Transcriptomic Revealed That Selenium-Rich Lactobacillus plantarum Alleviated Cadmium-Induced Immune Responses in Bulatmai barbel Luciobarbus capito Kidneys

Abstract

Cadmium (Cd) is a common environmental pollutant that accumulates mainly in the kidneys and thus endangers the physiological health of aquatic animals. Selenium (Se) is a natural antidote to heavy metals that antagonises heavy metal toxicity and enhances the antioxidant capacity of organisms. Lactobacillus plantarum (L. plantarum) can reduce the toxicity of heavy metals through adsorption, reduction and metabolism. Studies have confirmed that the biological synthesis of Se nanoparticles (Bio-SeNPs) using bacterial microorganisms is simple, safe and less toxic than the synthesis of inorganic and organic Se, but the effect on Cd-induced immunosuppression is un-known. One hundred and eighty Bulatmai barbel (Luciobarbus capito: L. capito) plants were randomly divided into control (C), Cd and Cd + Se-enriched L. plantarum groups (S1L1-Cd) and fed for 28 days. The analysis methods included histopathology, test kits, transcriptomics and real-time quantitative PCR. The addition of selenium-enriched L. plantarum significantly attenuated cadmium-induced pathological changes such as glomerular atrophy, detachment of renal tubular epithelial cells, mild swelling, and interstitial inflammatory cell infiltration. Cd stress can lead to significant decreases in RBC, HCT, WBC, LZM, C3, and IgM levels, and the addition of Se-enriched L. plantarum can significantly reverse the changes in these indicators. Transcriptomic analysis revealed 488 DEGs in the Cd groups, 301 of which were upregulated and 187 of which were downregulated. There were 1474 DEGs in the S1L1-Cd group, of which 720 were upregulated and 754 were downregulated. In addition, GO enrichment analysis revealed that the biological regulation of the most differentially expressed genes involved metal ion binding, ATP binding and nucleotide inclusion. KEGG enrichment analysis revealed six of the most enriched pathways: oxidative phosphorylation, Huntington disease, retrograde endocannabinoid signalling, natural killer cell-mediated cyto-toxicity, the IL-17 signalling pathway, and leukocyte transient migration. Moreover, we selected 12 DEGs for qRT-PCR, which showed that the qRT-PCR results were consistent with our RNA-Seq results. Our results suggest that Se-enriched L. plantarum can enhance immunity and alleviate Cd exposure-mediated immunosuppression in L. capito.

1. Introduction

The main sources of Cd pollution include polyvinyl chloride (PVC) products, colour pigments, industrial corrosive reagents, and phosphate fertilisers [1]. Bulatmai barbel belongs to Cypriniformes, Cyprinidae, and Barbinae, and is mainly found in the inland rivers of the southern Caspian Sea and the Aral Sea system, Uzbekistan, Iran and Turkey [2,3]. Heavy metal contamination of water bodies has led to heavy metal stress in Bulatmai barbel, severely affecting growth and development [3,4,5,6]. In addition, environmental Cd leakage can occur in tissues or organs such as the kidneys of living organisms [4,7]. Cd poses a great threat to the survival of aquatic animals due to its long half-life and low excretion rate from the body. Cd enters the bloodstream from the intestines of carp and accumulates in the kidneys over a long period of time, leading to renal dysfunction [1]. Cd stress disrupts cell physiological signalling cascades, gene expression, molecular transport and metabolic regulation in aquatic animals [8]. Cd exposure induced aberrant autophagy and pyroptosis in duck kidney tubular epithelial cells [9]. Cd can inhibit the function of T cells and B cells, thereby affecting the humoral immune function of aquatic animals and mediating the development of inflammatory responses that increase the burden on the immune system [10,11]. Furthermore, it has been demonstrated through in vitro experiments that Cd can directly interfere with signalling pathways, where cell activation and differentiation are altered, ultimately leading to cytokine production, which in turn affects the status and function of immune cells [11]. Cd exposure results in a significant increase in the serum IL-17 mRNA level [12]; this may be attributed to the effect of Cd on innate immune cells, which are required for the differentiation of cytokine-producing T cells [13]. Therefore, the increased accumulation of Cd in fish is causing great damage to the aquaculture industry, food safety and public health.

