Molecular Characterization and Antibacterial Potential of Goose-Type Lysozyme from Japanese Pufferfish (Takifugu rubripes)

Abstract

Lysozyme plays a crucial role in the innate immune response against bacterial phagocytosis by hydrolyzing the peptidoglycan layer of the bacterial cell wall. In this study, we characterized a goose-type lysozyme gene (TrLysG) in Japanese pufferfish. It is made up of an ORF of 573 bp that encodes a polypeptide of 190 amino acids. TrLysG includes a characteristic bacterial soluble lytic transglycosylase (SLT) domain, which contains three catalytic residues (Glu⁷¹, Asp⁸⁴ and Asp⁹⁵) and a highly conserved GLMQ motif (Gly⁹⁰, Leu⁹¹, Met⁹² and Gln⁹³). Phylogenetic analyses revealed that TrLysG is clustered together with its counterparts from other teleost fishes. Furthermore, mRNA expression analyses showed that TrLysG was highly expressed in healthy mucosal tissues (intestines and gills), and considerably up-regulated in response to Vibrio harveyi infection in the intestines, gills, and liver. At pH 6 and 55 °C, the pure recombinant TrLysG (rTrLysG) exhibits optimum activity. It also displayed antimicrobial activity against three Gram-positive bacteria (Streptococcus parauberis, Staphylococcus pasteuri and Staphylococcus epidermidis) as well as five Gram-negative bacteria (Shewanella, Aeromonas hydrophila, Escherichia coli, Vibrio parahaemolyticus and V. harveyi). Our results highlighted the significant role of TrLysG in immune defense against invading pathogens, thereby contributing to the prevention and alleviation of disease spread in aquaculture.

1. Introduction

The innate immune defense system of aquatic organisms is the first line of defense against invading pathogens [1,2], where lysozymes are key components due to their antibacterial activity. They catalyze the hydrolysis of the β-(1,4)-glycosidic linkage between the N-acetylmuramic acid (NAM) and N-acetyl-glucosamine (NAG) in bacterial peptidoglycan, leading to bacterial cell lysis [3,4]. Aside from their antibacterial properties, lysozymes also play significant roles in digestion, growth stimulation, anti-inflammatory responses, anti-tumor mechanisms, and even antiviral activities [5,6]. Numerous studies have demonstrated that lysozyme is a ubiquitous enzyme that is widely available in diverse organisms. It has been divided into six categories based on biochemical and structural characteristics [7]. Goose-type lysozyme (LysG) was initially identified in the egg whites of Embden goose [8], and subsequent studies found it in mammals [9], amphibians [10], fish [4,11], and more recently in invertebrates such as abalone [12] and scallop [1]. Among fish species, the first LysG was found in Paralichthys olivaceus [13], and it has since been isolated from a variety of fish species, such as Chinese black sleeper (Bostrychus sinensis) [14] and roughskin sculpin (Trachidermus fasciatus) [15]. These fish lysozymes were known to be induced by bacteria, viruses, and viral mimic poly (I:C) [16,17,18,19], while recombinant proteins showed antimicrobial activity against both Gram-positive and Gram-negative bacteria [13,17,20,21,22,23]. These findings suggested that LysG plays a key role in teleostean fish innate immunity.

Japanese pufferfish (Takifugu rubripes), a highly valued fish in marine aquaculture, is renowned for its delicate meat quality, delicious taste, and rich nutritional content [24]. Production of Japanese pufferfish has increased rapidly with the gradual expansion of its aquaculture. Meanwhile, as a teleost model species, studies have been carried out on Japanese pufferfish in various aspects, including nutrition [25], aquaculture [26,27,28], reproductive biology [29,30], responses to stress [31,32,33], tetrodotoxin [34], intestinal flora [35], growth trait [36], genome assembly [37], breeding [38], innate immunity [39,40,41], and so on. However, as the scale and density of Japanese pufferfish farming continue to expand, the prevalence of fish illnesses grows, leading to significant economic losses [42]. Previous studies have explored immune-related genes in Japanese pufferfish, such as neuromedin U [43], caspases [40], galectins [41], interleukin [44], and T-cell receptor [45]. Nevertheless, no investigation has been conducted on TrLysG and its corresponding protein product.

