Hormonal Signaling during dPCD: Cytokinin as the Determinant of RNase-Based Self-Incompatibility in Solanaceae
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Growing Conditions
- (1)
- Two clones (self-compatible and self-incompatible) of the petunia P. hybrida;
- (2)
- Four tomato species of the genus Solanum (one self-compatible cultivated tomato S. lycopersicum cultivar Blush and three self-incompatible tomato species S. chilense, S. pennellii, and S. habrochaites).
2.2. Treatments
2.2.1. In Vitro
2.2.2. In Vivo
2.3. Imaging of Growing Pollen Tubes
2.3.1. In Vitro
2.3.2. In Vivo (in Pistil Tissue)
2.4. Imaging of CLP Activity in Growing Pollen Tubes via Fluorescence Technique
2.4.1. In Vivo
2.4.2. In Vitro
2.5. RT-qPCR
2.6. Statistics
3. Results
3.1. Effect of Zeatin on In Vivo Pollen Tube Germination and Growth in Tomato
3.2. Effect of Zeatin Treatment on Caspase-like Protease Activities in the Pollen Tubes (P. hybrida and S. lycopersicum Cultivar BLUSH) Growing In Vivo
3.2.1. P. hybrida of Self-Incompatible Clone and Cross-Compatible Pollination
3.2.2. S. lycopersicum Cultivar Blush
3.3. Effect of Zeatin on Pollen Tube Germination and In Vitro Growth in Tomato
3.4. Effect of Zeatin on CLP Activities in the Pollen Tubes of Compatible Petunia Clone and S. lycopersicum Cultivar Blush Growing In Vitro
3.5. Effect of Latrunculin B (Inhibitor of F-Actin Polymerization) Treatment on the Caspase-like Protease Activities in Petunia and Tomato Growing Pollen Tubes
3.5.1. In Vivo
3.5.2. In Vitro
3.6. Determining the Expression Level of IPT5, LOG, CKX1, and CKX2 Genes Involved in the CK Biosynthesis of Cytokinins
4. Discussion
4.1. Self-Incompatibility Induced PCD
4.2. CK Inhibits Pollen Germination and Pollen Tube Growth in Solanaceae
4.3. CK Acidifies Pollen Tube Cytoplasm
4.4. CK Suppressed Actin Polymerization in Pollen Tubes
4.5. CK Stimulates CLP Activities
4.6. CK Biosynthesis Genes Activity
4.7. CK as a Factor of SI-Induced PCD
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- van Hautegem, T.; Waters, A.J.; Goodrich, J.; Nowack, M.K. Only in Dying, Life: Programmed Cell Death during Plant Development. Trends Plant Sci. 2015, 20, 102–113. [Google Scholar] [CrossRef]
- Huysmans, M.; Lema, A.S.; Coll, N.S.; Nowack, M.K. Dying Two Deaths—Programmed Cell Death Regulation in Development and Disease. Curr. Opin. Plant Biol. 2017, 35, 37–44. [Google Scholar] [CrossRef] [Green Version]
- Daneva, A.; Gao, Z.; Van Durme, M.; Nowack, M.K. Functions and Regulation of Programmed Cell Death in Plant Development. Annu. Rev. Cell Dev. Biol. 2016, 32, 441–468. [Google Scholar] [CrossRef]
- Reape, T.J.; McCabe, P.F. Apoptotic-like Regulation of Programmed Cell Death in Plants. Apoptosis 2010, 15, 249–256. [Google Scholar] [CrossRef]
- Van Durme, M.; Nowack, M.K. Mechanisms of Developmentally Controlled Cell Death in Plants. Curr. Opin. Plant Biol. 2016, 29, 29–37. [Google Scholar] [CrossRef]
- Hatsugai, N.; Yamada, K.; Goto-Yamada, S.; Hara-Nishimura, I. Vacuolar Processing Enzyme in Plant Programmed Cell Death. Front. Plant Sci. 2015, 6, 234. [Google Scholar] [CrossRef] [Green Version]
