Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease
Abstract
:1. Introduction
2. Material and Methods
2.1. Experimental Design
2.2. Clinical Evaluations
2.3. Tissue Samples
2.4. Gene Expression Studies Using Reverse Transcription-Quantitative PCR (RT-qPCR)
2.5. Immunohistochemical Analysis
2.6. Microscopic Observation and Statistical Analysis
3. Results
3.1. The Placental Villi of Pregnant Women with CVD Display an Overexpression in the NRF2 Marker
3.2. KEAP1, CUL3 and GSK-3β Expression Level Is Increased in the Placental Villi of Women with CVD during Pregnancy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Soma-Pillay, P.; Nelson-Piercy, C.; Tolppanen, H.; Mebazaa, A. Physiological changes in pregnancy. Cardiovasc. J. Afr. 2016, 27, 89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Troiano, N.H. Physiologic and hemodynamic changes during pregnancy. AACN Adv. Crit. Care 2018, 29, 273–283. [Google Scholar] [CrossRef] [PubMed]
- Kodogo, V.; Azibani, F.; Sliwa, K. Role of pregnancy hormones and hormonal interaction on the maternal cardiovascular system: A literature review. Clin. Res. Cardiol. 2019, 108, 831–846. [Google Scholar] [CrossRef] [PubMed]
- Tan, E.K.; Tan, E.L. Alterations in physiology and anatomy during pregnancy. Best Pract. Res. Clin. Obstet. Gynaecol. 2013, 27, 791–802. [Google Scholar] [CrossRef]
- Djordje, R.; Slobodan, T. Prevention and treatment of venous disorders during pregnancy and the postpartum period—Servier—PhlebolymphologyServier—Phlebolymphology. Phlebolymphology 2017, 4, 160–172. [Google Scholar]
- Taylor, J.; Hicks, C.W.; Heller, J.A. The hemodynamic effects of pregnancy on the lower extremity venous system. J. Vasc. Surg. Venous Lymphat. Disord. 2018, 6, 246–255. [Google Scholar] [CrossRef]
- Labropoulos, N. How Does Chronic Venous Disease Progress from the First Symptoms to the Advanced Stages? A Review. Adv. Ther. 2019, 36, 13–19. [Google Scholar] [CrossRef] [Green Version]
- Cornu-Thenard, A.; Boivin, P. Chronic venous disease during pregnancy—Servier—PhlebolymphologyServier—Phlebolymphology. Phlebolymphology 2014, 21, 138–145. [Google Scholar]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Álvarez-Mon, M.A.; Chaowen, C.; Ruiz-Grande, F.; Pekarek, L.; Monserrat, J.; Asúnsolo, A.; García-Honduvilla, N.; et al. Understanding Chronic Venous Disease: A Critical Overview of Its Pathophysiology and Medical Management. J. Clin. Med. 2021, 10, 3239. [Google Scholar] [CrossRef]
- Bergan, J.J.; Pascarella, L.; Schmid-Schönbein, G.W. Pathogenesis of primary chronic venous disease: Insights from animal models of venous hypertension. J. Vasc. Surg. 2008, 47, 183–192. [Google Scholar] [CrossRef] [Green Version]
- Raffetto, J.D.; Mannello, F. Pathophysiology of chronic venous disease. Int. Angiol. 2014, 33, 212–221. [Google Scholar] [PubMed]
- Eberhardt, R.T.; Raffetto, J.D. Chronic venous insufficiency. Circulation 2014, 130, 333–346. [Google Scholar] [CrossRef] [PubMed]
- Lurie, F.; Passman, M.; Meisner, M.; Dalsing, M.; Masuda, E.; Welch, H.; Bush, R.L.; Blebea, J.; Carpentier, P.H.; De Maeseneer, M.; et al. The 2020 update of the CEAP classification system and reporting standards. J. Vasc. Surg. Venous Lymphat. Disord. 2020, 8, 342–352. [Google Scholar] [CrossRef] [PubMed]
- Salim, S.; Machin, M.; Patterson, B.O.; Onida, S.; Davies, A.H. Global Epidemiology of Chronic Venous Disease: A Systematic Review With Pooled Prevalence Analysis. Ann. Surg. 2021, 274, 971–976. [Google Scholar] [CrossRef]
- Davies AH The Seriousness of Chronic Venous Disease: A Review of Real-World Evidence—PubMed. Adv. Ther. 2019, 36 (Suppl. S1), 5–12. [CrossRef]