In this study, the physicochemical properties, phylogenetic analysis, and molecular characteristics of TrLysG were investigated. Additionally, mRNA expression patterns were examined in healthy tissues as well as in the intestines, gills, and liver following V. harveyi infection. Furthermore, we evaluated the antibacterial activity of rTrLysG and explored its optimal pH and temperature conditions. The findings add to our understanding of the antibacterial function of rTrLysG in the innate immune system of Japanese pufferfish. Furthermore, in aquaculture, the use of fish lysozyme could reduce the need for antibiotics, lower the risks of environmental pollution and promote sustainable aquaculture.

2. Materials and Methods

2.1. Sequence Analysis

The TrLysG sequence was taken from the NCBI database (Accession number: NM_001032592) [46]. The molecular weight (MW) and isoelectric point (pI) were predicted using ExPASy [47]. To predict protein signal peptides, the online SignalP 4.0 program was applied to evaluate the inferred amino acid sequence [48]. SMART 6.0 was used to predict functional domains [49]. The determined amino acid sequence of TrLysG was uploaded to the SWISS-MODEL protein fold server for protein structure homology modeling [50]. To align multiple sequences, ESPript 3.0 software was utilized [51].

2.2. Phylogenetic Analysis

The NCBI database was consulted to obtain LysG amino acid sequences from various creatures in order to examine the evolutionary connection of TrLysG, including Mus musculus, Gallus gallus, Sceloporus undulates, Ictalurus furcatus, Takifugu flavidus, Tetraodon nigroviriais, Homo sapiens, Danio rerio, Salmo salar, Acanthochromis polyacanthus, Kryptolebias marmoratus, Astyanax mexicanus, Oncorhynchus mykiss, Bos taurus, Sinocyclocheilus grahami and Pygocentrus nattereri. Phylogenetic analysis was conducted using the maximum likelihood method with 1000 bootstraps in MEGA X (version 10.1.6) software [52].

2.3. Healthy Tissue Collection

The T. rubripes fingerlings, weighing in 190.34 ± 2.13 g and measuring 15.19 ± 0.32 cm in length, were acquired from the Tianzheng Corp (Dalian, China). The fish were kept in good condition and free of illness. Before the testing, the fish were allowed to acclimatize to the lab environment for two weeks. Water temperature and salinity were maintained at 16 °C and 29 ppt, respectively. Before sampling, fish were sedated with MS-222-dissolved seawater. The expression profiles were detected in nine tissues, including the skin, brain, kidney, muscles, intestines, heart, gills, liver, and spleen. The samples were flash-frozen in liquid nitrogen and stored at −80 °C.

2.4. Bacterial Infection and Sample Collection

V. harveyi challenge was performed to assess TrLysG response to bacterial infection of the host. The Dalian Key Laboratory of Marine Animal Disease Control and Prevention provided V. harveyi strain. The bacterial growth and challenge tests were performed as previously described [41,53]. Briefly, following thawing at room temperature, 1 mL of the bacterial solution was inoculated into a conical flask with 50 mL of 2216E liquid medium and incubated at 30 °C. After 24 h incubation (the concentration of OD_600nm = 1.1), V. harveyi was resuspended in PBS buffer. The resulting bacterial suspension was diluted to approximately 1 × 10⁷ CFU/mL. Each experimental fish received 0.1 mL of V. harveyi via intraperitoneal injection as the challenge experiment. The control group was administered an equivalent volume of phosphate-buffered saline. At 12, 24, and 48 h following the challenge, tissues from the intestine, gills, and liver were obtained in three biological duplicates for the treatment and control groups. The samples were flash-frozen in liquid nitrogen and then stored at −80 °C until extraction of RNA.