Se has antioxidant, anti-inflammatory, and heavy metal antagonistic functions; enhances reproductive function; and promotes basal metabolism in organisms. Se affects the immune function of the body in three ways: cellular immunity, humoral immunity and nonspecific immunity. Se can enhance the secretion of IL-1 and IL-2 by lymphocytes, stimulate the formation of immunoglobulins, and increase the levels of IgG and IgM [14]. Nano-Se is a new form of Se supplementation, and the addition of nano-Se to feed im-proves the activity of antioxidant enzymes in the L. capito liver [15]. Studies have shown that low doses of Se can promote the proliferation of hepatocytes in mice under arsenic (As) stress while attenuating the degree of lipid peroxidation in liver and kidney tissues, indicating that Se can antagonise arsenic toxicity [16,17,18]. It has been reported that Se can alleviate Cd toxicity by forming Se-Cd complexes with Cd, thereby reducing the bioavailability of Cd and reducing oxidative damage in different organs and tissues, such as the liver, kidneys, bones and blood [19].

Probiotics are defined as live beneficial microorganisms that, when ingested in moderation, may help the host regulate the intestinal flora. Probiotics will have beneficial effects on the host by colonising and altering the intestinal microbial population [20]. Feeding L. plantarum enhanced kidney antioxidant enzyme activity and reduced Cd toxicity in mice under Cd stress [21]. Probiotics can convert inorganic Se to nano-Se through bio-transformation, which reduces Se toxicity while increasing the biological activity of the probiotics, making Se conversion more efficient. Shang et al. carried out a Se enrichment test on six strains of Bacillus sphaericus and reported that the highest Se enrichment and Se conversion efficiency were found in Bacillus subtilis, with an enrichment content of 281.813 μg/mL and a Se conversion rate of 56% [22]. Studies have shown that probiotics have the ability to adsorb the heavy metal Cd, which can reach saturation adsorption and very high removal efficiency within one hour [23,24]. However, there are few studies on the mechanism of Cd removal by Se-enriched L. plantarum.

Studies have demonstrated that Se and L. plantarum have antagonistic effects on heavy metals, reducing their accumulation, promoting the immune response and modu-lating the inflammatory response [17,25,26]. However, most of these studies focused on Se or L. plantarum alone to antagonise heavy metal toxicity, and few studies have utilised the biotransformation of L. plantarum from sodium selenite to Se nanoparticles to antago-nise heavy metals. Therefore, the aim of this study was to investigate the effect of Se-enriched L. plantarum in feed on the immune regulation of L. capito and its potential role in alleviating the adverse effects of Cd toxicity through transcriptomics.

2. Materials and Methods

2.1. Drugs and Reagents

Sodium selenite (Sinopharm Group Chemical Reagent Co., Ltd., Hitachi Aerospace Corporation, Tokyo, Japan), Cd chloride (Tianjin Tianli Chemical Reagent Co., Ltd., Tianjin, China), RNA fixative (Dalian Meilun Biotechnology Co., Ltd., Dalian, China), MRS medium and MRS broth culture (Qingdao Haibo, Qingdao, China) were used.

2.2. Preparation of Se-Enriched Lactic Acid Bacteria

The detailed experimental procedures used for the adsorptive transformation of inorganic Se by L. plantarum have been described previously [1]. Briefly, 200 μL of L. plantarum and 200 µg/mL sodium selenite were added to 10 mL of MRS broth and incubated aerobically and statically for 24 h at 37 °C. The obtained Se-enriched L. plantarum solution was centrifuged at 3500 r/s for 5 min, after which the supernatant was discarded, and the Se in the solution was washed away three times. The precipitated cells obtained were dried in an oven at 37 °C. Bacterial powder (0.1 g) was mixed well with concentrated nitric acid (65% HNO₃). The digestion reaction was carried out on a hot plate until the sample was completely dissolved. The Se concentration was determined by an AA-6300 (Shimadzu, Japan) atomic absorption spectrometer

2.3. Scanning Electron Microscopy Observation of Se and Morphological Distribution of Bacteria

The L. plantarum strain was incubated in MRS medium at 37 °C for 12 h, transferred to 24-well plates and incubated in MRS medium containing 200 g/mL Na₂SeO₃ at 37 °C for 24 h. Then, the bacteria were fixed with glutaraldehyde at 2.5% v/v/v and left at room temperature for 1 h before being washed three times with PBS. The bacteria were dehydrated in a series of gradients of ethanol (30% to 100%), the ethanol was replaced with 100% tert-butanol, the bacteria were then dried and coated with gold in a vacuum freeze dryer, and the samples were scanned using a HITACHI SU8010 emission field scanning electron microscope (Hitachi Aerospace Corporation, Dallas, TX, USA).

