Next Article in Journal
Comparison of the Intestinal Microbiota Composition and Function of Red Claw Crayfish (Cherax quadricarinatus) Cultured in Ponds and Rice Fields
Previous Article in Journal
Transforming China’s Fisheries: A 40-Year Journey toward Sustainable Management (1980–2019)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 9
10.3390/fishes9090344
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Supplementation with Nano-Curcumin Improves the Meat Quality and Nutrition Value of Largemouth Bass (Micropterus salmoides) Fed with a High-Carbohydrate Diet

by
Yamin Wang
†,
Jing Chen
†,
Kaipeng Zhang
,
Xiaoxue Bao
,
Shan Xie
,
Zhenye Lin
,
Xiaotong Chen
and
Yingying Yu
*
Guangdong Provincial Key Laboratory of Animal Molecular Design and Precise Breeding, School of Life Science and Engineering, Foshan University, Foshan 528225, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2024, 9(9), 344; https://doi.org/10.3390/fishes9090344
Submission received: 30 July 2024 / Revised: 27 August 2024 / Accepted: 29 August 2024 / Published: 31 August 2024
(This article belongs to the Section Nutrition and Feeding)
Browse Figures
Versions Notes

Abstract

:
This study investigated the effects of curcumin nanoparticles on the flesh quality of largemouth bass on a high-carbohydrate diet. A total of 180 fish (11.01 ± 0.02 g) were fed three semi-purified diets: the Control group (LC) were supplemented with standard carbohydrate (10%), the experimental group (HC) were supplemented with 15% carbohydrate, and the experimental group were supplemented with 0.2% nano-curcumin added to 15% carbohydrate (HCN) for 6 weeks. Results showed that a* value, taurine, valine, isoleucine, histidine, cystine, fatty acids (C17:0 and C20:2n6), MDA (malondialdehyde) content, and SOD (Superoxide dismutase) activity were significantly elevated (p < 0.05) in HC. Muscle fibers showed significant increases in horizontal diameter, longitudinal diameter, and cross-sectional area (p < 0.05), as well as up-regulated expression levels of the MRFS (myogenic regulatory factor) family gene and MSTN (myostatin) (p < 0.05), and a significant decrease in C16:1n7 in HC (p < 0.05). Importantly, the HCN group enhanced the muscle quality of largemouth bass by elevating the L* value, valine, isoleucine, arginine and cystine, C20:2n6, decreasing (p < 0.05) refrigeration loss, chewability, firmness and hardness, then MDA content and SOD activity, and downregulating (p < 0.05) MSTN and MRFS family gene expression levels to improve largemouth bass muscle quality.
Keywords:
high-carbohydrate; Micropterus salmoides; muscle quality; nano-curcumin; nutrition value
Key Contribution: Dietary Supplementation with nano-curcumin can improve the meat quality of largemouth bass, increase the nutritional value, and reduce the oxidative damage.

1. Introduction

Largemouth bass (Micropterus salmoides) originates in freshwater streams and lakes in the United States. Introduced to Guangdong Province, China, in 1983, it has gained popularity among consumers for its tender meat and absence of intermuscular spines. At the same time, it has the preponderance of fast growth and rapid adaptation to environmental changes, making it a globally cultivated fish [1].
It is advisable that the digestible carbohydrate content in the cultured largemouth bass should not exceed 10%, and the protein content should approximate 45%. As the most affordable non-protein energy source, carbohydrates make up the majority of aquatic feed. Appropriately blending the proportion of carbohydrates in the diet can reduce the consumption of protein-energy, so as to save resources and improve economic efficiency. However, largemouth bass, as a carnivorous fish, has a very confined use of dietary carbohydrates, and prolonged high-carbohydrate intake leads to super physiological lipogenesis and glycogenesis, which eventually deteriorates into hepatic steatosis and hepatomegaly [2], while promoting muscle fiber hypertrophy and increased abdominal fat deposition [3,4]. Diets up to 25% carbohydrate have been reported to result in substantially lessening survival and increased blood glucose levels in largemouth bass [5]. A diet of 20% carbohydrates limits the growth of largemouth bass, increases liver oxidative damage, and accelerates liver glycogen accumulation [6]. A diet of 15% carbohydrates resulted in liver whitening, a remarkable increase in liver vacuolation, and a disorder in liver glucose metabolism [7]. At present, the impact of high-carbohydrate diets on largemouth bass is predominantly studied in the context of glucose metabolism and growth, with insufficient attention given to its effects on muscle quality.
Muscle quality is not a single trait. It is affected by diverse physical factors (including pH, meat color, texture, and water-holding capacity), alongside other factors like flavor and nutritional value. Fish muscle texture is an important criterion for fish muscle freshness, which hinges on several parameters, for example, hardness, cohesiveness, chewiness, springiness and stickiness. These parameters are affected by muscle fiber structure and collagen, mainly manifested as different meat quality at different developmental stages [8]. Studies have shown that a high-carbohydrate diet can improve the hardness and springness of the muscle of blunt snout bream [9]. And a high-carbohydrate diet reduces the lipid content of juvenile golden pompano muscle [10].
Curcumin, a polyphenol lipophilic molecule derived from turmeric, exhibits anti-inflammatory, anti-angiogenic, and antioxidant properties [11]. Its ability to block the activation of proteasomes in intact animals and enhance recovery during reload suggests potential benefits for skeletal muscle regeneration, attributed to its antioxidant and anti-inflammatory qualities [12]. In addition, curcumin injected into mice demonstrated beneficial effects on malnourished muscle by mechanistically inhibiting dysregulated nNOS activity [13]. Studies have shown that dietary curcumin can improve the myofiber structure of tilapia [14] and gumminess of Pelodiscus sinensis [15]. Then, curcumin enhances muscle quality by increasing the fatty acid content in Cyprinus carpio [16]. In summary, curcumin can exhibit a restorative effect on muscle quality.
However, its full therapeutic potential and efficacy are often not achieved by low water solubility and limited bioavailability stemming from malabsorption and first-pass elimination. Clinical experiments show that curcumin is available in nanoparticle, liposome capsule, emulsion, capsule, tablet, and powder [17]. Nanoencapsulation of curcumin has been demonstrated to enhance its water solubility, chemical stability, and bioavailability [18].
Therefore, the intention of this investigation was to explore the impact of a high-carbohydrate diet on largemouth bass muscle, address this gap in understanding, and appraise whether the supplementation of nano-curcumin to a high-carbohydrate diet can enhance largemouth bass muscle quality.

2. Materials and Methods

2.1. Experimental Design and Diets

Three kinds of isonitrogenous and isolipidic semi-purified test rations were prepared, which were control group (LC) supplemented with standard carbohydrate (10%), experimental group (HC) supplemented with 15% carbohydrate, and experimental group (HCN) supplemented with 0.2% nano-curcumin on the basis of 15% carbohydrate. The approximate components of the experimental diets are shown in Table 1. Nano-curcumin in this experiment was purchased from Shanghai Yihu Biotechnology Co., LTD (Shanghai, China). All raw materials were exhaustively mixed with oil and water, and the mixture (diameter 1.5 mm) was obtained by DS32-II twin-screw extruder (Guangzhou Vilavi Mechanical Equipment Co., Ltd., Guangzhou, China), which was let dry and then stored at −20 °C until the breeding experiment began.