2.5. RNA Extraction and cDNA Synthesis

Following the manufacturer’s instructions, total RNA was obtained using an RNAprep Pure Tissue Kit (TIANGEN, Beijing, China). RNA was quantified for purity and concentration using NV3000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The A260/280 ratio of every extracted RNA sample was between 1.8 and 2.1, and the concentration was more than 150 g/mL. First-strand cDNA was synthesized using a FastKing gDNA Dispelling RT SuperMix reagent Kit (TIANGEN, Beijing, China) following instructions (1 μg of RNA per 20 μL reaction).

2.6. Expression Analysis via qRT-PCR

qRT-PCR was performed using Talent qPCR PreMix (SYBR Green) reagent Kit (TIANGEN, Beijing, China) on a LightCycler^®96 Real-Time PCR System (Roche, Bâle, Swiss). Particular primers were created using the Primer Premier 5 (

Table 1. Sequences for primers used in the present study.

Primers	Sequence (5′-3′)
TrLysG-F	ATCCTGGTTGAGTTTATC
TrLysG-R	AGTAGTCCTTCCCTGTTG
β-actin-F	ATCCGTAAGGACCTGTATGC
β-actin-R	AGTATTTACGCTCAGGTGGG

). Sangon Biotech (Shanghai, China) produced all primers. Three biological duplicate cDNA samples from control and treatment tissues were examined using Ct values obtained via qRT-PCR. The Ct value of TrLysG in muscle was utilized as a control group in healthy tissues, and β-actin was employed as a reference for normalization of the relative expression. For the examination of gene expression after bacterial infection, distinct time-point treatment groups were compared to their respective control groups. The 2^−ΔΔCt technique was utilized to calculate the relative expression fold change after the Ct values were generated based on qRT-PCR. A one-way ANOVA with Duncan test was conducted for statistical analysis, and p < 0.05 values were regarded as statistically significant.

2.7. Expression and Purification of rTrLysG

Mingyan Biological Technology Company (Nanjing, China) synthesized the TrLysG sequence, which was codon-optimized for E. coli. The generated DNA fragment was digested using the restriction enzymes NdeI and HindIII (TaKaRa, Beijing, China ), ligated into the pET-30a (+) expression vector (Novagen, Beijing, China), linearized with the same enzymes, and transformed into competent E. coli DH5 cells (TaKaRa). Sequencing validated the recombinant pET-30a (+)-TrLysG plasmids, which were then transformed into E. coli BL21 (DE3). Single colonies were inoculated into LB medium with 50 g/mL of kanamycin sulfate and incubated at 37 °C until the OD_600nm reached 0.6–0.8. IPTG at a final concentration of 0.2 mM was used to stimulate E. coli cells for 16 h at 15 °C. The cells were harvested via centrifugation at 13,400× g for 5 min at 4 °C, and resuspended in BugBuster^® lysis buffer (Novagen). After sonicating and centrifuging the suspended cells, the amount of rTrLysG expression in the supernatant was determined using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, Nanjing, China) stained with Coomassie brilliant blue. The rTrLysG protein was purified using a Novagen Ni-IDA column. SDS-PAGE and the Bradford technique were used to determine the purity and concentration of the fusion protein.

2.8. Effect of pH and Temperature on Dissociate Activity of rTrLysG

The optimal pH and temperature for the solubility of rTrLysG were evaluated via the turbidimetric method as reported previously [54]. Streptococcus pasteuri was used as a substrate for rTrLysG. S. pasteuri was cultured overnight at 30 °C in 2216E liquid medium, centrifuged and resuspended in 0.05 M phosphate buffer with pHs ranging from 4.5 to 8.5 (at intervals of 0.5) to an optical density of OD_600nm = 0.2. A matrix suspension (100 μL) with different pH was mixed with 50 μL of rTrLysG (400 μg/mL), and the spectrophotometer was used to measure the OD_600nm value (A0). The compound was incubated at 37 °C for 2 h, and then transferred to an ice water bath to stop the reaction immediately. The OD_600nm value (A) was tested again. The combination with a fixed pH of 7 was incubated in a water bath at temperatures ranging from 15 to 65 °C (at intervals of 10 °C) for 2 h to determine the optimal temperature. The OD_600nm was measured before and after incubation (A0 and A, respectively). The enzyme activity (UL) was determined using the following formula: UL = (A0 − A)/A. Measurements were taken in triplicate.