2.4. Experimental Design

L. capito (76.2 ± 1.1 g) was procured from a specialized aquatic fry farm (Jilin province, China) and transferred to the laboratory. A total of 270 L. capito individuals were randomly and equally assigned to 9 aquariums (90 × 50 × 50 cm, 30 fish/aquarium). L. capito was randomly reared in a tempered glass fish tank with three experimental groups—control (C), Cd and Se-enriched Cd (S1L1-Cd)—with three replicates for each group, and the culture experiment lasted for 28 d. Cd was added to the water (0.05 mg/L), and Se and Cd concentrations were set according to previous studies [1]. Feeds were supplemented with Se-enriched L. plantarum (nano-Se level of 5 mg/kg and L. plantarum content of 10⁸ CFU/kg), and all feeds were stored at 4 °C until use. To maintain the activity of L. plantarum, all the finished feeds were stored at 4 °C and fed within 2 d. The feeds were stored at 4 °C and fed within 2 d. The water was changed once a day, half of it at a time, and the corresponding Cd was added according to the test concentration to maintain the set Cd concentration in the water.

The fish were fasted for 12 h before the end of the experiment, and six fish were removed from each group. One study recommended a minimum of 4 to 6 fish to obtain 80% statistical significance in biochemical/immunological parameters [27]. Whole blood was collected from the tail vein of the fish for biochemical analysis. The fish were euthanised with 300 mg/L of methane-sulfonate-222. The kidneys of the fish were collected. The kidneys were rinsed with precooled saline and then quickly placed in liquid nitrogen for 1.5 h. The kidneys were finally stored in a freezer at −80 °C for transcriptome sequencing and qRT-PCR. This study was approved by the Animal Care and Use Committee of Jilin Agricultural Science and Technology University (approval code: 20221011).

2.5. Blood and Serum Immunological Tests

Blood was subsequently collected. Haematological indices were determined using an animal blood cell analyser (Mindray BC-2800Vet, Shenzhen, China) according to the manufacturer’s instructions.

Serum creatinine (Cr), blood urea nitrogen (BUN), uric acid (UA), C3, C4, and immunoglobulin M (IgM) levels and lysozyme (LZM) activity were measured using an ELISA kit (Nanjing Jianjian Bioengineering Institute, Nanjing, Jiangsu, China).

2.6. Kidney Tissue Sections

Renal histological sections were fixed in 10% neutral-buffered formalin for histological examination. The formalin-fixed tissues were embedded in paraffin and processed using standard paraffin techniques. Sections stained with haematoxylin and eosin were processed according to standard protocols [28]. Finally, the sample sections were observed on an Axioskop microscope (IX71. Olympus, Hamburg, Germany).

2.7. Transcriptome

Sequencing was performed by Hangzhou Lianchuan Biotechnology Co., Ltd. (Hangzhou, China) using a NovaSeq 6000 system (Illumina, San Diego, CA, USA). The raw data obtained were filtered to maximise the data quality. Contaminated, low-quality and unidentified bases were removed. A window quality scan of sequencing reads was performed. The default scanning window was 6 bp. The portion of the reads from the beginning of the window to the end of the 3′ window was truncated when the average quality value in the window was less than 20. FastQC software was used for data quality control, with 90% valid data and 90% valid data for Q20 and Q30. Truncated sequences with N contents greater than 5% were removed. FastQC was used to assess sequence quality, including the number of valid reads, Q20, Q30 and GC content (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) (accessed on 18 May 2023). The expression levels of the unigenes were determined as transcripts per million (TPM) values. After obtaining reads for genes. Differentially expressed unigenes with statistical significance (|log2-fold change| ≥ 2, p < 0.05) were screened using the R package edgeR (3.12.1).