2.2. Experimental Fish and Feeding Management

Healthy experimental fish were purchased from He’s Aquatic Products Co., Ltd., (Foshan, China) and farmed in the circulating aquaculture system at Foshan University. A total of 180 healthy fish (initial body weight: 11.01 ± 0.02 g), which were domesticated for 2 weeks, were chosen and randomly divided into nine buckets (400 L) with 20 fish per cage. The average initial body weight of the LC group, HC group, and HCN group was 11.77 g, 11.76 g, and 11.76 g, respectively. During the entire breeding phase, it was necessary to carefully feed to apparent satiation twice a day at 8:00 and 17:00 for 6 weeks. Previous studies have shown that the 6-week experiment results are of reference significance, and the number of samples for repeated analysis for each indicator was three [19,20]. Therefore, this study selected three duplicate fish for each index for a 6-week culture experiment and analysis. At the same time, sufficient oxygen in the bucket was assured. A total of 30% of the total water was refreshed every 2 days. Water quality parameters remained as follows: Dissolved oxygen > 6.0 mg/L; Ammonia nitrogen < 0.2 mg/L; Water temperature 25 ± 3 °C, pH 7.0 ± 0.5.
Fish grow and develop at the highest rate throughout their juvenile years, and there is a noticeable shift in the morphology and composition of their muscular tissue. This has an effect on many fish’s final size and growth rate during their later stages of life. For this reason, juvenile fish are chosen for this study’s experiment.

2.3. Sample Collection and Analysis

The largemouth bass were made to fast for 24 h and then anaesthetized with ice water. The dorsal muscle from three fish per cage (nine fish per diet) were sampled for the determination of muscle color, pH, and shear force analysis indicators. The muscle sample was divided into three parts: A-anterior dorsal muscle (Near the head), B-abdominal (central section), C-posterior dorsal muscle (tail).

2.3.1. Flesh Quality Analysis

A direct pH meter (pH star, Mets, Germany) was used to measure the pH of the muscles. A colorimeter (SCQ-1A Tenovo International Co., Limited, Shenzhen, China) was used to measure the following dimensions as follows: brightness (L*), redness (a*), and yellowness (b*). These indicators were measured at the A and C positions.
Three fish were randomly selected for water-holding capacity (WHC) analysis and texture profile analysis (TPA). The same dorsal muscle was divided equally into three blocks used to measure the water-holding capacity (WHC), which were drip loss, refrigeration loss, and steaming loss, respectively. The Drip loss and steaming loss were measured according to methodology described in the literatures [21,22]. Refrigeration loss: Place 1 g muscle in a refrigerator at 4 °C for 24 h, remove the surface moisture, and then weigh it.
The TPA was measured according to methodology described in the literature with some modifications [23]. The modifications that followed were the specific test parameters: The measurement speed of the test was 5 mm/s, the target mode was selected, and the degree of strain was 50%. These shear force parameters were obtained by compression with the following parameters: The mid-measurement velocity was 2 mm/s, with the target mode being displacement and the displacement distance of 3 mm.

2.3.2. Determine the Chemical Composition of the Body and Muscles

Three whole fish and more than three fish dorsal muscles were randomly sampled per barrel and stored at −20 °C. The fish body and dorsal muscles were freeze-dried and crushed to measure the composition. Crude protein, crude fat, and crude ash were sampled, respectively, by Kjeldahl method, Soxhlet extraction, and Muffle burning high-temperature combustion method (550 °C, 4 h).

2.3.3. Muscle Amino Acid (AA) and Fatty Acid (FA) Content

The amino acids and fatty acids were measured according to the methodology described in the literature [24].

2.3.4. Muscle Histology

Three fish in each group were randomly selected. Their muscle was washed with normal saline, fixed with 4% paraformaldehyde, dehydrated with ethanol, embedded with paraffin, sliced, analyzed with dye hematoxylin and eosin (H&E), sealed, observed, and photographed.

2.3.5. Enzyme Assays

Three fish were randomly selected for sampling. The muscle supernatant was prepared, and superoxide dismutase (SOD), Total antioxidant capacity (T-AOC), and malondialdehyde (MDA) were used in the kit of Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

2.3.6. Real-Time Quantitative PCR Analysis

Three fish were randomly selected for sample collection. Four genes (MSTN, myf5, myf6, and myoD) were selected to quantify their mRNA expression. The qPCR was measured according to the methodology described in the literature [25,26]. Briefly, RNA extraction was reverse transcribed into cDNA for real-time quantitative PCR analysis, and expression results were calculated by the 2−ΔΔCt method. The kits used in the experiments were obtained from Yeasen Biotechnology (Shanghai, China).
The primer sequences for qPCR analysis are shown in Table 2.

2.4. Statistical Analysis

The results are expressed as mean ± S.E.M (standard error of the mean). All data were analyzed by one-way ANOVA using Duncan’s multirange tests of SPSS 26.0 (SPSS Inc., Michigan Avenue, Chicago, IL, USA). P < 0.05 was considered a statistically significant difference.

3. Results

3.1. Flesh Color and pH Changes

In Figure 1a, the meat color and pH results are presented. pH, b*, and L* of anterior dorsal muscle among the groups were undifferentiated (p > 0.05). Compared to LC (2.19) and HCN (2.78) feed groups, the HC feed group’s a* value (3.01) was higher (p < 0.05). Turning to the posterior dorsal muscle, the L* value of the HCN group (56.65) was significantly higher than that of the HC group (52.17), while the a*, b*, and pH values were undifferentiated (p > 0.05) (Figure 1b).

3.2. Whole Fish Body and Muscle Composition Analysis

The compositional analysis of whole fish and muscle is shown in Table 3. Crude protein, crude ash of whole fish, and muscle did not differ significantly among all groups (p > 0.05). However, in whole fish composition, the HCN group exhibited significantly reduced crude lipid content compared to the other group (p < 0.05). Similarly, the HCN group displayed significantly lower crude lipid content than the HC group in terms of muscle composition (p < 0.05).

3.3. Muscle Amino Acid Composition Analysis

Table 4 indicates that significant differences were observed in the muscle’s amino acid composition. In the LC group, valine, isoleucine, and cystine were significantly lower than those in the other groups (p < 0.05). Conversely, compared with the other groups, the HCN group exhibited significantly higher levels of arginine and tyrosine (p < 0.05), while glycine and taurine were lower (p < 0.05). Notably, the HC group displayed the highest taurine among all groups (p < 0.05). Additionally, compared with the LC group, histidine in the HC group was significantly higher (p < 0.05). In comparison to the HCN group, there was a significant rise in proline in the HC group (p < 0.05).

3.4. Muscle Fatty Acid Composition Analysis

Table 5 presents the compositional analysis of muscle fatty acid. Regarding the saturated fatty acids (SFA) category, when comparing the HC group to the LC group, C17:0 was lower. Conversely, within monounsaturated fatty acids (MUFA), C16:1n7 exhibited an opposing trend. C20:2n6 was markedly lowest in the LC group in n-6 polyunsaturated fatty acids (n-6PUFA) category (p < 0.05). Broadly speaking, in terms of total polyunsaturated fatty acids (PUFA), the HC group exhibited a statistically significant increase in comparison to the LC group (Table 4).

3.5. Water-Holding Capacity (WHC) of Muscle

It is observed from Table 6 that the refrigeration loss of the HCN group is significantly reduced compared with the LC group (p < 0.05). However, steaming loss and drip loss did not differ significantly between the groups (p > 0.05).

3.6. Texture Profile Analysis (TPA) and Shear Force Tests of Muscle

Testing with TPA and shear force were used to examine the textural change that occurred during processing. As described in Table 7, gumminess in the HC group was markedly higher than in the LC group (p < 0.05). Additionally, as showed in Table 6, the anterior dorsal muscle, abdominal muscle, and posterior dorsal muscle in the HCN group displayed a significant reduction in chewiness, firmness, and hardness compared to all other groups.

