough LC-PUFA, especially DHA directly from I. galbana, leading to the down-regulation of these genes by the 16th d. On the other hand, the group fed with C. calcitrans (rich in EPA but with trace amounts of DHA) still required intensive LC-PUFA synthesis, showing relatively higher expressions of Fad and Elovl. By the 24th day, both groups fed with I. galbana and C. calcitrans had accumulated sufficient LC-PUFA, resulting in significantly lower expressions of Fad and Elovl compared to the group fed with Chlorella sp. Second, S. constricta might have a high capacity to biosynthesize DHA, which explains the similar DHA content in tissues fed with Chlorella sp. compared to the other two microalgal diets (Table 3). This suggests that DHA is crucial for S. constricta development, so similar DHA content was maintained across the three groups, despite Chlorella sp. lacking LC-PUFA. This pattern has been observed in various marine mollusks, such as Mytilus galloprovincialis [17] and Venerupis pullastra [14]. However, since DHA synthesis is energetically expensive, obtaining dietary DHA through I. galbana or C. calcitrans would be more efficient than via Chlorella sp. This difference could significantly affect the energy allocation to S. constricta growth. Thirdly, our analysis of Fad and Elovl expressions was conducted on the 8th, 16th, and 24th d after a prolonged culture period. Other nutrients of the three microalgae might also play a role in gene expressions, which requires further investigation. Additionally, conducting similar studies with shorter culture times could provide insights into the effects of microalgal FA on Fad and Elovl expressions in S. constricta. For instance, a study on Ruditapes philippinarum demonstrated that during a short 7 d period, I. gabana significantly inhibits Fad and Elovl expressions, while Chlorella sp. significantly stimulates these gene expressions [31]. Collectively, these unexpected effects of dietary FA on Fad and Elovl expressions in S. constricta can be better understood by considering these factors. Moreover, if the FA composition is the only variable in the diets, it is believed that the expressions of Fad and Elovl in S. constricta would align with those observed in other aquatic animals.

4.3. S. constricta Can Modulate FA Composition in Addition to Direct Accumulation

As shown in Table 3, there were significant differences in the FA composition of the muscular tissues among S. constricta fed with different microalgae, a trend also evident in the PLS-DA result (Figure 3A). Furthermore, the FA compositions in the muscular tissues of juvenile S. constricta (Table 3) closely mirrored those present in the respective dietary microalgae (Table 1), as indicated by the relatively high correlation coefficient in Figure 4. These observations align with previous studies on other marine mollusks [14,15,16,17,18,19], which also showed similar correlations between dietary microalgae and tissue FA compositions. To elaborate the results of the present study further, it was observed that when fed with Chlorella sp. (which is richest in LA but lacks 14:0), the samples displayed the highest levels of LA except for on the 16th d and the lowest levels of 14:0 on all sampling days. When fed with C. calcitrans (abundant in 16:1n-7 and EPA but lacking ALA), the samples exhibited the highest levels of 16:1n-7 and EPA, while maintaining the lowest levels of ALA across all sampling days. Finally, when fed with I. galbana (which is richest in 18:1n-9, 18:4n-3, and DHA), the samples consistently showed relatively higher levels of 18:1n-9, 18:4n-3, and DHA on all sampling days. Those results underscore the tendency of marine mollusks to accumulate FA directly from their diets. Therefore, maintaining an appropriate FA composition in the diet, especially LC-PUFA, is critical for optimizing the growth of marine mollusks.

However, the result also suggested that juvenile S. constricta possesses a certain ability to modulate the FA composition through selective accumulation and endogenous synthesis (Table 3). For example, despite Chlorella sp. containing relatively high levels of 20:0, 16:2n-6, and 16:3n-4 (Table 1), these FA were not detected in the samples of juveniles fed with Chlorella sp., suggesting their negligible impact on S. constricta development. Moreover, the juveniles fed with Chlorella sp. accumulated a relatively higher level of 18:0, which might compensate for the absence of 14:0 in their diet. Furthermore, even though Chlorella sp. lacks LC-PUFA, the samples of juveniles fed with Chlorella sp. displayed relatively higher levels of ARA, 22:5n-3, EPA, and DHA (Table 3), indicating that S. constricta has the capacity for significant endogenous LC-PUFA biosynthesis. When fed with C. calcitrans, the juveniles exhibited the highest levels of 18:1n-7 and 20:1n-7, which might result from the abundant precursor, 16:1n-7, in their diet. Additionally, the juveniles fed with C. calcitrans accumulated the highest levels of 20:4n-3, likely because its product, EPA, was obtained in sufficient quantities directly from diets. Notably, despite the significantly lower DHA levels in the juveniles fed with C. calcitrans compared to those fed with I. galbana (except for on the 24th d), no significant differences were observed in their growth (Figure 1). This suggests that EPA may effectively compensate for the physiological functions typically attributed to DHA. Although I. galbana contains a notably high level of 18:4n-3 (50.35 ± 6.01 µg·mg⁻¹), its concentration in the juveniles fed with I. galbana was very low (~0.16–0.54 µg·mg⁻¹), implying a minor role of 18:4n-3 in S. constricta physiology. In contrast, although ARA was exclusively detected in C. calcitrans (2.49 ± 0.47 µg·mg⁻¹, Table 1), it was present at relatively high levels in all samples (~0.77–1.81 µg·mg⁻¹, Table 3), highlighting a potential essential role for ARA in S. constricta development.

4.4. Selective Retention and Incorporation of FA Exist in S. constricta

Likewise, the FA composition in the visceral mass (Table 4) also clearly mirrors that of the dietary microalgae (Table 1, Figure 4). Nevertheless, some FA found in microalgae were absent in both the visceral mass and the muscular tissues. This includes FA like 20:0, 16:2n-6, and 16:3n-4, which have relatively high levels in Chlorella sp. at 5.23 ± 0.19 µg·mg⁻¹, 4.92 ± 0.09 µg·mg⁻¹, and 11.12 ± 1.50 µg·mg⁻¹, respectively (Table 1). Conversely, some FA were exclusively detected in the visceral mass but not in the muscular tissues, such as 16:3n-3, 18:3n-6, and 20:3n-7. These findings indicate that the dietary FA is selectively retained by S. constricta and further incorporated into its tissues. Additionally, some FA were uniquely detected in the farmed juveniles but not in the dietary microalgae. These include FA like 18:2n-3, 20:1n-7, 20:2n-6, 22:2(5,13), 22:4n-6, and 22:5n-3. These FAs may be synthesized as intermediate precursors of LC-PUFA or play specific physiological roles in S. constricta. The variations in FA composition between S. constricta and the dietary microalgae may be attributed to species-specific factors, suggesting that certain FA may be necessary for one species but not for another.

5. Conclusions

In summary, this study highlights the critical role of dietary FA composition in the development of S. constricta, directly impacting the FA composition of this bivalve. Additionally, the findings demonstrated the ability of S. constricta to regulate its FA composition through the significant modulation of Fad and Elovl expressions. Overall, the combination of Fad and Elovl expressions data with changes in FA composition provides valuable insights into the metabolism of the dietary FA in S. constricta. These results hold significance for the selection of appropriate dietary microalgae and the formulation of artificial feeds in the farming industry of this bivalve species.