- Ge, Y.; Cai, Y.-M.; Bonneau, L.; Rotari, V.; Danon, A.; McKenzie, E.A.; McLellan, H.; Mach, L.; Gallois, P. Inhibition of Cathepsin B by Caspase-3 Inhibitors Blocks Programmed Cell Death in Arabidopsis. Cell Death Differ. 2016, 23, 1493–1501. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.-F.; Li, J.; Bi, F.-C.; Liu, Z.; Chang, Z.-Y.; Wang, L.-Y.; Huang, L.-Q.; Yao, N. Ceramide-Induced Cell Death Depends on Calcium and Caspase-Like Activity in Rice. Front. Plant Sci. 2020, 11, 145. [Google Scholar] [CrossRef] [Green Version]
- Wilkins, K.A.; Poulter, N.S.; Franklin-Tong, V.E. Taking One for the Team: Self-Recognition and Cell Suicide in Pollen. J. Exp. Bot. 2014, 65, 1331–1342. [Google Scholar] [CrossRef] [Green Version]
- Igic, B.; Smith, W.A.; Robertson, K.A.; Schaal, B.A.; Kohn, J.R. Studies of Self-Incompatibility in Wild Tomatoes: I. S-Allele Diversity in Solanum Chilense Dun. (Solanaceae). Heredity 2007, 99, 553–561. [Google Scholar] [CrossRef]
- Ahmad, M.H.; Rao, M.J.; Hu, J.; Xu, Q.; Liu, C.; Cao, Z.; Larkin, R.M.; Deng, X.; Bosch, M.; Chai, L. Systems and Breakdown of Self-Incompatibility. Crit. Rev. Plant Sci. 2022, 41, 209–239. [Google Scholar] [CrossRef]
- Tsukamoto, T.; Ando, T.; Watanabe, H.; Marchesi, E.; Kao, T. Duplication of the S-Locus F-Box Gene Is Associated with Breakdown of Pollen Function in an S-Haplotype Identified in a Natural Population of Self-Incompatible Petunia Axillaris. Plant Mol. Biol. 2005, 57, 141–153. [Google Scholar] [CrossRef]
- Williams, J.S.; Der, J.P.; dePamphilis, C.W.; Kao, T.H. Transcriptome analysis reveals the same 17 S-locus F-box genes in two haplotypes of the self-incompatibility locus of Petunia inflata. The Plant Cell. 2014, 26(7), 2873–2888. [Google Scholar] [CrossRef] [Green Version]
- Kubo, K.; Tsukahara, M.; Fujii, S.; Murase, K.; Wada, Y.; Entani, T.; Iwano, M.; Takayama, S. Cullin1-P Is an Essential Component of Non-Self Recognition System in Self-Incompatibility in Petunia. Plant Cell Physiol. 2016, 57, 2403–2416. [Google Scholar] [CrossRef] [Green Version]
- McClure, B.A.; Haring, V.; Ebert, P.R.; Anderson, M.A.; Simpson, R.J.; Sakiyama, F.; Clarke, A.E. Style Self-Incompatibility Gene Products of Nicotlana Alata Are Ribonucleases. Nature 1989, 342, 955–957. [Google Scholar] [CrossRef]
- McClure, B.; Cruz-García, F.; Romero, C. Compatibility and Incompatibility in S-RNase-Based Systems. Ann. Bot. 2011, 108, 647–658. [Google Scholar] [CrossRef] [Green Version]
- Igic, B.; Kohn, J.R. Evolutionary Relationships among Self-Incompatibility RNases. Proc. Natl. Acad. Sci. USA 2001, 98, 13167–13171. [Google Scholar] [CrossRef] [Green Version]
- Florez-Rueda, A.M.; Scharmann, M.; Roth, M.; Städler, T. Population Genomics of the “Arcanum” Species Group in Wild Tomatoes: Evidence for Separate Origins of Two Self-Compatible Lineages. Front. Plant Sci. 2021, 12, 624442. [Google Scholar] [CrossRef]
- Landis, J.B.; Miller, C.M.; Broz, A.K.; Bennett, A.A.; Carrasquilla-Garcia, N.; Cook, D.R.; Last, R.L.; Bedinger, P.A.; Moghe, G.D. Migration through a Major Andean Ecogeographic Disruption as a Driver of Genetic and Phenotypic Diversity in a Wild Tomato Species. Mol. Biol. Evol. 2021, 38, 3202–3219. [Google Scholar] [CrossRef]
- Tsuchimatsu, T.; Fujii, S. The Selfing Syndrome and beyond: Diverse Evolutionary Consequences of Mating System Transitions in Plants. Philos. Trans. R. Soc. B Biol. Sci. 2022, 377, 20200510. [Google Scholar] [CrossRef]
- Zhao, H.; Zhang, Y.; Zhang, H.; Song, Y.; Zhao, F.; Zhang, Y.; Zhu, S.; Zhang, H.; Zhou, Z.; Guo, H.; et al. Origin, Loss, and Regain of Self-Incompatibility in Angiosperms. Plant Cell 2022, 34, 579–596. [Google Scholar] [CrossRef]