3.7. Muscle Cellularity and Histology Analysis

Table 8 provides insights into muscle cellularity. The horizontal diameter (HD) exhibited a significant decrease in the LC group but a notable increase in the HC group (p < 0.05). Furthermore, the HC group’s longitudinal diameter (LD) and cross-sectional area (CSA) were significantly higher than the LC group’s (p < 0.05). In contrast, the myofiber density (MD) was markedly higher in the LC group than in the other groups (p < 0.05). Histologically, the muscle fibers in the HC group showed obvious rupture, resulting in an incomplete muscle structure, while the HCN group’s muscle fiber rupture was alleviated (Figure 2).

3.8. Analysis of Antioxidant Enzymes in the Muscle

As can be seen from Figure 3, MDA and SOD in the HC group were significantly increased compared with the other groups (p < 0.05). However, T-AOC did not differ significantly (p > 0.05).

3.9. Real-Time Quantitative PCR Analysis in Muscle

It can be observed in Figure 4 that compared with other groups, the expression levels of MSTN, myf5, and myf6 were up-regulated (p < 0.05) in the HC group. Myod expression did not differ significantly (p > 0.05).

4. Discussion

Due to the shortage of fish meal resources, carbohydrates are often used to replace fish meal in the diet, thus saving protein and reducing feed costs. But research has indicated that adding high carbohydrate to the diet will lead to changes in factors such as muscle fatty acid [27] and nutrient composition, which will have an impact on muscle quality [28]. Healthy and effective feed additives can ameliorate the negative impact of a high-carbohydrate diet on aquatic animals [4,29]. Therefore, this study intended to appraise whether the supplementation of nano-curcumin to high-carbohydrate diet might improve largemouth bass muscle quality.
The color of the fillet is the most intuitive indicator of consumer choice. In this study, the anterior dorsal muscle in the HC group had the highest a* value. The cause may be attributed to perimortem stress, which corresponds with the Atlantic salmon research [30]. According to our research, the addition of nano-curcumin resulted in an increased L* value in muscle compared to the HC diet group. This indicated that nano-curcumin availably enhances the muscle color [31], thus making largemouth bass muscle more desirable to consumers.
The meat quality of fish serves as an indicator reflecting the nutritive quality of muscle, encompassing parameters such as crude protein and crude lipid [32]. Our study indicates that the effects of LC and HC diets on crude protein and crude lipid in largemouth bass were not significant. This outcome may be due to the limited carbohydrate utilization observed in largemouth bass. A similar outcome was also observed in grass carp [33]. Curcumin’s inhibitory effect on lipogenesis has been reported in previous literature [34]. In alignment with these reports, our study demonstrated a significant reduction in crude lipid content in both whole fish and muscle. In addition, there was no significant difference in protein between whole fish and muscle in the HCN group, which was consistent with the results of the study of large yellow croaker [35]. However, studies have shown that nano-curcumin can promote protein deposition [36]. There is no consensus on a reasonable explanation for this difference, which may be related to the size, variety, feed composition, farming environment, or differences of the nanocarriers.
Product quality is the decisive factor affecting consumers’ behavior of buying fish [37]. As a rule, meat quality is a complex issue, which involves textural properties in addition to nutrient composition. Texture is a kind of sensory quality, which can be associated with juiciness and tenderness, specifically manifested as hardness, adhesiveness, cohesiveness, chewiness, and firmness, and is a crucial parameter for assessing the quality of fish [8]. According to the results of this investigation, different parts of fish in the HCN group showed lower chewability, firmness, and hardness, indicating that the meat was more tender in the HCN group. Muscle fiber structure (muscle fiber diameter and density) is one of the primary elements influencing the hardness of fish muscle [38]. The increase in muscle hardness demonstrated a positive correlation with the augmentation of muscle fiber density and an inverse correlation with the augmentation of muscle fiber diameter [39]. In the current investigation, both LD and CSA increased, and MD decreased, in the HC group, which corresponds with Huang [9]. The HCN group showed larger HD and smaller MD, indicating that the muscle was tender with the addition of nano-curcumin.
WHC is related to the quality of the fish, such as affecting the texture, juiciness, tenderness, and flavor of the meat [40]. With high WHC, the meat will be juicy and tender; conversely, the flavor and nutritional value of the meat will be severely reduced. In the current results, the HCN group has the lowest refrigeration loss and the best WHC, improving tenderness. In addition, studies have shown a negative relationship between WHC and MDA content in muscle [41]. Compared with the HC group, MDA content in the HCN group was significantly reduced in the present study. Therefore, the HCN group may improve water-holding capacity (WHC) by reducing oxidative damage. To sum up, the aforementioned findings demonstrate that the addition of a nano-curcumin supplement to a high-carbohydrate diet results in tender and juicy largemouth bass muscle.
The flavor of fish muscle is primarily determined by umami amino acids and fatty acids compounds [42]. Among them, Asp, Arg, Tyr, and Glu contribute to umami, whereas Gly, Pro, Ser, and Ala participate in sweetness [43], and Leu, Ile, His, and Phe are bitter [44]. Research has shown that increasing specific amino acids, like Ser, Asp, and Ala, in muscle may boost the flavor of fish [45]. As can be seen from our results, the HC group exhibited the least favorable taste perception (with the highest Ile and His), and the HCN group exhibited the most preferred taste perception (with the highest Arg and Tyr). Fatty acids behave differently in terms of flavor depending on their oxidation products. PUFA oxidizes to form a variety of small molecule volatile compounds that produce flavor and odor. The n-3 PUFA in muscle produces a pleasant flavor [46], while the n-6 PUFA produces an odor [47]. In pork, reduced C16:1 content is associated with a deterioration in the flavor and texture of the meat [48]. Therefore, it is reasonable to speculate that an increase of PUFA and C20:2n6 and a decrease of C16:1 in largemouth bass would deteriorate the texture and flavor of fish muscle. As far as we are aware, this is the initial evidence showing that supplementation of nano-curcumin in high-carbohydrate diets can enhance the meatiness and relish of fish muscle.
Oxidation reaction not only reduces the nutritional value of the meat but also causes changes in muscle texture, color, and odor, which affects the consumer’s desire to consume. MDA, as a major product of lipid oxidation, is highly biotoxic and is often used as a key indicator for evaluating muscle-quality deterioration in aquatic products [49]. Numerous research works have demonstrated that curcumin influences antioxidant enzymes in different tissues [50,51]. This research found that a high-carbohydrate diet increased MDA content in largemouth bass and decreased MDA activity after the addition of nano-curcumin. These results indicate that adding nano-curcumin to a high-carbohydrate diet can reduce oxidative damage and improve muscle quality. SOD has the function of scavenging free radicals. The SOD content was elevated in the HC group, which may be attributed to the large number of free radicals produced in the fish as a result of stress, thus inducing an enhanced SOD activity to scavenge free radicals. Rainbow trout had similar outcomes [52].
Screening and functional verification of genes related to meat-quality traits can improve meat quality. MRFs are regulators within the sarcomere, and their main function is to regulate the proliferation and hypertrophy [53]. During the whole muscle cell cycle, MRFs first regulate the activation and development of muscle cells through myf5 and myoD, and then initiate the cell differentiation and fusion process by myog and MRF4/Myf6 [54]. The MSTN inhibits skeletal muscle growth and development in vertebrates (including bony animals) [55], but also leads to fat accumulation [56]. In the current investigation, the expression levels of myf5, myf6, and MSTN in the HCN group were downregulated compared with the HC group, so we speculated that a high-carbohydrate diet could promote myoblast proliferation and differentiation but would lead to fat accumulation. Although the supplementation of nano-curcumin did not significantly affect muscle growth, it reduced fat accumulation, which was consistent with the outcomes of muscle nutrient content.

5. Conclusions

Based on the results, the consumption of a high-carbohydrate diet by largemouth bass promotes the proliferation and differentiation of muscle fiber but can increase bitterness. In contrast, the addition of nano-curcumin to a high-carbohydrate diet improved its nutritional value and meat quality by increasing muscle flavor, WHC, and tenderness, and by reducing fat deposition and oxidative damage to muscle.