- García-Honduvilla, N.; Ortega, M.A.; Asúnsolo, Á.; Álvarez-Rocha, M.J.; Romero, B.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J. Placentas from women with pregnancy-associated venous insufficiency show villi damage with evidence of hypoxic cellular stress. Hum. Pathol. 2018, 77, 45–53. [Google Scholar] [CrossRef]
- Ortega, M.A.; Asúnsolo, Á.; Álvarez-Rocha, M.J.; Romero, B.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Remodelling of collagen fibres in the placentas of women with venous insufficiency during pregnancy. Histol. Histopathol. 2018, 33, 567–576. [Google Scholar] [CrossRef]
- Ortega, M.A.; Saez, M.A.; Fraile-Martínez, O.; Asúnsolo, Á.; Pekarek, L.; Bravo, C.; Coca, S.; Sainz, F.; Álvarez-Mon, M.; Buján, J.; et al. Increased angiogenesis and lymphangiogenesis in the placental villi of women with chronic venous disease during pregnancy. Int. J. Mol. Sci. 2020, 21, 2487. [Google Scholar] [CrossRef] [Green Version]
- Ortega, M.A.; Gómez-Lahoz, A.M.; Sánchez-Trujillo, L.; Fraile-Martinez, O.; García-Montero, C.; Guijarro, L.G.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Bujan, J.; et al. Chronic Venous Disease during Pregnancy Causes a Systematic Increase in Maternal and Fetal Proinflammatory Markers. Int. J. Mol. Sci. 2022, 23, 8976. [Google Scholar] [CrossRef]
- He, F.; Ru, X.; Wen, T. NRF2, a Transcription Factor for Stress Response and Beyond. Int. J. Mol. Sci. 2020, 21, 4777. [Google Scholar] [CrossRef]
- Ma, Q. Role of Nrf2 in Oxidative Stress and Toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ortega, M.A.; Sánchez-Trujillo, L.; Bravo, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Alvarez-Mon, M.A.; Sainz, F.; Alvarez-Mon, M.; Bujan, J.; et al. Newborns of Mothers with Venous Disease during Pregnancy Show Increased Levels of Lipid Peroxidation and Markers of Oxidative Stress and Hypoxia in the Umbilical Cord. Antioxidants 2021, 10, 980. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Martínez-Vivero, C.; Sainz, F.; Bravo, C.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Pregnancy-associated venous insufficiency course with placental and systemic oxidative stress. J. Cell. Mol. Med. 2020, 24, 4157–4170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eggler, A.L.; Small, E.; Hannink, M.; Mesecar, A.D. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1. Biochem. J. 2009, 422, 171–180. [Google Scholar] [CrossRef] [Green Version]
- Cullinan, S.B.; Gordan, J.D.; Jin, J.; Harper, J.W.; Diehl, J.A. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: Oxidative stress sensing by a Cul3-Keap1 ligase. Mol. Cell. Biol. 2004, 24, 8477–8486. [Google Scholar] [CrossRef] [Green Version]
- Satta, S.; Mahmoud, A.M.; Wilkinson, F.L.; Yvonne Alexander, M.; White, S.J. The Role of Nrf2 in Cardiovascular Function and Disease. Oxid. Med. Cell. Longev. 2017, 2017, 9237263. [Google Scholar] [CrossRef]
- Tantengco, O.A.G.; de Castro Silva, M.; Shahin, H.; Bento, G.F.C.; Cursino, G.C.; Cayenne, S.; da Silva, M.G.; Menon, R. The role of nuclear factor erythroid 2-related factor 2 (NRF2) in normal and pathological pregnancy: A systematic review. Am. J. Reprod. Immunol. 2021, 86, e13496. [Google Scholar] [CrossRef]
- Chomczynski, P.; Sacchi, N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: Twenty-something years on. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
- Vallone, P.M.; Butler, J.M. AutoDimer: A screening tool for primer-dimer and hairpin structures. Biotechniques 2004, 37, 226–231. [Google Scholar] [CrossRef] [Green Version]