- Kovaleva, L.V.; Timofeeva, G.V.; Andreev, I.M.; Zakharova, E.V.; Bogoutdinova, L.R.; Baranova, E.N.; Khaliluev, M.R.; Golivanov, Y.Y. Aminooxyacetic Acid (AOA), Inhibitor of 1-Aminocyclopropane-1-Carboxilic Acid (ACC) Synthesis, Suppresses Self-Incompatibility-Induced Programmed Cell Death in Self-Incompatible Petunia Hybrida L. Pollen Tubes. Protoplasma 2020, 257, 213–227. [Google Scholar] [CrossRef]
- Zakharova, E.V.; Timofeeva, G.V.; Fateev, A.D.; Kovaleva, L.V. Caspase-like Proteases and the Phytohormone Cytokinin as Determinants of S-RNAse-Based Self-Incompatibility-Induced PCD in Petunia hybrida L. Protoplasma 2021, 258, 573–586. [Google Scholar] [CrossRef]
- Kovaleva, L.; Zakharova, E. Hormonal Status of the Pollen-Pistil System at the Progamic Phase of Fertilization after Compatible and Incompatible Pollination in Petunia hybrida L. Sex. Plant Reprod. 2003, 16, 191–196. [Google Scholar] [CrossRef]
- Kovaleva, L.V.; Zakharova, E.V.; Minkina, Y.V.; Timofeeva, G.V.; Andreev, I.M. Germination and In Vitro Growth of Petunia Male Gametophyte Are Affected by Exogenous Hormones and Involve the Changes in the Endogenous Hormone Level. Russ. J. Plant Physiol. 2005, 52, 521–526. [Google Scholar] [CrossRef]
- Andreev, I.M.; Timofeeva, G.V.; Minkina, Y.V.; Kovaleva, L.V. Effects of Exogenous Phytohormones on Intracellular PH of Petunia Hybrida Pollen Grains. Russ. J. Plant Physiol. 2007, 54, 626–632. [Google Scholar] [CrossRef]
- Kovaleva, L.V.; Zakharova, E.V.; Minkina, Y.V.; Voronkov, A.S. Effects of Flavonols and Phytohormones on Germination and Growth of Petunia Male Gametophyte. Allelopath. J. 2009, 23, 51–61. [Google Scholar]
- Voronkov, A.S.; Andreev, I.M.; Timofeeva, G.V.; Kovaleva, L.V. Electrogenic Activity of Plasma Membrane H+-ATPase in Germinating Male Gametophyte of Petunia and Its Stimulation by Exogenous Auxin: Mediatory Role of Calcium and Reactive Oxygen Species. Russ. J. Plant Physiol. 2010, 57, 401–407. [Google Scholar] [CrossRef]
- Kovaleva, L.V.; Voronkov, A.S.; Zakharova, E.V. Role of Auxin and Cytokinin in the Regulation of the Actin Cytoskeleton in the in Vitro Germinating Male Gametophyte of Petunia. Russ. J. Plant Physiol. 2015, 62, 179–186. [Google Scholar] [CrossRef]
- Kovaleva, L.; Voronkov, A.; Zakharova, E.; Minkina, Y.; Timofeeva, G.; Andreev, I. Regulation of Petunia Pollen Tube Growth by Phytohormones: Identification of Their Potential Targets. J. Agric. Sci. Technol. A 2016, 6, 239–254. [Google Scholar] [CrossRef] [Green Version]
- Heslop-Harrison, Y.; Heslop-Harrison, J. Germination of Monocolpate Angiosperm Pollen: Evolution of the Actin Cytoskeleton and Wall during Hydration, Activation and Tube Emergence. Ann. Bot. 1992, 69, 385–394. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
- Nishijima, T.; Niki, T.; Niki, T. Corolla of the large-flowered petunia (Petunia hybrida Vilm.) cultivars exhibit low endogenous cytokinin concentration through enhanced expression of the genes encoding cytokinin oxidases. J. Jpn. Soc. Hortic. Sci. 2011, 80, 334–342. [Google Scholar] [CrossRef] [Green Version]