2.9. Antibacterial Activity of rTrLysG by Minimal Inhibitory Concentration

The antibacterial activity of rTrLysG protein was exhibited using a minimal inhibitory concentration (MIC) test against three strains of Gram-positive and five strains of Gram-negative bacteria obtained from Yantai Marine Economic Research Institute and the Dalian Key Laboratory of Marine Animal Disease Control and Prevention. The MIC test procedure was carried out following previous research [55]. Briefly, Gram-negative bacteria including Shewanella, A. hydrophila, E. coli, V. parahaemolyticus and V. harveyi and Gram-positive bacteria including S. parauberis, S. pasteuri and S. epidermidis were cultured in medium to the exponential growth phase, and then adjusted to a final concentration of OD_600nm = 0.3. In sterile 96-well plates (Corning, USA), 40µL bacteria and a 40 µL rTrLysG mixture were suspended. The final concentration of recombinant protein in the medium ranged from 0.2 mg/mL to 6.25 × 10⁻³ mg/mL (the difference between each dilution is two times). As a negative control, the same medium concentrations were applied. The mixes were then cultured for 6 to 8 h at the strain’s ideal temperature before being quantified at absorbance 600 nm with a precision micro-plate reader. All tests were carried out in triplicate.

3. Results

3.1. Sequence Analysis of TrLysG

TrLysG is composed of a 573 bp ORF encoding 190 amino acids; its molecular mass is predicted to be 20.87 kDa, with an isoelectric point of 5.96. Analysis using SMART 6.0 software revealed that TrLysG contains a transglycosylase SLT domain spanning from Thr⁴⁸ to Ser¹⁷⁴. Multiple-sequence alignment displayed three catalytic residues (Glu⁷¹, Asp⁸⁴, and Asp⁹⁵), along with a highly conserved GLMQ motif (Gly⁹⁰, Leu⁹¹, Met⁹², and Gln⁹³) (Figure 1). This conserved GLMQ motif lies between the catalytic residues in the active site cleft. Furthermore, the predicted 3D structure of TrLysG features five α-helices depicted in yellow and three β-sheets shown in red, connected by coils (Figure 2). The three catalytic residues are located on the α-helix (Glu⁷¹) and the coiled coil (Asp⁸⁴ and Asp⁹⁵), respectively.

3.2. Phylogenetic Analysis

To understand the relationship between TrLysG and other species in terms of phylogeny, a phylogenetic tree was constructed. The tree is well clustered into four distinct groups, which consist of teleostean, reptilian, avian, and mammalian branches (Figure 3). The teleostean clade of the amino acid tree contains all fish species. TrLysG is classified into the teleost group and has the closest relationship with the T. flavidus counterpart.

3.3. Expression Analysis of TrLysG in Healthy Tissues

TrLysG expression was measured via qRT-PCR in nine healthy tissues. The results revealed that TrLysG exhibited widespread expression across all examined tissues. Specifically, as shown in Figure 4, the intestines and gills demonstrated significantly higher expression of TrLysG compared to other tissues (p < 0.05). On the contrary, the expression levels in remaining six tissues were relatively low, with no significant differences observed among them.

3.4. Temporal Expression Profiles of TrLysG post V. harveyi Injection

The expression pattern of TrLysG was characterized in specific tissues following bacterial infection to clarify its roles in immunity. The relative expression levels of TrLysG were examined in the gills, intestines, and liver after V. harveyi infection at 12, 24, and 48 h post infection (Figure 5). After intraperitoneal injection of V. harveyi, pathological changes were observed mainly at the site of bacterial injection, liquefaction and lesions were seen in the liver and injection region, and the liquefaction became serious over time. No significant morphological changes were seen in the gills or intestines within 48 h. In the intestine, the fold change of TrLysG reached a maximum of 6.6-fold at 24 h, and then declined to a relatively higher level (4-fold) compared to the control group. Furthermore, TrLysG expression in the gill was significantly up-regulated after infection, and reached its peak at 48 h. These results indicated that TrLysG exhibits a similar expression pattern in the intestine and gill. While in the liver, significant up-regulation was observed at all three-time points after V. harveyi infection, with the peak value appearing at 48 h by 5.8-fold compared to the control group.