- Jang, S.J.; Jeon, R.H.; Kim, H.D.; Hwang, J.C.; Lee, H.J.; Bae, S.G.; Lee, S.L.; Rho, G.J.; Kim, S.J.; Lee, W.J. TATA box binding protein and ribosomal protein 4 are suitable reference genes for normalization during quantitative polymerase chain reaction study in bovine mesenchymal stem cells. Asian-Australas. J. Anim. Sci. 2020, 33, 2021. [Google Scholar] [CrossRef]
- Asúnsolo, Á.; Chaowen, C.; Ortega, M.A.; Coca, S.; Borrell, L.N.; De León-Luis, J.; García-Honduvilla, N.; Álvarez-Mon, M.; Buján, J. Association Between Lower Extremity Venous Insufficiency and Intrapartum Fetal Compromise: A Nationwide Cross-Sectional Study. Front. Med. 2021, 8, 577096. [Google Scholar] [CrossRef]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Sáez, M.A.; Álvarez-Mon, M.A.; Torres-Carranza, D.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; Bravo, C.; et al. The Pivotal Role of the Placenta in Normal and Pathological Pregnancies: A Focus on Preeclampsia, Fetal Growth Restriction, and Maternal Chronic Venous Disease. Cells 2022, 11, 568. [Google Scholar] [CrossRef]
- Cornelius, C.; Perrotta, R.; Graziano, A.; Calabrese, E.J.; Calabrese, V. Stress responses, vitagenes and hormesis as critical determinants in aging and longevity: Mitochondria as a “chi”. Immun. Ageing 2013, 10, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dodson, M.; De La Vega, M.R.; Cholanians, A.B.; Schmidlin, C.J.; Chapman, E.; Zhang, D.D. Modulating NRF2 in disease: Timing is everything. Annu. Rev. Pharmacol. Toxicol. 2019, 59, 555. [Google Scholar] [CrossRef] [PubMed]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saha, S.; Buttari, B.; Panieri, E.; Profumo, E.; Saso, L. An overview of Nrf2 signaling pathway and its role in inflammation. Molecules 2020, 25, 5474. [Google Scholar] [CrossRef] [PubMed]
- Al-Sawaf, O.; Clarner, T.; Fragoulis, A.; Kan, Y.W.; Pufe, T.; Streetz, K.; Wruck, C.J. Nrf2 in health and disease: Current and future clinical implications. Clin. Sci. 2015, 129, 989–999. [Google Scholar] [CrossRef]
- Duhig, K.; Chappell, L.C.; Shennan, A.H. Oxidative stress in pregnancy and reproduction. Obstet. Med. 2016, 9, 113–116. [Google Scholar] [CrossRef] [Green Version]
- Dsouza, V.; Rani, A.; Patil, V.; Pisal, H.; Randhir, K.; Mehendale, S.; Wagh, G.; Gupte, S.; Joshi, S. Increased oxidative stress from early pregnancy in women who develop preeclampsia. Clin. Exp. Hypertens. 2016, 38, 225–232. [Google Scholar] [CrossRef]
- Cuffe, J.S.; Xu, Z.C.; Perkins, A.V. Biomarkers of oxidative stress in pregnancy complications. Biomark. Med. 2017, 11, 295–306. [Google Scholar] [CrossRef] [PubMed]
- Thompson, L.P.; Al-Hasan, Y. Impact of Oxidative Stress in Fetal Programming. J. Pregnancy 2012, 2012, 582748. [Google Scholar] [CrossRef] [PubMed]
- Nezu, M.; Souma, T.; Yu, L.; Sekine, H.; Takahashi, N.; Zu-Sern Wei, A.; Ito, S.; Fukamizu, A.; Zsengeller, Z.K.; Nakamura, T.; et al. Nrf2 inactivation enhances placental angiogenesis in a preeclampsia mouse model and improves maternal and fetal outcomes. Sci. Signal. 2017, 10, eaam5711. [Google Scholar] [CrossRef] [PubMed]
- Chiarello, D.I.; Abad, C.; Rojas, D.; Toledo, F.; Vázquez, C.M.; Mate, A.; Sobrevia, L.; Marín, R. Oxidative stress: Normal pregnancy versus preeclampsia. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165354. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Sola, M.; Álavrez-Rocha, M.J.; Sainz, F.; Álavrez-Mon, M.; Buján, J.; García-Honduvilla, N. Patients with incompetent valves in chronic venous insufficiency show increased systematic lipid peroxidation and cellular oxidative stress markers. Oxid. Med. Cell. Longev. 2019, 2019, 5164576. [Google Scholar] [CrossRef]