- Mallona, I.; Lischewski, S.; Weiss, J.; Hause, B.; Egea-Cortines, M. Validation of Reference Genes for Quantitative Real-Time PCR during Leaf and Flower Development in Petunia Hybrida. BMC Plant Biol. 2010, 10, 4. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- McInnis, S.M.; Desikan, R.; Hancock, J.T.; Hiscock, S.J. Production of Reactive Oxygen Species and Reactive Nitrogen Species by Angiosperm Stigmas and Pollen: Potential Signalling Crosstalk? New Phytol. 2006, 172, 221–228. [Google Scholar] [CrossRef]
- McClure, B.A.; Franklin-Tong, V. Gametophytic Self-Incompatibility: Understanding the Cellular Mechanisms Involved in “Self” Pollen Tube Inhibition. Planta 2006, 224, 233–245. [Google Scholar] [CrossRef]
- Fujii, S.; Kubo, K.; Takayama, S. Non-Self- and Self-Recognition Models in Plant Self-Incompatibility. Nat. Plants 2016, 2, 1–9. [Google Scholar] [CrossRef]
- Du, J.; Ge, C.; Li, T.; Wang, S.; Gao, Z.; Sassa, H.; Qiao, Y. Molecular Characteristics of S-RNase Alleles as the Determinant of Self-Incompatibility in the Style of Fragaria Viridis. Hortic. Res. 2021, 8, 185. [Google Scholar] [CrossRef]
- Kardile, H.B.; Yilma, S.; Sathuvalli, V. Molecular Approaches to Overcome Self-Incompatibility in Diploid Potatoes. Plants 2022, 11, 1328. [Google Scholar] [CrossRef]
- Dongariyal, A.; Dimri, D.C.; Kumar, P.; Choudhary, A.; Jat, P.K.; Basile, B.; Mataffo, A.; Corrado, G.; Singh, A. Pollen-Pistil Interaction in Response to Pollination Variants in Subtropical Japanese Plum (Prunus Salicina Lindl.) Varieties. Plants 2022, 11, 3081. [Google Scholar] [CrossRef]
- Rea, A.C.; Nasrallah, J.B. Self-Incompatibility Systems: Barriers to Self-Fertilization in Flowering Plants. Int. J. Dev. Biol. 2004, 52, 627–636. [Google Scholar] [CrossRef]
- Liang, M.; Cao, Z.; Zhu, A.; Liu, Y.; Tao, M.; Yang, H.; Xu, Q.; Wang, S.; Liu, J.; Li, Y.; et al. Evolution of Self-Compatibility by a Mutant Sm-RNase in Citrus. Nat. Plants 2020, 6, 131–142. [Google Scholar] [CrossRef]
- Williams, J.S.; Natale, C.A.; Wang, N.; Li, S.; Brubaker, T.R.; Sun, P.; Kao, T. Four Previously Identified Petunia Inflata S-Locus F-Box Genes Are Involved in Pollen Specificity in Self-Incompatibility. Mol. Plant 2014, 7, 567–569. [Google Scholar] [CrossRef] [Green Version]
- Lai, Z.; Ma, W.; Han, B.; Liang, L.; Zhang, Y.; Hong, G.; Xue, Y. An F-Box Gene Linked to the Self-Incompatibility (S) Locus of Antirrhinum Is Expressed Specifically in Pollen and Tapetum. Plant Mol. Biol. 2002, 50, 29–41. [Google Scholar] [CrossRef]
- Ushijima, K.; Yamane, H.; Watari, A.; Kakehi, E.; Ikeda, K.; Hauck, N.R.; Iezzoni, A.F.; Tao, R. The S Haplotype-Specific F-Box Protein Gene, SFB, Is Defective in Self-Compatible Haplotypes of Prunus Avium and P. Mume. Plant J. 2004, 39, 573–586. [Google Scholar] [CrossRef]
- Sijacic, P.; Wang, X.; Skirpan, A.L.; Wang, Y.; Dowd, P.E.; McCubbin, A.G.; Huang, S.; Kao, T. Identification of the Pollen Determinant of S-RNase-Mediated Self-Incompatibility. Nature 2004, 429, 302–305. [Google Scholar] [CrossRef]
- Chen, S.; Jia, J.; Cheng, L.; Zhao, P.; Qi, D.; Yang, W.; Liu, H.; Dong, X.; Li, X.; Liu, G. Transcriptomic Analysis Reveals a Comprehensive Calcium- and Phytohormone-Dominated Signaling Response in Leymus Chinensis Self-Incompatibility. Int. J. Mol. Sci. 2019, 20, 2356. [Google Scholar] [CrossRef] [Green Version]
- Hanamata, S.; Sawada, J.; Ono, S.; Ogawa, K.; Fukunaga, T.; Nonomura, K.; Kimura, S.; Kurusu, T.; Kuchitsu, K. Impact of Autophagy on Gene Expression and Tapetal Programmed Cell Death During Pollen Development in Rice. Front. Plant Sci. 2020, 11, 172. [Google Scholar] [CrossRef] [Green Version]