3.5. Expression and Purification of rTrLysG

The recombinant protein of rTrLysG was successfully expressed in E. coli BL21 (DE3) after induction with 0.2 mM of IPTG at 15 °C for 16 h. SDS-PAGE with Coomassie brilliant blue staining revealed an approximately 21 kDa anticipated protein band of rTrLysG in protein extract supernatant. (Figure S2). After extracting soluble fusion protein from lysate supernatant, SDS-PAGE (Figure S3A) and Western blotting with anti-His tag antibody (Figure S3B) revealed a single band of pure rTrLysG protein. Finally, a total of 7.38 mg rTrLysG protein was obtained.

3.6. Lytic Activity of rTrLysG at Different pH and Temperature

Each fish species lysozyme has a distinct optimal activity at varying pH and temperature. To determine the lytic activity of rTrLysG, a turbidimetric assay was performed using S. pasteuri as the substrate, with temperature ranging from 15 to 65 °C (in intervals of 10 °C) and pH ranging from 4.5 to 8.5 (in intervals of 0.5). The results indicated that the highest lytic activity of rTrLysG occurred within the temperature range of 50–60 °C, with an optimum temperature of 55 °C (U_L = 0.48). The pH range suitable for rTrLysG activity was found to be between 5.5 and 6.5, with an optimum pH of 6 (U_L = 0.54) (Figure 6).

3.7. Antibacterial Activity of Recombinant Protein

The minimum inhibitory concentration (MIC) refers to the lowest concentration of an antimicrobial that visibly inhibits the growth of the bacteria [56]. It is a critical factor in assessing the antimicrobial activity of lysozyme against bacterial strains. In this study, the MICs of rTrLysG against Gram-negative and Gram-positive bacteria are presented in

Table 2. The minimum inhibitory concentration (MIC) of rTrLysG.

Bacteria	Types	MIC (μg/mL)
Streptococcus parauberis	Gram-positive	100
Staphylococcus pasteuri	Gram-positive	50
Staphylococcus epidermidis	Gram-positive	200
Shewanella	Gram-negative	200
Aeromonas hydrophila	Gram-negative	200
Escherichia coli	Gram-negative	200
Vibrio Parahaemolyticus	Gram-negative	200
Vibrio harveyi	Gram-negative	50

. The results showed that these ranged from 50 to 200 μg/mL. The MIC of rTrLysG against S. parauberis was observed to be 100 μg/mL, while the MIC of rTrLysG against S. pasteuri and V. harveyi was 50 μg/mL. These findings confirm that this synthetic protein inhibited the growth of both Gram-negative and Gram-positive bacteria.