2.8. Gene Ontology and Enrichment Analysis

Unigenes were obtained by reassembling the transcriptome using Trinity 2.4.0. All newly assembled gene sequences (UniGene) were compared and annotated with the NR, GO, EggNog and KEGG databases. Biological effects of differentially expressed genes were demonstrated using GO (http://www.geneontology.org) (accessed on 18 May 2023); signalling pathways between differentially expressed genes were analysed using KEGG (http://www.genome.jp/kegg/) (accessed on 18 May 2023). The GO and KEGG classes were significantly enriched (p < 0.05).

2.9. qRT-PCR

Total RNA was extracted from the kidneys of L. capito according to the instructions of the Simply P Total RNA Extraction Kit (Hangzhou Bozhi Science and Technology Co., Ltd., Hangzhou, China). cDNA was reverse transcribed using 1 μg of total RNA according to the instructions of the PrimeScript™ RT kit and gDNA Eraser (Beijing Baozhi Physical Technology Co., Ltd., Beijing, China). For quantitative real-time fluorescence PCR (qRT-PCR), qRT-PCR was performed on a QuantStudio 6 real-time PCR system. The sequences of primers used for gene expression analysis are shown in

Table 1. Primer sequences for polymerase chain reactions.

Gene	Gene Name	Nucleotide Sequence (5′–3′)		Accession No.
β-Actin	Beta-Actin	Forward Reverse	CATTGGAGGGCAAGTCTGGT CCCGAGATCCAACTACGAGC	NR145818.1
HSP90AB1	Heat shock protein 90ab1	Forward Reverse	ACCACCCTGCTCTGTACTACT TCCTGAGGGTTGGGGATGAT
HSP70	Heat shock protein 70	Forward Reverse	GCCATGAACCCCAACAACAC TTTCGGCTTCCCTCCATCAC	AY120894.1
IL-1β	Interleukin-1β	Forward Reverse	ACCAGCTGGATTTGTCAGAAG ACATACTGAATTGAACTTTG	AB010701
HSPA4L	Heat shock 70-kDa protein 4-like	Forward Reverse	AACAGGACTTGCCAAACCCA CAAAGTTGCATCCGCCCAAA
agr2	Anterior gradient 2	Forward Reverse	AGCACTTGTCTCCTGATGGC TACAGGCGGTTAGCATAGCG
MT-CO1	Mitochondrially encoded cytochrome c oxidase I	Forward Reverse	TTAGCTGACTCGCCACACTC TACAATGCCAGTCAGGCCAC
MT-ND4	Mitochondrially encoded NADH dehydrogenase 4	Forward Reverse	ACAAGCTCCATCTGCCTACG GAAGCTTCAGGGGGTTTGGA
VMO1	Vitelline membrane outer layer 1	Forward Reverse	TGGGGTCACAGGGAAATGTG TGAACTGAGGCGTAGCTGTG
HSPA8	Heat shock protein family A member 8	Forward Reverse	AGTGGACAAAAGCACTGGCA TTAAAGGCCAGCGACTCCAA
tnfaip8l2a	Tumour necrosis factor alpha-induced protein 8-like protein 2	Forward Reverse	GACAACAGCGGTGAGGTTCT AAGTCCTGTGCCACACTCAG
C3	complement component 3	Forward Reverse	GTACGTGGGAAAGACGCTGA CAGCGTAAGTGCTGGTCAGA
C5	complement component 4	Forward Reverse	GGAGGAACACACCAGCAAGT GCTCTCCACGAACCATGGAA

. The relative expression of each gene relative to that of the internal reference gene β-actin was calculated according to the 2^−ΔΔCT method.

2.10. Data Analysis

The data are expressed as the mean ± standard deviation (mean ± SD) of each group. Differences in means between groups were analysed using one-way analysis of variance (ANOVA), and multiple comparisons were performed using Tukey’s method and then tested using the data analysis software SPSS 20.0. Differences with a p value < 0.05 were considered to indicate statistical significance.

3. Results

3.1. Se-Enriched Lactic Acid Bacteria

As shown in Figure 1A, the L. plantarum surface was smooth. As shown in Figure 1B, spherical Se nanoparticles (red arrows) were visibly attached to the surface of L. plantarum. Zhang et al. [29] also obtained similar findings.

3.2. Kidney Histology and Morphology

As shown in Figure 2, kidney sections from the control group (A) show normal glomeruli, proximal tubules and distal tubules, and after Cd stress (B) show glomerular atrophy, vacuolisation of the tubular epithelial cell lining, mild swelling and epithelial cell detachment, and a large number of inflammatory cells infiltrating the renal interstitium. After feeding with Se-enriched L. plantarum, pathological changes in glomerular structure were significantly reduced, the renal tubular structure was normal, and the number of inflammatory cells in the renal interstitium was significantly reduced.