- Shibuya, K.; Niki, T.; Ichimura, K. Pollination Induces Autophagy in Petunia Petals via Ethylene. J. Exp. Bot. 2013, 64, 1111–1120. [Google Scholar] [CrossRef] [Green Version]
- Masclaux-Daubresse, C.; Clément, G.; Anne, P.; Routaboul, J.-M.; Guiboileau, A.; Soulay, F.; Shirasu, K.; Yoshimoto, K. Stitching Together the Multiple Dimensions of Autophagy Using Metabolomics and Transcriptomics Reveals Impacts on Metabolism, Development, and Plant Responses to the Environment in Arabidopsis. Plant Cell 2014, 26, 1857–1877. [Google Scholar] [CrossRef] [Green Version]
- Pillajo, J.O.Q.; Chapin, L.J.; Jones, M.L. Senescence and Abiotic Stress Induce Expression of Autophagy-Related Genes in Petunia. J. Am. Soc. Hortic. Sci. 2018, 143, 154–163. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Lin, Y.; Li, X.; Guo, S.; Huang, Y.; Xie, Q. Autophagy Dances with Phytohormones upon Multiple Stresses. Plants 2020, 9, 1038. [Google Scholar] [CrossRef]
- Wu, J.; Qin, X.; Tao, S.; Jiang, X.; Liang, Y.-K.; Zhang, S. Long-Chain Base Phosphates Modulate Pollen Tube Growth via Channel-Mediated Influx of Calcium. Plant J. 2014, 79, 507–516. [Google Scholar] [CrossRef]
- Kovaleva, L.V.; Timofeeva, G.V.; Rodionova, G.B.; Zakharova, E.V.; Rakitin, V.Y. Role of Ethylene in the Control of Gametophyte-Sporophyte Interactions in the Course of the Progamic Phase of Fertilization. Russ. J. Dev. Biol. 2013, 44, 69–77. [Google Scholar] [CrossRef]
- Sakakibara, H. Cytokinin Biosynthesis and Transport for Systemic Nitrogen Signaling. Plant J. 2021, 105, 421–430. [Google Scholar] [CrossRef]
- Zottini, M.; Barizza, E.; Bastianelli, F.; Carimi, F.; Lo Schiavo, F. Growth and Senescence of Medicago Truncatula Cultured Cells Are Associated with Characteristic Mitochondrial Morphology. New Phytol. 2006, 172, 239–247. [Google Scholar] [CrossRef]
- Ishii, Y.; Hori, Y.; Sakai, S.; Honma, Y. Control of Differentiation and Apoptosis of Human Myeloid Leukemia Cells by Cytokinins and Cytokinin Nucleosides, Plant Redifferentiation-Inducing Hormones. Cell Growth Differ. 2002, 13, 19–26. [Google Scholar]
- Mlejnek, P.; Procházka, S. Activation of Caspase-like Proteases and Induction of Apoptosis by Isopentenyladenosine in Tobacco BY-2 Cells. Planta 2002, 215, 158–166. [Google Scholar] [CrossRef]
- Carimi, F.; Zottini, M.; Formentin, E.; Terzi, M.; Lo Schiavo, F. Cytokinins: New Apoptotic Inducers in Plants. Planta 2003, 216, 413–421. [Google Scholar] [CrossRef]
- Carimi, F.; Terzi, M.; De Michele, R.; Zottini, M.; Lo Schiavo, F. High Levels of the Cytokinin BAP Induce PCD by Accelerating Senescence. Plant Sci. 2004, 166, 963–969. [Google Scholar] [CrossRef]
- Carimi, F.; Zottini, M.; Costa, A.; Cattalan, I.; De Michele, R.; Terzi, M.; Lo Schiavo, F. NO Signalling in Cytokinin-Induced Programmed Cell Death. Plant Cell Environ. 2005, 28, 1171–1178. [Google Scholar] [CrossRef]
- Kaźmierczak, A.; Kunikowska, A.; Doniak, M.; Kornaś, A. Mechanism of Kinetin-Induced Death of Vicia Faba Ssp. Minor Root Cortex Cells. Sci. Rep. 2021, 11, 23746. [Google Scholar] [CrossRef]
- Vogel, J.P.; Woeste, K.E.; Theologis, A.; Kieber, J.J. Recessive and Dominant Mutations in the Ethylene Biosynthetic Gene ACS5 of Arabidopsis Confer Cytokinin Insensitivity and Ethylene Overproduction, Respectively. Proc. Natl. Acad. Sci. USA 1998, 95, 4766–4771. [Google Scholar] [CrossRef] [Green Version]