4. Discussion

Lysozymes are found ubiquitously across various organisms such as animals, plants, fungi, bacteria, and bacteriophages [3]. They are an opsonin that stimulates the complement system and phagocytes. Furthermore, they are prevalent in the mucus, lymphoid tissue, plasma, and various body fluids across different fish species [2]. Our current study reported the identification of a goose-type lysozyme in Japanese pufferfish. It consists of 190 amino acids, with a calculated molecular mass of 20.87 kDa and a theoretical isoelectric point (pI) of 5.96. Most fish LysG have a similar molecular mass, like sea bass (Dicentrarchus labrax L.), grass carp (Ctenopharyngodon idellus), and rohu (Labeo rohita), ranging from 20.19 to 20.27 kDa [19,20,57]. The TrLysG was found to lack a signal peptide, suggesting its potential as an intracellular protein primarily engaged in defense mechanisms following pathogen invasion of the host cell [58]. Multiple-sequence alignment analysis of TrLysG showed that many amino acids are conserved from fish to mammals, and that it contains three important catalytic residues (Glu⁷¹, Asp⁸⁴ and Asp⁹⁵). The Glu⁷¹ and Asp⁸⁴ residues are conserved in all fish species and mammals except for Homo sapiens. The conserved GLMQ motif has been reported to enhance bacterial binding [59], and play a role in enzymatic reactions or the regulation of specialized lytic transglycosylase [60]. These residues are essential to the lysozyme’s three-dimensional structure and biological activity [14]. Furthermore, the number of cysteine residues in LysG exhibits significant variability. Research has shown that the formation of disulfide bonds by cysteine residues is essential for maintaining the structural stability of the LysG [61]. Avian and mammalian lysozyme sequences typically possess four cysteine residues, resulting in the formation of two disulfide bridges [62,63]. However, the situation in fish is more complex, with common carp and Atlantic cod having only one cysteine residue, while other species do not have any cysteine residues [19], such as orange-spotted grouper (Epinephelus coioides), Japanese flounder, and Japanese pufferfish in the current study. The lack of cysteine residues may have some effect on the structural stability of the protein. Phylogenetic analysis grouped all fish species into a single cluster, clearly distinguished from that in avian and mammalian studies, with TrLysG exhibiting the highest similarity to T. flavidus. Previous research has revealed that the LysG in fish forms a distinct group due to the absence of the signal peptide sequence [59].

In fish, LysG has been found to be expressed in various tissues. It is mainly produced in the head kidney and spleen, which are important tissues involved in immune responses [23,64,65]. Furthermore, LysG can be also abundantly found in mucosal tissues, such as intestines, skin and gills, which play significant roles in mucosal immunity [66]. In addition to nutrient digestion and absorption, the intestines are also a vital component of animals’ immune defense against harmful substances. Fish gills are exposed to numerous waterborne pathogens, with some pathogens utilizing the gills as a portal of entry into the host [67]. Hence, the substantial presence of LysG could be crucial. TrLysG expression levels were also found to vary among specific tissues, with intestines exhibiting the highest expression, followed by the gills. Similarly, Lates calcarifer and E. coioides exhibited the highest expression levels in the intestines [17,68], while gills showed the highest level of expression in sea bass [57], yellow catfish (Pelteobagrus fulvidraco) [69], and crucian carp (Carassius auratus) [64]. These findings suggested that the significant expression levels of LysG in mucosal tissues may be associated with their crucial functions in mucosal immune responses.

V. harveyi is a Gram-negative bacterium and belongs to the Vibrionaceae family. It is a well-known and dangerous bacterial disease of fish and invertebrates. Naturally diseased fish may exhibit a range of lesions, including liver congestion, muscle necrosis, skin ulcers, and tail rot [70]. In the present study, the intestines and gills were selected for the challenge experiment due to their high expression in normal healthy conditions; moreover, V. harveyi would cause serious granulomatous lesions in the liver of Japanese pufferfish. Therefore, the liver was also selected for gene expression detection. In this study, fish were intraperitoneally injected with V. harveyi for infection challenge; therefore, besides bacterial infection, the upregulation of TrLysG could also be caused by injection. The expression levels of control in different time-points and different tissues were also evaluated. The results showed that TrLysG expression were indeed altered by the injection (Figure S1). TrLysG showed reduced expression compared to 12 h in each tissue injected after 24 h in the liver, indicating that either the effect of injection only lasted for a short period of time (12 h), or the injection only downregulated TrLysG expression. In order to eliminate the effects of the injection, fold changes were calculated in comparison to the corresponding control at each time-point in each tissue, so that the increase in the TrLysG was only caused by bacterial infection. Our findings revealed that TrLysG expression levels were significantly up-regulated in all tested tissues. Similarly, in vivo challenge experiments in other teleost species also demonstrated the up-regulation of LysG in multiple tissues following bacterial infection, such as in the liver of rohu [19], Chinese rare minnow [18], Dabry’s sturgeon [71] and crucian carp [64] after A. hydrophila infection; in the gills of seahorse (Hippocampus abdominalis) [72] after being challenged by Edwardsiella tarda and Streptococcus iniae; and in the intestine of half-smooth tongue sole (Cynoglossus semilaevis) [73] and turbot (Scophthalmus maximus) [22] after Vibrio anguillarum and S. iniae infection, respectively. Notably, TrLysG was significantly up-regulated for three-time points in the liver, indicating that the liver plays an important role at every stage of bacterial infection. These results indicated the significance of this enzyme in immune defense against invading pathogens.