- Wang, L.; Chen, Y.; Sternberg, P.; Cai, J. Essential roles of the PI3 kinase/Akt pathway in regulating Nrf2-dependent antioxidant functions in the RPE. Investig. Ophthalmol. Vis. Sci. 2008, 49, 1671–1678. [Google Scholar] [CrossRef] [Green Version]
- Ortega, M.A.; Fraile-Martínez, O.; Saez, M.A.; Álvarez-Mon, M.A.; Gómez-Lahoz, A.M.; Bravo, C.; De León Luis, J.A.; Sainz, F.; Coca, S.; Asúnsolo, Á.; et al. Abnormal proinflammatory and stressor environmental with increased the regulatory cellular IGF-1/PAPP-A/STC and Wnt-1/β-Catenin canonical pathway in placenta of women with Chronic venous Disease during Pregnancy. Int. J. Med. Sci. 2021, 18, 2814–2827. [Google Scholar] [CrossRef]
- Wakabayashi, N.; Chartoumpekis, D.V.; Kensler, T.W. Crosstalk between Nrf2 and Notch signaling. Free Radic. Biol. Med. 2015, 88, 158. [Google Scholar] [CrossRef] [Green Version]
- Zhao, W.X.; Lin, J.H. Notch Signaling Pathway and Human Placenta. Int. J. Med. Sci. 2012, 9, 447. [Google Scholar] [CrossRef] [Green Version]
- Iso, T.; Suzuki, T.; Baird, L.; Yamamoto, M. Absolute Amounts and Status of the Nrf2-Keap1-Cul3 Complex within Cells. Mol. Cell. Biol. 2016, 36, 3100–3112. [Google Scholar] [CrossRef] [Green Version]
- Niture, S.K.; Khatri, R.; Jaiswal, A.K. Regulation of Nrf2—An update. Free Radic. Biol. Med. 2014, 66, 36–44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, F.; Wang, N.; Tan, H.Y.; Guo, W.; Zhang, C.; Feng, Y. The functional roles of exosomes-derived long non-coding RNA in human cancer. Cancer Biol. Ther. 2019, 20, 583–592. [Google Scholar] [CrossRef] [PubMed]
- Piergentili, R.; Zaami, S.; Cavaliere, A.F.; Signore, F.; Scambia, G.; Mattei, A.; Marinelli, E.; Gulia, C.; Perelli, F. Non-Coding RNAs as Prognostic Markers for Endometrial Cancer. Int. J. Mol. Sci. 2021, 22, 3151. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.; Tian, F.J.; Lin, Y. Oxidative stress in placenta: Health and diseases. Biomed Res. Int. 2015, 2015, 293271. [Google Scholar] [CrossRef] [Green Version]
- Cavaliere, A.F.; Perelli, F.; Zaami, S.; Piergentili, R.; Mattei, A.; Vizzielli, G.; Scambia, G.; Straface, G.; Restaino, S.; Signore, F. Towards Personalized Medicine: Non-Coding RNAs and Endometrial Cancer. Healthcare 2021, 9, 965. [Google Scholar] [CrossRef] [PubMed]
- Mundal, S.B.; Rakner, J.J.; Silva, G.B.; Gierman, L.M.; Austdal, M.; Basnet, P.; Elschot, M.; Bakke, S.S.; Ostrop, J.; Thomsen, L.C.V.; et al. Divergent Regulation of Decidual Oxidative-Stress Response by NRF2 and KEAP1 in Preeclampsia with and without Fetal Growth Restriction. Int. J. Mol. Sci. 2022, 23, 1966. [Google Scholar] [CrossRef]
- Zhang, Y.; Jiang, G.; Zhang, C. Downregulation of Cullin 3 Ligase Signaling Pathways Contributes to Hypertension in Preeclampsia. Front. Cardiovasc. Med. 2021, 8, 654254. [Google Scholar] [CrossRef]
- Zhang, Q.; Yu, S.; Huang, X.; Tan, Y.; Zhu, C.; Wang, Y.L.; Wang, H.; Lin, H.Y.; Fu, J.; Wang, H. New insights into the function of Cullin 3 in trophoblast invasion and migration. Reproduction 2015, 150, 139–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Knatko, E.V.; Tatham, M.H.; Zhang, Y.; Castro, C.; Higgins, M.; Dayalan Naidu, S.; Leonardi, C.; de la Vega, L.; Honda, T.; Griffin, J.L.; et al. Downregulation of Keap1 Confers Features of a Fasted Metabolic State. iScience 2020, 23, 101638. [Google Scholar] [CrossRef]
- Ortega, M.A.; Saez, M.A.; Sainz, F.; Fraile-Martínez, O.; García-Gallego, S.; Pekarek, L.; Bravo, C.; Coca, S.; Álvarez-Mon, M.; Buján, J.; et al. Lipidomic profiling of chorionic villi in the placentas of women with chronic venous disease. Int. J. Med. Sci. 2020, 17, 2790–2798. [Google Scholar] [CrossRef]