- Vogel, J.P.; Schuerman, P.; Woeste, K.; Brandstatter, I.; Kieber, J.J. Isolation and Characterization of Arabidopsis Mutants Defective in the Induction of Ethylene Biosynthesis by Cytokinin. Genetics 1998, 149, 417–427. [Google Scholar] [CrossRef]
- Young, T.E.; Gallie, D.R. Regulation of Programmed Cell Death in Maize Endosperm by Abscisic Acid. Plant Mol. Biol. 2000, 42, 397–414. [Google Scholar] [CrossRef]
- Trobacher, C.P. Ethylene and Programmed Cell Death in Plants. Botany 2009, 87, 757–769. [Google Scholar] [CrossRef]
- Kakimoto, T. Identification of Plant Cytokinin Biosynthetic Enzymes as Dimethylallyl Diphosphate: ATP/ADP Isopentenyltransferases. Plant Cell Physiol. 2001, 42, 677–685. [Google Scholar] [CrossRef]
- Kakimoto, T. Perception and Signal Transduction of Cytokinins. Annu. Rev. Plant Biol. 2003, 54, 605–627. [Google Scholar] [CrossRef]
- Brault, M.; Amiar, Z.; Pennarun, A.-M.; Monestiez, M.; Zhang, Z.; Cornel, D.; Dellis, O.; Knight, H.; Bouteau, F.; Rona, J.-P. Plasma Membrane Depolarization Induced by Abscisic Acid in Arabidopsis Suspension Cells Involves Reduction of Proton Pumping in Addition to Anion Channel Activation, Which Are Both Ca2+ Dependent. Plant Physiol. 2004, 135, 231–243. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Triviño, M.; Lin, Z.; Carli, J.; Eaves, D.J.; Van Damme, D.; Nowack, M.K.; Franklin-Tong, V.E.; Bosch, M. New Opportunities and Insights into Papaver Self-Incompatibility by Imaging Engineered Arabidopsis Pollen. J. Exp. Bot. 2020, 71, 2451–2463. [Google Scholar] [CrossRef] [Green Version]
- Mazina, S.E.; Matveeva, N.P.; Ermakov, I.P. Determination of a position of a functional pore in the tobacco pollen. Tsitologiia 2002, 44, 33–39. [Google Scholar]
- Bosch, M.; Franklin-Tong, V.E. Self-Incompatibility in Papaver: Signalling to Trigger PCD in Incompatible Pollen. J. Exp. Bot. 2008, 59, 481–490. [Google Scholar] [CrossRef] [Green Version]
- Qin, Y.; Yang, Z. Rapid Tip Growth: Insights from Pollen Tubes. Semin. Cell Dev. Biol. 2011, 22, 816–824. [Google Scholar] [CrossRef] [Green Version]
- van Doorn, W.G. Classes of Programmed Cell Death in Plants, Compared to Those in Animals. J. Exp. Bot. 2011, 62, 4749–4761. [Google Scholar] [CrossRef] [Green Version]
- de Graaf, B.H.J.; Vatovec, S.; Juárez-Díaz, J.A.; Chai, L.; Kooblall, K.; Wilkins, K.A.; Zou, H.; Forbes, T.; Franklin, F.C.H.; Franklin-Tong, V.E. The Papaver Self-Incompatibility Pollen S-Determinant, PrpS, Functions in Arabidopsis Thaliana. Curr. Biol. 2012, 22, 154–159. [Google Scholar] [CrossRef] [Green Version]
- Ferreira, F.J.; Kieber, J.J. Cytokinin Signaling. Curr. Opin. Plant Biol. 2005, 8, 518–525. [Google Scholar] [CrossRef]
- Lin, Z.; Eaves, D.J.; Sanchez-Moran, E.; Franklin, F.C.H.; Franklin-Tong, V.E. The Papaver Rhoeas S Determinants Confer Self-Incompatibility to Arabidopsis Thaliana in Planta. Science 2015, 350, 684–687. [Google Scholar] [CrossRef]
- Staiger, C.J.; Poulter, N.S.; Henty, J.L.; Franklin-Tong, V.E.; Blanchoin, L. Regulation of Actin Dynamics by Actin-Binding Proteins in Pollen. J. Exp. Bot. 2010, 61, 1969–1986. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.Y.; Wong, E.I.; Vidali, L.; Estavillo, A.; Hepler, P.K.; Wu, H.; Cheung, A.Y. The Regulation of Actin Organization by Actin-Depolymerizing Factor in Elongating Pollen Tubes. Plant Cell 2002, 14, 2175–2190. [Google Scholar] [CrossRef] [Green Version]