Lysozymes are commonly recognized as muramidase and have the ability to produce bacterial cell lysis, which is a fundamental characteristic shared by various lysozymes [74]. However, the enzymatic activity is not always the same in different conditions; it is usually maximal at a specific temperature and pH, which ensures proper substrate binding and ultimately enhances the antimicrobial efficacy. Therefore, optimum temperature and pH are key factors for optimal enzyme action [75]. Optimal pH values have been found to range from 5.0 to 7.5 in previous research in fish [76]. In our study, we tested the lytic activity of rTrLysG at various temperatures and pH levels using S. cereus as the substrate. The rTrLysG optimal condition was observed at pH 6, consistent with rohu [19]. Meanwhile, different fish species exhibited a broad range of optimal temperatures, spanning from 22 to 60 °C in various studies [13,20,22,57,77], and the rTrLysG demonstrated an optimal temperature of 55 °C. Overall, our findings indicated that the optimum pH and temperature of rTrLysG were both within the range previously described for fish LysG proteins.

The antibacterial activity of rTrLysG was evaluated using MIC tests against three Gram-positive and five Gram-negative bacteria. In our current investigation, rTrLysG exhibited antibacterial effects against multiple Gram-positive bacteria, which has been confirmed in numerous species [19]. However, since Gram-negative bacteria’s peptidoglycan is encased in an outer membrane that contains lipopolysaccharides, lysozymes cannot reach it directly [78]. As reported in chickens, the hen egg white lysozyme (HEWL) displayed limited or negligible activity against Gram-negative bacteria [21,79]. Surprisingly, similar to TrLysG, many teleost lysozymes also showed notable inhibitory effects against Gram-negative bacteria [13,19,57,76]. Studies have found that besides their fundamental role as muramidases, lysozymes may exhibit non-enzymatic bactericidal activities that involve activating bacterial autolysis through the interaction between cationic lysozyme molecules and the cell wall, as well as perturbing, disintegrating, and causing membrane leakage without peptidoglycan hydrolysis [15,18]. Notably, our findings indicated that the lytic action of rTrLysG is quite efficient for both S. pasteuri and V. harveyi with MIC of 50 μg/mL. In aquaculture, the accumulation of antibiotics has resulted in the development of resistance among bacterial pathogens, and resistance developed in the aquatic animals could be transmitted to humans, to the detriment of our health. Therefore, identification of safer alternatives is essential for the healthy and sustainable development of aquaculture. Studies have revealed that the chances of the emergence of resistance to lysozymes is slim [80], making it a promising antibacterial agent for disease control. In the course of aquaculture, lysozymes could be used as feed additives; previous studies have reported that complexes of natural actives with lysozymes shield fish from harmful microbes and increase feed conversion [81]. Furthermore, lysozymes could be added directly to culture water to enhance water quality [82] and maintain microbial balance, thereby strengthening aquatic animals’ resistance to bacterial diseases.

5. Conclusions

We have successfully characterized the molecular features, physicochemical properties, and evolutionary relationships of TrLysG. Transcriptional analyses revealed widespread expression of TrLysG in nine healthy tissues, with the intestines and gills showing the highest abundance. Furthermore, TrLysG exhibited a significant up-regulation following V. harveyi challenge. The purified recombinant protein rTrLysG exhibited bactericidal activity against both Gram-positive and Gram-negative bacteria. Our results demonstrated the crucial role of TrLysG in the immunological response to bacterial infection in T. rubripes, which could further help in harnessing rTrLysG for the development of novel biotherapeutics.