Author Contributions

Data curation, Y.W., J.C., X.B., and X.C.; Formal analysis, Y.W., J.C., K.Z., X.B., and Z.L.; Funding acquisition, Y.Y.; Methodology, Y.W., J.C., K.Z., X.B., S.X., Z.L., and X.C.; Resources, Y.Y.; Visualization, Y.W., J.C., K.Z., and S.X.; Writing—original draft, Y.W.; Writing—review & editing, Y.W., J.C., and Y.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the fund of National Natural Science Foundation of China (32202911), the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precise Breeding (2019B030301010), The Guangdong Basic and Applied Basic Research Foundation (2019A1515110068), and Key-Area Research and Development Program of Guangdong Province (2019B110209005).

Institutional Review Board Statement

The Animal Research Committee of Foshan University Animal Ethics Committee granted ethical approval for the experiment (approval number: 2020056, date: 6 May 2020).

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors thank the participants who gave their time to the experiment. We would like to thank the following people for their help in this study: Yuhua Yue, Yanmin Qiu, Xianjun Feng, and Zhuozhi Ou.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

MDA, malondialdehyde; SOD, Superoxide dismutase; T-AOC, Total antioxidant capacity; MRFS, myogenic regulatory factor; MSTN, myostatin; myoD, myoblast determinant; Myf5, myogenic factor 5; myog, myogenic hormone; Myf6, myogenic regulatory factor 6; WHC, water-holding capacity; TPA, texture profile analysis; AA, amino acid; FA, fatty acid; H&E, ematoxylin and eosin; L*, brightness; a*, redness; b*, yellowness; SFA, saturated fatty acids; MUFA, monounsaturated fatty acids; n-6PUFA, n-6 polyunsaturated fatty acids; PUFA, total polyunsaturated fatty acids; HD, horizontal diameter; LD, longitudinal diameter; CSA, cross sectional area; MD, Myofiber density.