3.3. Haemocyte Parameters and Serum Immune Responses

As shown in Figure 3, Cd exposure can cause cytotoxicity, which is a decrease in fish immune functions. In this study, the haematological indices of L. capito were determined under Cd or Se-enriched L. plantarum treatment. As expected, Cd exposure resulted in a significant decrease in blood RBC, HCT and WBC counts, while the S1L1-Cd group had significantly greater RBC, HCT and WBC counts.

The serum LZM, C3, C4 and IgM levels are nonspecific immune indicators that are important for resisting pathogen invasion and maintaining the health of fish. In this study, the serum levels of LZM, C3 and IgM were significantly lower in the Cd group than in the control group. The serum levels of LZM, C3, and IgM were significantly greater in the S1L1-Cd group than in the Cd and control groups. However, there was no significant change in the serum level of C4, and its mechanism of action needs to be further investigated and discussed. These results show that the addition of selenium-enriched L. plantarum to the feed could improve the immune function of L. capito and alleviate cadmium-induced immunosuppression.

3.4. Kidney Damage Indicators

The three indicators of blood urea nitrogen (BUN), inosine (CR), and uric acid (UA) in serum are sensitive serological indicators of kidney injury (Figure 4). Their levels can directly reflect kidney function. In this study, compared with those in the control group, the serum Cr, BUN, and UA levels in the Cd group were significantly greater. Compared with those in the Cd group, the levels of serum Cr, BUN and UA significantly decreased in the S1L1-Cd group, but elevated compared to the control group. This result shows that selenium-enriched L. plantarum can attenuate cadmium stress-induced renal injury.

3.5. Transcriptome

The quality control results of the transcriptome sequencing are shown in

Table 2. Transcriptome sequencing quality control results.

Sample	Raw_Reads	Clean_Reads
C1	39,890,490	38,813,784
C2	43,258,692	42,393,916
C3	43,489,474	42,578,024
Cd1	39,470,924	37,924,708
Cd2	42,786,912	41,503,984
Cd3	43,699,384	41,839,558
S1L1-Cd1	47,325,678	46,031,170
S1L1-Cd2	44,356,428	42,993,436
S1L1-Cd3	40,541,038	39,382,828

. The three samples in Group C obtained 38,813,784, 42,393,916 and 42,578,024 readings, and the samples in group Cd obtained 37,924,708, 41,503,984 and 41,839,558 readings, respectively. The 46,031,170, 42,993,436 and 39,382,828 readings were obtained for the S1L1_Cd group. The differences in gene expression in the kidney tissues of L. capito plants treated with Cd and L. plantarum are shown in Figure 5A. There were 488 DEGs in the control group and the Cd group, of which 301 genes were upregulated and 187 genes were downregulated. There were 1474 DEGs in the C and S1L1-Cd groups, of which 720 genes were upregulated and 754 genes were downregulated. A total of 989 DEGs were expressed in the S1L1-Cd and Cd groups; 510 genes were upregulated, and 497 genes were downregulated. A Venn diagram can more directly show the overlap of differential gene expression. As shown in Figure 5B, two significantly differentially expressed genes were found in all the groups. The cluster analysis of differential gene expression is shown in Figure 5C. The two differentially expressed genes were TRINITY_DN15244_c0_g1 (agr2) and TRINITY_DN16045_c0_g1.

We used GO enrichment to analyse DEGs in L. capito plants treated with Cd- or Se-enriched L. plantarum. DNA templates (transcriptional regulation) and signal transduction were significantly enriched. Membranes, membrane components and cellular components of the nucleus were significantly enriched. The molecular functions of metal ion binding, ATP binding, and nucleotide inclusion were the most highly differentially expressed genes (Figure 6A).