- Lovy-Wheeler, A.; Kunkel, J.G.; Allwood, E.G.; Hussey, P.J.; Hepler, P.K. Oscillatory Increases in Alkalinity Anticipate Growth and May Regulate Actin Dynamics in Pollen Tubes of Lily. Plant Cell 2006, 18, 2182–2193. [Google Scholar] [CrossRef] [Green Version]
- Franklin-Tong, V.E.; Gourlay, C.W. A Role for Actin in Regulating Apoptosis/Programmed Cell Death: Evidence Spanning Yeast, Plants and Animals. Biochem. J. 2008, 413, 389–404. [Google Scholar] [CrossRef] [Green Version]
- Smertenko, A.; Franklin-Tong, V.E. Organisation and Regulation of the Cytoskeleton in Plant Programmed Cell Death. Cell Death Differ. 2011, 18, 1263–1270. [Google Scholar] [CrossRef]
- Wilkins, K.A.; Bancroft, J.; Bosch, M.; Ings, J.; Smirnoff, N.; Franklin-Tong, V.E. Reactive Oxygen Species and Nitric Oxide Mediate Actin Reorganization and Programmed Cell Death in the Self-Incompatibility Response of Papaver. Plant Physiol. 2011, 156, 404–416. [Google Scholar] [CrossRef] [Green Version]
- Yang, B.; Thorogood, D.; Armstead, I.P.; Franklin, F.C.H.; Barth, S. Identification of genes expressed during the self-incompatibility response in perennial ryegrass (Lolium perenne L.). Plant Mol. Biol. 2009, 70, 709–723. [Google Scholar] [CrossRef]
- Baluska, F.; Samaj, J.; Menzel, D. Polar Transport of Auxin: Carrier-Mediated Flux across the Plasma Membrane or Neurotransmitter-like Secretion? Trends Cell Biol. 2003, 13, 282–285. [Google Scholar] [CrossRef]
- Onelli, E.; Moscatelli, A.; Gagliardi, A.; Zaninelli, M.; Bini, L.; Baldi, A.; Caccianiga, M.; Reggi, S.; Rossi, L. Retarded Germination of Nicotiana Tabacum Seeds Following Insertion of Exogenous DNA Mimics the Seed Persistent Behavior. PLoS ONE 2017, 12, e0187929. [Google Scholar] [CrossRef] [Green Version]
- Romagnoli, S.; Cai, G.; Faleri, C.; Yokota, E.; Shimmen, T.; Cresti, M. Microtubule- and Actin Filament-Dependent Motors Are Distributed on Pollen Tube Mitochondria and Contribute Differently to Their Movement. Plant Cell Physiol. 2007, 48, 345–361. [Google Scholar] [CrossRef]
- Winship, L.J.; Rounds, C.; Hepler, P.K. Perturbation Analysis of Calcium, Alkalinity and Secretion during Growth of Lily Pollen Tubes. Plants 2017, 6, 3. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.Y.H.; Cheung, A.Y.; Wu, H.M. Actin-depolymerizing factor mediates Rac/Rop GTPase–regulated pollen tube growth. Plant Cell 2003, 15, 237–249. [Google Scholar] [CrossRef] [Green Version]
- Thomas, S.G.; Huang, S.; Li, S.; Staiger, C.J.; Franklin-Tong, V.E. Actin Depolymerization Is Sufficient to Induce Programmed Cell Death in Self-Incompatible Pollen. J. Cell Biol. 2006, 174, 221–229. [Google Scholar] [CrossRef] [Green Version]
- Werner, T.; Schmülling, T. Cytokinin Action in Plant Development. Curr. Opin. Plant Biol. 2009, 12, 527–538. [Google Scholar] [CrossRef]
- Takei, K.; Sakakibara, H.; Sugiyama, T. Identification of Genes Encoding Adenylate Isopentenyltransferase, a Cytokinin Biosynthesis Enzyme, in Arabidopsis Thaliana. J. Biol. Chem. 2001, 276, 26405–26410. [Google Scholar] [CrossRef] [Green Version]