- Lavu, N.; Richardson, L.; Bonney, E.; Menon, R. Glycogen synthase kinase (GSK) 3 in Pregnancy and Parturition: A Systematic Review of Literature. J. Matern. Fetal. Neonatal Med. 2020, 33, 1946. [Google Scholar] [CrossRef] [PubMed]
- Lavu, N.; Richardson, L.; Radnaa, E.; Kechichian, T.; Urrabaz-Garza, R.; Sheller-Miller, S.; Bonney, E.; Menon, R. Oxidative stress-induced downregulation of glycogen synthase kinase 3 beta in fetal membranes promotes cellular senescence. Biol. Reprod. 2019, 101, 1018. [Google Scholar] [CrossRef] [PubMed]
- Hermida, M.A.; Dinesh Kumar, J.; Leslie, N.R. GSK3 and its interactions with the PI3K/AKT/mTOR signalling network. Adv. Biol. Regul. 2017, 65, 5–15. [Google Scholar] [CrossRef] [PubMed]
- Flügel, D.; Görlach, A.; Michiels, C.; Kietzmann, T. Glycogen synthase kinase 3 phosphorylates hypoxia-inducible factor 1alpha and mediates its destabilization in a VHL-independent manner. Mol. Cell. Biol. 2007, 27, 3253–3265. [Google Scholar] [CrossRef]
CVD (n = 62) | HC (n = 52) | |
---|---|---|
Median age (IQR), years | 33 (22–40) | 34 (27–41) |
Median gestational age (IQR), weeks | 40.5 (39–41.5) | 41 (39–42) |
C-section delivery, n (%) | 12 (19.4) | 9 (17.3) |
Vaginal delivery, n (%) | 50 (80.6) | 43 (82.7) |
Varicose vein (CEAP), n (%) | ||
CEAP 1 | 37 (59.7) | 0 (0) |
CEAP 2 | 21 (33.8) | 0 (0) |
CEAP 3 | 4 (6.5) | 0 (0) |
Previous pregnancies, n (%) | 33 (53.2) | 19 (36.5) |
Previous abortions, n (%) | 14 (22.6) | 9 (17.3) |
Regular menstrual cycles, n (%) | 50 (80.6) | 42 (80.7) |
Sedentary profession, n (%) | 41 (66.1) | 40 (76.9) |
Gene | Sequence Fwd (5′→3′) | Sequence Rev (5′→3′) | Temp |
---|---|---|---|
TBP | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | 60 °C |
NRF2 | CACGGTCCACAGCTCATCAT | GGTTGGGGTCTTCTGTGGAG | 58 °C |
KEAP1 | TACAGCCAAGGTCCCTGAGT | CCTCAATGGACACCACCTCC | 61 °C |
CUL3 | CGAATCTGAGCAAAGGCACG | TCCATGGTCATCGGAAAGGC | 60 °C |
GSK3B | GGATTCGTCAGGAACAGGACA | TTAGCATCTGACGCTGCTGT | 59 °C |
Antigen | Species | Dilution | Provider | Protocol Specifications |
---|---|---|---|---|
Nrf2 | Rabbit monoclonal | 1:750 | Abcam (ab62352) | Glycine HCl, 30 min RT. 0.2% Hyaluronidase, 30 min 42 °C |
KEAP1 | Rabbit monoclonal | 1:500 | Abcam (ab109287) | Triton 100 × 0.1% in PBS, 10 min |
CUL3 | Rabbit polyclonal | 1:500 | Abcam (ab245410) | Glycine HCl, 30 min RT. 0.2% Hyaluronidase, 30 min 42 °C |
GSK3 | Rabbit monoclonal | 1:250 | Abcam (ab183177) | 10 mM Sodium citrate pH = 6 before incubation with blocking solution |
IgG (Rabbit) | Mouse | 1:1000 | Sigma-Aldrich (RG-96/B5283) | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
García-Montero, C.; Fraile-Martinez, O.; Rodriguez-Martín, S.; Funes Moñux, R.M.; Saz, J.V.; Bravo, C.; De Leon-Luis, J.A.; Ruiz-Minaya, M.; Pekarek, L.; Saez, M.A.; et al. Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease. Antioxidants 2022, 11, 2277. https://doi.org/10.3390/antiox11112277
García-Montero C, Fraile-Martinez O, Rodriguez-Martín S, Funes Moñux RM, Saz JV, Bravo C, De Leon-Luis JA, Ruiz-Minaya M, Pekarek L, Saez MA, et al. Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease. Antioxidants. 2022; 11(11):2277. https://doi.org/10.3390/antiox11112277
Chicago/Turabian StyleGarcía-Montero, Cielo, Oscar Fraile-Martinez, Sonia Rodriguez-Martín, Rosa M. Funes Moñux, Jose V. Saz, Coral Bravo, Juan A. De Leon-Luis, María Ruiz-Minaya, Leonel Pekarek, Miguel A. Saez, and et al. 2022. "Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease" Antioxidants 11, no. 11: 2277. https://doi.org/10.3390/antiox11112277