The KEGG database annotates differentially expressed gene enrichment pathways. Our results showed that the enriched pathways were as follows: environmental information processing, cellular processes, and human diseases (Figure 6B). The kidney tissue enrichment pathways consisted of four main categories: organismal systems, metabolism, human diseases, genetic information processing, environmental information processing and cellular processes. The six pathways with the greatest enrichment were signal transduction, endocrine system, cell growth and death, cellular community eukaryotes, signalling molecules and interaction and immune system. The 20 pathways with the most significant enrichment in KEGG pathways were analysed. Research has shown that Cd is closely related to signalling pathways related to kidney immune injury. The following six of the most closely related enrichment pathways were identified: oxidative phosphorylation, Huntington disease, retrograde endocannabinoid signalling, natural killer cell-mediated cytotoxicity, the IL-17 signalling pathway, and leukocyte transendothelial migration (Figure 7).

3.6. qRT-PCR Validation

Twelve DEGs from L. capito kidneys were randomly selected for qRT-PCR to verify the reliability and reproducibility of the RNA-Seq data (Figure 8). HSP90AB1, hsp70, and HSPA4L expression levels were significantly greater in the Cd group than in the control group, and agr2 and VMO1 expression levels were lower in the Cd group than in the control group (Figure 8A). The results showed that the expression levels of MT-CO1, MT-ND4, HSP90AB1, and HSPA8 in the S1L1-Cd group were significantly greater than those in the control group, and the expression levels of agr2, VMO1, IL1B, and tnfaip8l2a were lower than those in the control group (Figure 8B).

4. Discussion

Cd is a toxic heavy metal, and Cd is widely present in natural aquatic environments. Long-term exposure to Cd or excessive Cd intake can cause serious damage to the physiological functions of aquatic animals and oxidative stress [30]. The kidneys are the main target organs of Cd exposure, and Cd is mainly excreted through the kidneys when it enters the body of aquatic animals. When the Cd concentration is too high, the kidneys are unable to efficiently excrete Cd, which leads to the accumulation of Cd in the kidneys, thus causing kidney damage [31]. A study reported that Cd exposure can lead to severe damage to the histological structure of the kidney in male rats and that Se can reduce Cd accumulation and alleviate kidney damage [32]. In this study, we found that Cd stress caused glomerular atrophy, vacuolisation of the tubular epithelial cell lining, mild swelling and epithelial cell detachment in renal tissues, whereas the lesions were significantly attenuated by the addition of Se-enriched L. plantarum to the feed, which suggests that Cd exposure causes damage to the kidney tissues of L. capito and that Se-enriched L. plantarum alleviates Cd damage to the kidneys.

A study revealed that Cd concentrations were greater than 0.1 mg/kg in the muscle, liver and kidneys of carp (Cyprinus carpio) and catfish (Silurus glanis) from the Buško Blato region of Bosnia and Herzegovina, and Cd accumulation reached its highest level in the kidneys [33]. Cd has been shown to have toxic effects on the hepatopancreas, cardiovascular, immune and reproductive systems [34,35]. Cd stress can lead to significant changes in blood biochemical indices in aquatic animals. Similarly, acute Cd exposure led to a significant reduction in blood WBC, RBC, and HCT levels in mice [35]. Similar results were obtained by Simsek, where Cd-containing feeds led to anaemia in mice by causing a reduction in erythrocyte, leukocyte, and ANAE-positive T-lymphocyte counts as well as Hb, PCV, and MCHC values in mouse groups. In the present study, our results also revealed a decrease in RBC, HGB and HCT, which may be due to the inhibition of erythropoiesis induced by Cd chloride, whereas the increase in leucocytes may be a result of enhanced immunomodulation of the organism affected by oxidative stress [36].

Serum creatinine (Cr), blood urea nitrogen (BUN), and uric acid (UA) are the main indicators for evaluating renal function. Heavy metal exposure can lead to a significant increase in serum Cr, BUN, and UA [37]. Fluoride exposure was also found to cause oxidative damage and nephropathy in mice and significantly increased urea nitrogen (BUN), creatine and serum creatinine levels [38]. Studies have confirmed that Se can attenuate hexavalent chromium [Cr(VI)]-induced renal dysfunction by lowering the serum levels of BUN and CRE [39]. In the present study, long-term Cd exposure resulted in significantly higher levels of serum Cr, BUN, and UA in L. capito, which suggests that Cd can cause renal dysfunction. Compared with those in the Cd group, the Se-enriched Cd group had significantly lower serum Cr, BUN, and UA levels, which suggests that Se-enriched L. plantarum can alleviate the damage caused by Cd in the kidney to a certain extent. Fish are lower metameric vertebrates with relatively low specific immune responses, and the nonspecific immune system is of great importance to scleractinian fishes under abiotic stress. Lysozyme is an important component of nonspecific immunity in fish and is widely present in fish mucus and serum, where it activates phagocytic complements in addition to lysing bacteria [40].