References

  1. Wang, D.; Yao, H.; Li, Y.H.; Xu, Y.J.; Ma, X.F.; Wang, H.P. Global diversity and genetic landscape of natural populations and hatchery stocks of largemouth bass (Micropterus salmoides) across American and Asian regions. Sci. Rep. 2019, 9, 16697. [Google Scholar] [CrossRef]
  2. Zhao, T.; Wu, K.; Hogstrand, C.; Xu, Y.H.; Chen, G.H.; Wei, C.C.; Luo, Z. Lipophagy mediated carbohydrate-induced changes of lipid metabolism via oxidative stress, endoplasmic reticulum (ER) stress and ChREBP/PPARγ pathways. Cell. Mol. Life Sci. 2020, 77, 1987–2003. [Google Scholar] [CrossRef]
  3. Bao, S.T.; Liu, X.C.; Huang, X.P.; Guan, J.F.; Xie, D.Z.; Li, S.A.; Xu, C. Magnesium supplementation in high carbohydrate diets: Implications on growth, muscle fiber development and flesh quality of Megalobrama amblycephala. Aquac. Rep. 2022, 23, 101039. [Google Scholar] [CrossRef]
  4. Wu, H.X.; Li, W.J.; Shan, C.J.; Zhang, Z.Y.; Lv, H.B.; Qiao, F.; Du, Z.; Zhang, M. Oligosaccharides improve the flesh quality and nutrition value of Nile tilapia fed with high carbohydrate diet. Food Chem. Mol. Sci. 2021, 3, 100040. [Google Scholar] [CrossRef]
  5. Amoah, A.; Coyle, S.D.; Webster, C.D.; Durborow, R.M.; Bright, L.A.; Tidwell, J.H. Effects of graded levels of carbohydrate on growth and survival of largemouth bass. J. World Aquacult. Soc. 2008, 39, 397–405. [Google Scholar] [CrossRef]
  6. Lin, S.M.; Shi, C.M.; Mu, M.M.; Chen, Y.J.; Luo, L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, Micropterus salmoides. Fish Shellfish. Immunol. 2018, 78, 121–126. [Google Scholar] [CrossRef]
  7. Zhange, Y.; Xie, S.; Wei, H.; Zheng, L.; Liu, Z.; Fang, H.; Xie, J.; Liao, S.; Tian, L.; Liu, Y.; et al. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, Micropterus salmoides. Aquac. Nutr. 2020, 26, 1083–1095. [Google Scholar] [CrossRef]
  8. Cheng, J.H.; Sun, D.W.; Han, Z.; Zeng, X.A. Texture and Structure Measurements and Analyses for Evaluation of Fish and Fillet Freshness Quality: A Review. Compr. Rev. Food Sci. Food Saf. 2014, 13, 52–61. [Google Scholar] [CrossRef]
  9. Huang, Y.Y.; Jiang, G.Z.; Abasubong, K.P.; Wang, C.C.; Zhang, L.; Dai, Y.J.; Zheng, X.C.; Cao, X.F.; He, C.; Wang, X.; et al. High lipid and high carbohydrate diets affect muscle growth of blunt snout bream (Megalobrama amblycephala) through different signaling pathways. Aquaculture 2022, 548, 737495. [Google Scholar] [CrossRef]
  10. Zhou, C.; Ge, X.; Niu, J.; Lin, H.; Huang, Z.; Tan, X. Effect of dietary carbohydrate levels on growth performance, body composition, intestinal and hepatic enzyme activities, and growth hormone gene expression of juvenile golden pompano, Trachinotus ovatus. Aquaculture 2015, 437, 390–397. [Google Scholar] [CrossRef]
  11. Kunnumakkara, A.B.; Bordoloi, D.; Padmavathi, G.; Monisha, J.; Roy, N.K.; Prasad, S.; Aggarwal, B.B.; Dardevet, D.; Astruc, T. Curcumin, the golden nutraceutical: Multitargeting for multiple chronic diseases. Br. J. Pharmacol. 2017, 174, 1325–1348. [Google Scholar] [CrossRef] [PubMed]
  12. Vazeille, E.; Slimani, L.; Claustre, A.; Magne, H.; Labas, R.; Béchet, D.; Taillandier, D.; Attaix, D. Curcumin treatment prevents increased proteasome and apoptosome activities in rat skeletal muscle during reloading and improves subsequent recovery. J. Nutr. Biochem. 2012, 23, 245–251. [Google Scholar] [CrossRef]
  13. Gorza, L.; Germinario, E.; Vitadello, M.; Guerra, I.; De Majo, F.; Gasparella, F.; Caliceti, P.; Vitiello, L.; Danieli-Betto, D. Curcumin Administration Improves Force of mdx Dystrophic Diaphragm by Acting on Fiber-Type Composition, Myosin Nitrotyrosination and SERCA1 Protein Levels. Antioxidants 2023, 12, 1181. [Google Scholar] [CrossRef]
  14. Li, X.; Wu, L.; Duan, L.; Wang, W.; Zhao, P.; Wu, M.; Song, W.; Huang, F. Effects of Dietary Curcumin on Growth and Flesh Quality in Juvenile Genetically Improved Farmed Tilapia (GIFT, Oreochromis niloticus). Aquac. Res. 2023, 2023, 6013669. [Google Scholar] [CrossRef]
  15. Jiang, J.Y.; Wen, H.; Jiang, M.; Tian, J.; Dong, L.X.; Shi, Z.C.; Zhou, T.; Lu, X.; Liang, H.W. Dietary Curcumin Supplementation Could Improve Muscle Quality, Antioxidant Enzyme Activities and the Gut Microbiota Structure of Pelodiscus sinensis. Animals 2023, 13, 2626. [Google Scholar] [CrossRef]
  16. Pirani, F.; Moradi, S.; Ashouri, S.; Johari, S.A.; Ghaderi, E.; Kim, H.P.; Yu, L. Dietary supplementation with curcumin nanomicelles, curcumin, and turmeric affects growth performance and silver nanoparticle toxicity in Cyprinus carpio. Environ. Sci. Pollut. Res. 2021, 28, 64706–64718. [Google Scholar] [CrossRef] [PubMed]
  17. Gupta, S.C.; Patchva, S.; Aggarwal, B.B. Therapeutic roles of curcumin: Lessons learned from clinical trials. AAPS J. 2013, 15, 195–218. [Google Scholar] [CrossRef] [PubMed]
  18. Salehi, B.; Calina, D.; Docea, A.O.; Koirala, N.; Aryal, S.; Lombardo, D.; Pasqua, L.; Taheri, Y.; Castillo, C.M.S.; Martorell, M.; et al. Curcumin’s Nanomedicine Formulations for Therapeutic Application in Neurological Diseases. J. Clin. Med. 2020, 9, 430. [Google Scholar] [CrossRef]
  19. Wu, X.; Castillo, S.; Rosales, M.; Burns, A.; Mendoza, M.; Gatlin, D.M. Relative use of dietary carbohydrate, non-essential amino acids, and lipids for energy by hybrid striped bass, Morone chrysops ♀ × M. saxatilis ♂. Aquaculture 2015, 435, 116–119. [Google Scholar] [CrossRef]
  20. Zhao, W.; Jin, M.; Zhu, T.; Xie, S.; Yang, Y.; Li, X.; Zhou, Q. Dietary starch level regulates the growth and glycolipid metabolism through the insulin-PI3K-AKT signaling pathway of juvenile mud crab (Scylla paramamosain). Aquac. Rep. 2024, 36, 102124. [Google Scholar] [CrossRef]
  21. Lu, H.; Wang, H.; Luo, Y.K. Changes in Protein Oxidation, Water-Holding Capacity, and Texture of Bighead Carp (Aristichthys Nobilis) Fillets under Chilled and Partial Frozen Storage. J. Aquat. Food Prod. Technol. 2017, 26, 566–577. [Google Scholar] [CrossRef]
  22. Du, X.; Chang, P.; Tian, J.; Kong, B.; Sun, F.; Xia, X. Effect of ice structuring protein on the quality, thermal stability and oxidation of mirror carp (Cyprinus carpio L.) induced by freeze-thaw cycles. LWT 2020, 124, 109140. [Google Scholar] [CrossRef]
  23. Li, H.; Chen, Y.; Li, M.; Huang, J.; Zu, X.; Liao, T.; Xiong, G.P. Effects of temporary rearing with organic selenium on the muscle flavor and texture properties of largemouth bass (Micropterus salmonides). Food Chem. 2022, 397, 133747. [Google Scholar] [CrossRef] [PubMed]
  24. Zhu, T.; Yang, R.; Xiao, R.; Ni, W.; Liu, L.; Zhao, J.; Ye, Z. Effect of swimming training on the flesh quality in Chinese Perch (Siniperca chuatsi) and its relationship with muscle metabolism. Aquaculture 2023, 577, 739926. [Google Scholar] [CrossRef]
  25. Huang, B.; Zhang, S.; Dong, X.; Chi, S.; Yang, Q.; Liu, H.; Tan, B.; Xie, S. Effects of fishmeal replacement by black soldier fly on growth performance, digestive enzyme activity, intestine morphology, intestinal flora and immune response of pearl gentian grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Fish Shellfish Immunol. 2022, 120, 497–506. [Google Scholar] [CrossRef]
  26. Kari, Z.A.; Kabir, M.A.; Dawood, M.A.O.; Razab, M.K.A.A.; Ariff, N.S.N.A.; Sarkar, T.; Pati, S.; Edinur, H.; Mat, K.; Ismail, T.; et al. Effect of fish meal substitution with fermented soy pulp on growth performance, digestive enzyme, amino acid profile, and immune-related gene expression of African catfish (Clarias gariepinus). Aquaculture 2022, 546, 737418. [Google Scholar] [CrossRef]
  27. Wang, B.K.; Liu, W.B.; Xu, C.; Cao, X.F.; Zhong, X.Q.; Shi, H.J.; Li, X.F. Dietary carbohydrate levels and lipid sources modulate the growth performance, fatty acid profiles and intermediary metabolism of blunt snout bream Megalobrama amblycephala in an interactive pattern. Aquaculture 2017, 481, 140–153. [Google Scholar] [CrossRef]
  28. Zhou, C.; Ge, X.; Liu, B.; Xie, J.; Chen, R.; Miao, L.; Ren, M. Comparative study on the effect of high dietary carbohydrate on the growth performance, body composition, serum physiological responses and hepatic antioxidant abilities in Wuchang bream (Megalobrama amblycephala) and black carp (Mylopharyngodon piceus Richardson, 1846). Aquac. Res. 2017, 48, 1020–1030. [Google Scholar] [CrossRef]
  29. Fang, Z.; Gong, Y.; Han, Z.; Xie, R.; Li, W.; Zhang, H.; Chen, N.; Li, S. Dietary sodium diacetate inclusion relieved hepatic glycogen deposition, oxidative stress, and intestinal microbial imbalance of largemouth bass (Micropterus salmoides) fed high dietary carbohydrate. Aquaculture 2024, 580, 740307. [Google Scholar] [CrossRef]
  30. Erikson, U.; Misimi, E. Atlantic salmon skin and fillet color changes effected by perimortem handling stress, rigor mortis, and ice storage. J. Food Sci. 2008, 73, C50–C59. [Google Scholar] [CrossRef]
  31. Yu, H.; Liang, H.; Ge, X.; Zhu, J.; Wang, Y.; Ren, M.; Chen, X. Dietary chlorella (Chlorella vulgaris) supplementation effectively improves body color, alleviates muscle inflammation and inhibits apoptosis in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 127, 140–147. [Google Scholar] [CrossRef] [PubMed]
  32. Listrat, A.; Lebret, B.; Louveau, I.; Astruc, T.; Bonnet, M.; Lefaucheur, L.; Picard, B.; Bugeon, J. How Muscle Structure and Composition Influence Meat and Flesh Quality. Sci. World J. 2016, 2016, 3182746. [Google Scholar] [CrossRef] [PubMed]
  33. Xu, T.; Liu, X.; Huang, W.; Li, G.; Zhang, Y.; Xu, D.; Wang, G. Effects of dietary carbohydrate levels on growth, metabolic enzyme activities and oxidative status of hybrid snakehead (Channa maculata ♀ × Channa argus ♂). Aquaculture 2023, 563, 738960. [Google Scholar] [CrossRef]
  34. Shao, W.; Yu, Z.; Chiang, Y.; Yang, Y.; Chai, T.; Foltz, W.; Lu, H.; Fantus, I.; Jin, T. Curcumin prevents high fat diet induced insulin resistance and obesity via attenuating lipogenesis in liver and inflammatory pathway in adipocytes. PLoS ONE 2012, 7, e28784. [Google Scholar] [CrossRef] [PubMed]
  35. Ji, R.; Xiang, X.; Li, X.; Mai, K.; Ai, Q. Effects of dietary curcumin on growth, antioxidant capacity, fatty acid composition and expression of lipid metabolism-related genes of large yellow croaker fed a high-fat diet. Br. J. Nutr. 2021, 126, 345–354. [Google Scholar] [CrossRef]
  36. Lee, D.Y.; Chun, Y.S.; Kim, J.K.; Lee, J.O.; Ku, S.K.; Shim, S.M. Curcumin Attenuates Sarcopenia in Chronic Forced Exercise Executed Aged Mice by Regulating Muscle Degradation and Protein Synthesis with Antioxidant and Anti-inflammatory Effects. J. Agric. Food Chem. 2021, 69, 6214–6228. [Google Scholar] [CrossRef] [PubMed]
  37. Gatlin Iii, D.M.; Barrows, F.T.; Brown, P.; Dabrowski, K.; Gaylord, T.G.; Hardy, R.W.; Herman, E.; Hu, G.; Krogdahl, A.; Nelson, R.; et al. Expanding the utilization of sustainable plant products in aquafeeds: A review. Aquac. Res. 2007, 38, 551–579. [Google Scholar] [CrossRef]
  38. Chen, L.; Liu, J.; Kaneko, G.; Xie, J.; Wang, G.; Yu, D.; Li, Z.; Ma, L.; Qi, D.; Tian, J.; et al. Quantitative phosphoproteomic analysis of soft and firm grass carp muscle. Food Chem. 2020, 303, 125367. [Google Scholar] [CrossRef]
  39. Yu, E.M.; Zhang, H.F.; Li, Z.F.; Wang, G.J.; Wu, H.K.; Xie, J.; Yu, D.; Xia, Y.; Zhang, K.; Gong, W. Proteomic signature of muscle fibre hyperplasia in response to faba bean intake in grass carp. Sci. Rep. 2017, 7, 45950. [Google Scholar] [CrossRef]
  40. Wright, L.I.; Scanga, J.A.; Belk, K.E.; Engle, T.E.; Tatum, J.D.; Person, R.C.; McKenna, D.R.; Griffin, D.B.; McKeith, F.K.; Savell, J.W.; et al. Benchmarking value in the pork supply chain: Characterization of US pork in the retail marketplace. Meat Sci. 2005, 71, 451–463. [Google Scholar] [CrossRef]
  41. Zhao, H.F.; Feng, L.; Jiang, W.D.; Liu, Y.; Jiang, J.; Wu, P.; Zhao, J.; Kuang, S.; Tang, L.; Tang, W.; et al. Flesh Shear Force, Cooking Loss, Muscle Antioxidant Status and Relative Expression of Signaling Molecules (Nrf2, Keap1, TOR, and CK2) and Their Target Genes in Young Grass Carp (Ctenopharyngodon idella) Muscle Fed with Graded Levels of Choline. PLoS ONE 2015, 10, e0142915. [Google Scholar] [CrossRef]
  42. Reina, R.; del Pulgar, J.S.; López-Buesa, P.; García, C. Amino acid and nucleotide contents and sensory traits of dry-cured products from pigs with different genotypes. Meat Sci. 2014, 96, 230–236. [Google Scholar] [CrossRef]
  43. Jiang, W.D.; Wen, H.L.; Liu, Y.; Jiang, J.; Wu, P.; Zhao, J.; Kang, S.; Tang, L.; Tang, W.; Zhang, Y.A.; et al. Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): Avoid tryptophan deficiency or excess. Food Chem. 2016, 199, 210–219. [Google Scholar] [CrossRef] [PubMed]
  44. Lee, C.W.; Lee, J.R.; Kim, M.K.; Jo, C.; Lee, K.H.; You, I.; Jung, S. Quality Improvement of Pork Loin by Dry Aging. Korean J. Food Sci. Anim. Resour. 2016, 36, 369–376. [Google Scholar] [CrossRef] [PubMed]
  45. Yang, B.; Jiang, W.D.; Wu, P.; Liu, Y.; Zeng, Y.Y.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.N.; Wang, S.; et al. Soybean isoflavones improve the health benefits, flavour quality indicators and physical properties of grass carp (Ctenopharygodon idella). PLoS ONE 2019, 14, e0209570. [Google Scholar] [CrossRef] [PubMed]
  46. Osorio, M.T.; Zumalacárregui, J.M.; Cabeza, E.A.; Figueira, A.; Mateo, J. Effect of rearing system on some meat quality traits and volatile compounds of suckling lamb meat. Small Rumin. Res. 2008, 78, 1–12. [Google Scholar] [CrossRef]
  47. Turchini, G.M.; Mentasti, T.; Caprino, F.; Panseri, S.; Moretti, V.M.; Valfrè, F. Effects of dietary lipid sources on flavour volatile compounds of brown trout (Salmo Trutta L.). Fill. J. Appl. Ichthyol. 2004, 20, 71–75. [Google Scholar] [CrossRef]
  48. Kris-Etherton, P.M.; Pearson, T.A.; Wan, Y.; Hargrove, R.L.; Moriarty, K.; Fishell, V.; Etherton, T. High-monounsaturated fatty acid diets lower both plasma cholesterol and triacylglycerol concentrations. Am. J. Clin. Nutr. 1999, 70, 1009–1015. [Google Scholar] [CrossRef]
  49. Shi, G.; Gao, T.; Li, X.; Shi, L.; Chen, S.; Ding, A.; Li, X.; Qiao, Y.; Liao, L.; Xiong, G.; et al. Integrating transcriptomic and metabolomic analysis to understand muscle qualities of red swamp crayfish (Procambarus clarkii) under transport stress. Food Res. Int. 2023, 164, 112361. [Google Scholar] [CrossRef]
  50. Memarzia, A.; Khazdair, M.R.; Behrouz, S.; Gholamnezhad, Z.; Jafarnezhad, M.; Saadat, S.; Boskabady, M. Experimental and clinical reports on anti-inflammatory, antioxidant, and immunomodulatory effects of Curcuma longa and curcumin, an updated and comprehensive review. BioFactors 2021, 47, 311–350. [Google Scholar] [CrossRef]
  51. Meng, B.; Li, J.; Cao, H. Antioxidant and antiinflammatory activities of curcumin on diabetes mellitus and its complications. Curr. Pharm. Des. 2013, 19, 2101–2113. [Google Scholar] [PubMed]
  52. Wu, Y.; Zhao, M.; Xia, Y.; Sun, W.; Xiong, G.; Shi, L.; Tiao, Y.; Wu, W.; Ding, A.; Chen, L.; et al. Deterioration of muscle quality caused by ammonia exposure in rainbow trout (Oncorhynchus mykiss). Food Biosci. 2023, 53, 102609. [Google Scholar] [CrossRef]
  53. Azm, F.R.A.; Kong, F.; Tan, Q.; Zhu, Y.; Yu, H.; Yao, J.; Luo, Z. Effects of replacement of dietary rapeseed meal by distiller’s dried grains with solubles (DDGS) on growth performance, muscle texture, health and expression of muscle-related genes in grass carp (Ctenopharyngodon idellus). Aquaculture 2021, 533, 736169. [Google Scholar] [CrossRef]
  54. Xiao, K.; Wang, X.; Dai, Y.J.; Huang, Y.Y.; Wang, M.M.; Guo, H.X.; Liu, W.; Li, X.; Abasubong, K.; Jiang, G.; et al. Hypoxia mediates Hif-1α to affect myofiber development and Vc regulates the influence by activating Shh-Gli pathway in channel catfish (Ictalurus punctatus). Aquaculture 2023, 562, 738849. [Google Scholar] [CrossRef]
  55. Sáez-Arteaga, A.; Wu, Y.; Silva-Marrero, J.I.; Rashidpour, A.; Almajano, M.P.; Fernández, F.; Baanante, I.; Metón, I. Gene markers of dietary macronutrient composition and growth in the skeletal muscle of gilthead sea bream (Sparus aurata). Aquaculture 2022, 555, 738221. [Google Scholar] [CrossRef]
  56. McPherron, A.C.; Lee, S.J. Suppression of body fat accumulation in myostatin-deficient mice. J. Clin. Investig. 2002, 109, 595–601. [Google Scholar] [CrossRef] [PubMed]
Fishes 09 00344 g001
Figure 1. Effect of nano-curcumin supplementation on pH and color of anterior (a) and posterior (b) dorsal muscle of largemouth bass in high-carbohydrate diets. Different superscript letters indicate significant differences (p < 0.05), and the same letters or no letters indicate insignificant differences (p > 0.05). L*, brightness; a*, redness; b*, yellowness.
Figure 1. Effect of nano-curcumin supplementation on pH and color of anterior (a) and posterior (b) dorsal muscle of largemouth bass in high-carbohydrate diets. Different superscript letters indicate significant differences (p < 0.05), and the same letters or no letters indicate insignificant differences (p > 0.05). L*, brightness; a*, redness; b*, yellowness.
Fishes 09 00344 g001
Fishes 09 00344 g002
Figure 2. Effects of a high-carbohydrate diet supplemented with nano-curcumin on muscle cellularity and histology analysis of largemouth bass. (a) LC; (b) HC; (c) HCN. The black arrows point to broken muscle fibers.
Figure 2. Effects of a high-carbohydrate diet supplemented with nano-curcumin on muscle cellularity and histology analysis of largemouth bass. (a) LC; (b) HC; (c) HCN. The black arrows point to broken muscle fibers.
Fishes 09 00344 g002
Fishes 09 00344 g003