In addition, IgM is an important measure of humoral immunity and health in fish. External oxidative stress has a significant effect on the level of immunity in fish. When Takifugu rubripes were subjected to nitrite stress, the serum LZM and IgM levels decreased significantly, leading to immune dysfunction and immunotoxicity [41]. It has also been found that ammonia exposure results in significantly lower concentrations of C3, C4, IgM and LZM and reduced immune function in redfin puffer [42]. In the present study, we found that Cd stress resulted in a significant reduction in the levels of C3, IgM and LZM in L. capito, whereas there was no significant change in the level of C4. Se and L. plantarum have growth-promoting, immune-enhancing and antioxidant functions [43]. L. plantarum belongs to a branch of Lactobacillus, and it has been shown that Lactobacillus has growth-promoting, immune-enhancing and disease-resistant functions. The administration of Lactobacillus to loaches significantly increased C3, C4, IgM and LZM levels and enhanced humoral immunity [44]. In our study, the addition of Se-enriched L. plantarum to the feed after Cd exposure increased the C3, IgM and LZM levels, suggesting that Se-enriched L. plantarum alleviated Cd-induced immunosuppression in L. capito.

The transendothelial migration of leukocytes is the process by which leukocytes pass through the vascular endothelium into tissues and is essential for the functioning of the immune system because it allows leukocytes to reach damaged cells or tissues [45]. In the inflammatory response, leukocyte migration across the endothelium is an important factor. Through transendothelial migration, leukocytes can reach damaged tissues while removing pathogens and waste products from damaged tissues, promoting tissue repair and regeneration [46]. Lymphocytes are an important part of the immune system that makes up an organism. Humoral immunity is mediated by antibodies produced by B lymphocytes (B cells); antibodies recognise extracellular microorganisms, bind to them (blocking host cell infection in this way) and promote phagocytosis for microbial uptake and destruction; and T lymphocytes (T cells), the mediators of cell-mediated immunity, destroy intracellular microorganisms [47].

IL-17 is a bridge between innate and adaptive immunity, as it is produced by adaptive and ‘innate’ T cells and activates the gene expression program typical of the innate immune response; IL-17 has been implicated in a variety of diseases, and IL-17 activates the nf-κB and MAPK pathways, which regulate the production of inflammatory mediators [48]. In recent years, the IL-17 family has attracted much attention from a wide range of medical researchers. One study showed that IL-17 and IL-23 levels were significantly greater in AIH patients than in chronic hepatitis B (CHB) patients and healthy controls [49]. In addition, IL-17 can promote oxidative stress-induced hepatocyte apoptosis through the Nrf2/Keap1 signalling pathway [50,51]. In the present study, Cd exposure significantly enriched leukocyte transendothelial migration and the IL-17, TNF and nrf-κB signalling pathways, revealing that Cd exposure promotes oxidative stress-mediated inflammatory responses in L. capito. In contrast, the addition of Se-enriched L. plantarum to the feed significantly reversed the changes in the expression levels of these inflammatory factors, revealing that Se-enriched L. plantarum mitigated Cd-mediated immune responses by modulating inflammatory factors.

5. Conclusions

In conclusion, our study showed that Cd exposure causes damage to the kidneys of L. capito. Cd exposure induced immunosuppression and further reduced immune levels through haematological and immunological parameters. Cd regulates immune and inflammatory responses by activating the transendothelial migration pathway of leukocytes. KEGG pathway analysis revealed that Cd stress significantly enriched the IL-17 signalling pathway, which is involved in the inflammatory response. In contrast, the addition of Se-enriched L. plantarum to the feed significantly alleviated renal tissue injury. The Se-enriched L. plantarum treatment significantly reversed the effects of Cd stress on haematological and immunological parameters and alleviated Cd exposure-induced renal injury through the transendothelial migratory pathway, and the IL-17 signalling pathway was involved in the inflammatory response. Overall, the present study revealed the potential mechanism by which Se-enriched L. plantarum alleviates Cd-induced renal pathology and provided a theoretical basis for assessing the toxic effects of Cd in fish.