Figure 3. Effects of a high-carbohydrate diet supplemented with nano-curcumin on muscle. (a) malondialdehyde content (MDA), (b) total antioxidant capacity T-AOC, and (c) superoxide dismutase activity (SOD) of largemouth bass. Different superscript letters indicate significant differences (p < 0.05), and the same letters or no letters indicate insignificant differences (p > 0.05).
Figure 3. Effects of a high-carbohydrate diet supplemented with nano-curcumin on muscle. (a) malondialdehyde content (MDA), (b) total antioxidant capacity T-AOC, and (c) superoxide dismutase activity (SOD) of largemouth bass. Different superscript letters indicate significant differences (p < 0.05), and the same letters or no letters indicate insignificant differences (p > 0.05).
Fishes 09 00344 g003
Fishes 09 00344 g004
Figure 4. Effects of high-carbohydrate diet supplemented with nano-curcumin on relative mRNA expression level. ((a) MSTN; (b) myf6; (c) myf5; (d) myoD) of largemouth bass. Different superscript letters in each expression (myoD, Myf5, myf6, and MSTN) represent significant differences (p < 0.05).
Figure 4. Effects of high-carbohydrate diet supplemented with nano-curcumin on relative mRNA expression level. ((a) MSTN; (b) myf6; (c) myf5; (d) myoD) of largemouth bass. Different superscript letters in each expression (myoD, Myf5, myf6, and MSTN) represent significant differences (p < 0.05).
Fishes 09 00344 g004
Table 1. Proximate composition of experimental diets (% in dry matter).
Table 1. Proximate composition of experimental diets (% in dry matter).
ItemLCHCHCN
Moisture (%)7.367.427.33
Crude protein (%)42.0142.5643.57
Crude lipid (%)10.4110.1110.10
Crude ash (%)14.7114.6414.53
Table 2. Real-time q-PCR was used to detect the primer sequences.
Table 2. Real-time q-PCR was used to detect the primer sequences.
NamePrimer Sequences
β-actinF: AAAGGGAAATCGTGCGTGAC
R: AAGGAAGGCTGGAAGAGGG
myf5F: CTTTGAGACGTTGCACCTCG
R: TCCACCGCTCTCGTAACAG
myf6F: GGCCAGTCATGAGTACCACT
R: TCACAATGGATGACAGACGC
myodF: TCTGAAAAGTGACCGGAGCT
R: TAGATCACGTTCGGGTCCTG
MSTNF: ACCTTGGAGTGAATGTAGAC
R: GAGTGGAGTGGAGTGGAT
Table 3. Effects of high-carbohydrate diet supplemented with nano-curcumin on whole-body and muscle component composition of largemouth bass (%, dry weight).
Table 3. Effects of high-carbohydrate diet supplemented with nano-curcumin on whole-body and muscle component composition of largemouth bass (%, dry weight).
ItemLCHCHCN
Whole fish body composition
Crude lipid (%)30.78 ± 0.57 b30.44 ± 0.09 b28.39 ± 0.55 a
Crude ash (%)13.23 ± 0.1813.77 ± 0.2113.20 ± 0.47
Crude protein (%)37.70 ± 3.3738.19 ± 0.3841.80 ± 0.85
Muscle composition
Crude lipid (%)13.47 ± 0.22 ab14.02 ± 0.16 b12.94 ± 0.20 a
Crude ash (%)6.48 ± 0.076.48 ± 0.056.44 ± 0.05
Crude protein (%)68.30 ± 3.1069.41 ± 2.2670.03 ± 1.55
Data are expressed as mean ± S.E.M (n = 3). Values with different letters differ significantly (p < 0.05).
Table 4. Effects of a high-carbohydrate diet supplemented with nano-curcumin on the amino acid composition of largemouth bass (%, dry weight).
Table 4. Effects of a high-carbohydrate diet supplemented with nano-curcumin on the amino acid composition of largemouth bass (%, dry weight).
ItemLCHCHCN
Taurine0.25 ± 0.00 a0.29 ± 0.00 b0.20 ± 0.00 c
Threonine3.61 ± 0.023.62 ± 0.023.63 ± 0.00
Alanine4.94 ± 0.034.93 ± 0.034.98 ± 0.00
Valine3.64 ± 0.03 a3.72 ± 0.02 b3.74 ± 0.02 b
Methionine2.34 ± 0.022.37 ± 0.022.39 ± 0.00
Isoleucine3.26 ± 0.03 a3.34 ± 0.02 b3.38 ± 0.02 b
Leucine6.15 ± 0.056.22 ± 0.046.27 ± 0.00
Phenylalanine3.26 ± 0.033.26 ± 0.013.30 ± 0.01
Histidine1.96 ± 0.01 a2.01 ± 0.01 b1.99 ± 0.00 ab
Lysine7.35 ± 0.057.43 ± 0.067.46 ± 0.00
Arginine4.53 ± 0.02 a4.53 ± 0.01 a4.60 ± 0.00 b
Aspartic8.30 ± 0.068.38 ± 0.068.39 ± 0.01
Serine3.39 ± 0.023.42 ± 0.023.41 ± 0.00
Glutamate12.05 ± 0.0812.10 ± 0.0612.20 ± 0.00
Glycine4.35 ± 0.04 a4.35 ± 0.01 a4.26 ± 0.00 b
Cystine0.85 ± 0.00 a0.86 ± 0.00 b0.86 ± 0.00 b
Tyrosine2.67 ± 0.01 a2.67 ± 0.00 a2.69 ± 0.00 b
Proline3.04 ± 0.01 ab3.05 ± 0.01 a3.02 ± 0.00 b
Total amino acids75.94 ± 0.5076.55 ± 0.4076.78 ± 0.03
Data are expressed as mean ± S.E.M (n = 3). Values with different letters differ significantly (p < 0.05).
Table 5. Effects of high-carbohydrate diet supplemented with nano-curcumin on the fatty acid composition of largemouth bass (%, dry weight).
Table 5. Effects of high-carbohydrate diet supplemented with nano-curcumin on the fatty acid composition of largemouth bass (%, dry weight).
ItemLCHCHCN
SFA
C12:00.01 ± 0.000.02 ± 0.010.04 ± 0.01
C13:00.01 ± 0.000.00 ± 0.000.00 ± 0.00
C14:02.01 ± 0.061.85 ± 0.152.04 ± 0.04
C15:00.33 ± 0.010.32 ± 0.030.33 ± 0.06
C16:019.32 ± 0.0119.13 ± 0.0719.20 ± 0.10
C17:00.29 ± 0.00 a0.31 ± 0.01 b0.30 ± 0.00 ab
C18:04.93 ± 0.185.43 ± 0.345.12 ± 00
C20:00.27 ± 0.010.28 ± 0.000.28 ± 0.01
C21:00.03 ± 0.010.03 ± 0.000.03 ± 0.01
C22:00.17 ± 0.010.14 ± 0.010.16 ± 0.01
C23:01.42 ± 0.11.57 ± 0.11.48 ± 0.01
C24:00.11 ± 0.010.11 ± 0.010.12 ± 0.01
SFA28.95 ± 0.2029.20 ± 0.2629.10 ± 0.10
MUFA
C14:1n50.03 ± 0.000.03 ± 0.010.03 ± 0.00
C16:1n75.49 ± 0.09 b4.78 ± 0.31 a5.23 ± 0.74 ab
C17:1n70.26 ± 0.000.25 ± 0.010.25 ± 0.01
C18:1n9t0.26 ± 0.020.26 ± 0.030.24 ± 0.01
C18:1n9c24.63 ± 0.5223.17 ± 0.7623.93 ± 0.13
C20:1n92.02 ± 0.011.99 ± 0.022.04 ± 0.033
C22:1n90.16 ± 0.010.17 ± 0.000.15 ± 0.01
C24:1n90.56 ± 0.050.57 ± 0.040.60 ± 0.03
MUFA33.40 ± 0.5731.23 ± 1.0332.48 ± 0.17
n-6PUFA
C18:2n6c17.03 ± 0.2517.05 ± 0.5217.49 ± 0.09
C18:3n60.21 ± 0.010.21 ± 0.010.22 ± 0.02
C20:2n60.40 ± 0.02 a0.47 ± 0.03 b0.48 ± 0.01 b
C20:3n60.49 ± 0.020.52 ± 0.010.48 ± 0.01
C20:4n60.03 ± 0.000.03 ± 0.010.03 ± 0.01
C22:2n60.02 ± 0.010.01 ± 0.000.03 ± 0.02
n-6PUFA18.18 ± 0.2218.29 ± 0.4918.72 ± 0.03
n-3PUFA
C18:3n31.10 ± 0.0341.07 ± 0.051.10 ± 0.00
C20:3n30.15 ± 0.010.11 ± 0.010.14 ± 0.01
C20:5n32.09 ± 0.062.19 ± 0.122.12 ± 0.03
C22:6n316.12 ± 0.5917.89 ± 1.1916.32 ± 0.27
n-3PUFA19.46 ± 0.6021.26 ± 1.2619.68 ± 0.31
PUFA37.63 ± 0.40 a39.55 ± 0.78 b38.40 ± 0.28 ab
SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; Data are expressed as mean ± S.E.M (n = 3). Values with different letters differ significantly (p < 0.05).
Table 6. Effects of high-carbohydrate diet supplemented with nano-curcumin on water-holding capacity of largemouth bass.
Table 6. Effects of high-carbohydrate diet supplemented with nano-curcumin on water-holding capacity of largemouth bass.
ItemLCHCHCN
Refrigeration loss (%)2.44 ± 0.10 b2.26 ± 0.10 ab2.07 ± 0.11 a
Steaming loss (%)26.54 ± 0.7324.88 ± 0.4224.55 ± 0.75
Drip loss (%)3.29 ± 0.292.85 ± 0.142.80 ± 0.26
Data are expressed as mean ± S.E.M (n = 3). Values with different letters differ significantly (p < 0.05).
Table 7. Effects of high-carbohydrate diet supplemented with nano-curcumin on TPA and shear force of largemouth bass.
Table 7. Effects of high-carbohydrate diet supplemented with nano-curcumin on TPA and shear force of largemouth bass.
ItemLCHCHCN
TPA
Springiness0.42 ± 0.010.44 ± 0.010.43 ± 0.02
Cohesiveness0.50 ± 0.030.53 ± 0.030.49 ± 0.02
Gumminess1123.86 ± 59.84 a1420.53 ± 77.52 b1230.19 ± 27.56 ab
Resilience0.37 ± 0.020.38 ± 0.020.37 ± 0.02
Shear force
Anterior dorsal muscle
Chewiness (g/sec)252.50 ± 9.99 b233.98 ± 12.49 ab211.25 ± 6.63 a
Firmness (g/sec)252.56 ± 9.99 b234.03 ± 12.49 ab211.30 ± 6.29 a
Hardness (g/sec)224.35 ± 13.86 b202.08 ± 14.53 ab165.99 ± 6.90 a
Abdominal
Chewiness (g/sec)299.83 ± 9.32 b291.08 ± 18.94 b191.03 ± 12.28 a
Firmness (g/sec)299.88 ± 9.32 b291.14 ± 18.94 b191.08 ± 12.28 a
Hardness (g/sec)259.88 ± 13.89 b244.69 ± 20.43 b165.70 ± 23.63 a
Posterior dorsal muscle
Chewiness (g/sec)359.64 ± 14.76 b320.28 ± 28.21 b241.50 ± 15.34 a
Firmness (g/sec)359.69 ± 14.76 b320.34 ± 28.21 b241.55 ± 15.34 a
Hardness (g/sec)336.01 ± 19.53 b297.25 ± 16.76 b183.46 ± 14.99 a
Data are expressed as mean ± S.E.M (n = 3). Values with different letters differ significantly (p < 0.05).
Table 8. Effects of high-carbohydrate diet supplemented with nano-curcumin on muscle cellularity and histology of largemouth bass.
Table 8. Effects of high-carbohydrate diet supplemented with nano-curcumin on muscle cellularity and histology of largemouth bass.
ItemLCHCHCN
HD (μm)29.46 ± 0.03 a42.51 ± 2.34 b36.94 ± 0.24 c
LD (μm)53.82 ± 3.60 a72.90 ± 6.94 b60.62 ± 0.92 ab
CSA (μm2)1765.70 ± 155.90 a2930.51 ± 376.64 b2249.26 ± 60.27 ab
MD (NO./mm2)496 ± 25.97 b340.67 ± 30.89 a407 ± 11.02 a
HD, horizontal diameter; LD, longitudinal diameter; CSA, cross-sectional area; MD, myofiber density. Values with different letters differ significantly (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Y.; Chen, J.; Zhang, K.; Bao, X.; Xie, S.; Lin, Z.; Chen, X.; Yu, Y. Dietary Supplementation with Nano-Curcumin Improves the Meat Quality and Nutrition Value of Largemouth Bass (Micropterus salmoides) Fed with a High-Carbohydrate Diet. Fishes 2024, 9, 344. https://doi.org/10.3390/fishes9090344

AMA Style

Wang Y, Chen J, Zhang K, Bao X, Xie S, Lin Z, Chen X, Yu Y. Dietary Supplementation with Nano-Curcumin Improves the Meat Quality and Nutrition Value of Largemouth Bass (Micropterus salmoides) Fed with a High-Carbohydrate Diet. Fishes. 2024; 9(9):344. https://doi.org/10.3390/fishes9090344

Chicago/Turabian Style

Wang, Yamin, Jing Chen, Kaipeng Zhang, Xiaoxue Bao, Shan Xie, Zhenye Lin, Xiaotong Chen, and Yingying Yu. 2024. "Dietary Supplementation with Nano-Curcumin Improves the Meat Quality and Nutrition Value of Largemouth Bass (Micropterus salmoides) Fed with a High-Carbohydrate Diet" Fishes 9, no. 9: 344. https://doi.org/10.3390/fishes9090344

APA Style

Wang, Y., Chen, J., Zhang, K., Bao, X., Xie, S., Lin, Z., Chen, X., & Yu, Y. (2024). Dietary Supplementation with Nano-Curcumin Improves the Meat Quality and Nutrition Value of Largemouth Bass (Micropterus salmoides) Fed with a High-Carbohydrate Diet. Fishes, 9(9), 344. https://doi.org/10.3390/fishes9090344

Article Metrics

Back to TopTop