- Maxwell, B.B.; Kieber, J.J. Cytokinin Signal Transduction. In Plant Hormones: Biosynthesis, Signal Transduction, Action! Springer: Dordrecht, The Netherlands, 2010; pp. 329–357. [Google Scholar]
- Hirose, N.; Takei, K.; Kuroha, T.; Kamada-Nobusada, T.; Hayashi, H.; Sakakibara, H. Regulation of Cytokinin Biosynthesis, Compartmentalization and Translocation. J. Exp. Bot. 2008, 59, 75–83. [Google Scholar] [CrossRef] [Green Version]
- Takei, K.; Yamaya, T.; Sakakibara, H. Arabidopsis CYP735A1 and CYP735A2 Encode Cytokinin Hydroxylases That Catalyze the Biosynthesis of Trans-Zeatin. J. Biol. Chem. 2004, 279, 41866–41872. [Google Scholar] [CrossRef] [Green Version]
- Jahnen, W.; Batterham, M.P.; Clarke, A.E.; Moritz, R.L.; Simpson, R.J. Identification, Isolation, and N-Terminal Sequencing of Style Glycoproteins Associated with Self-Incompatibility in Nicotiana Alata. Plant Cell 1989, 1, 493–499. [Google Scholar] [CrossRef] [Green Version]
- Ai, Y.; Singh, A.; Coleman, C.E.; Ioerger, T.R.; Kheyr-Pour, A.; Kao, T. Self-Incompatibility in Petunia Inflata: Isolation and Characterization of CDNAs Encoding Three S-Allele-Associated Proteins. Sexual Plant Reprod. 1990, 3, 130–138. [Google Scholar] [CrossRef]
- Kubo, K.-I.; Paape, T.; Hatakeyama, M.; Entani, T.; Takara, A.; Kajihara, K.; Tsukahara, M.; Shimizu-Inatsugi, R.; Shimizu, K.K.; Takayama, S. Gene Duplication and Genetic Exchange Drive the Evolution of S-RNase-Based Self-Incompatibility in Petunia. Nat. Plants 2015, 1, 14005. [Google Scholar] [CrossRef] [Green Version]
- Luu, D.-T.; Qin, X.; Morse, D.; Cappadocia, M. S-RNase Uptake by Compatible Pollen Tubes in Gametophytic Self-Incompatibility. Nature 2000, 407, 649–651. [Google Scholar] [CrossRef]
- Torres-Rodríguez, M.D.; Cruz-Zamora, Y.; Juárez-Díaz, J.A.; Mooney, B.; McClure, B.A.; Cruz-García, F. NaTrxh Is an Essential Protein for Pollen Rejection in Nicotiana by Increasing S-RNase Activity. Plant J. 2020, 103, 1304–1317. [Google Scholar] [CrossRef]
- Goldraij, A.; Kondo, K.; Lee, C.B.; Hancock, C.N.; Sivaguru, M.; Vazquez-Santana, S.; Kim, S.; Phillips, T.E.; Cruz-Garcia, F.; McClure, B. Compartmentalization of S-RNase and HT-B Degradation in Self-Incompatible Nicotiana. Nature 2006, 439, 805–810. [Google Scholar] [CrossRef]
- Matsumoto, D.; Tao, R. Recognition of S-RNases by an S Locus F-Box like Protein and an S Haplotype-Specific F-Box like Protein in the Prunus-Specific Self-Incompatibility System. Plant Mol. Biol. 2019, 100, 367–378. [Google Scholar] [CrossRef]
- Thomas, S.G.; Franklin-Tong, V.E. Self-Incompatibility Triggers Programmed Cell Death in Papaver Pollen. Nature 2004, 429, 305–309. [Google Scholar] [CrossRef]
- Kao, T.H.; Tsukamoto, T. The molecular and genetic bases of S-RNase-based self-incompatibility. Plant Cell 2004, 16 (Suppl. S1), S72–S83. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.-L.; Wu, J.; Xu, G.-H.; Gao, Y.; Chen, G.; Wu, J.-Y.; Wu, H.; Zhang, S.-L. S-RNase Disrupts Tip-Localized Reactive Oxygen Species and Induces Nuclear DNA Degradation in Incompatible Pollen Tubes of Pyrus Pyrifolia. J. Cell Sci. 2010, 123, 4301–4309. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.-Q.; Xu, G.-H.; Zhang, S.-L. Pyrus Pyrifolia Stylar S-RNase Induces Alterations in the Actin Cytoskeleton in Self-Pollen and Tubes in Vitro. Protoplasma 2007, 232, 61–67. [Google Scholar] [CrossRef]
- Chai, L.; Tudor, R.L.; Poulter, N.S.; Wilkins, K.A.; Eaves, D.J.; Franklin, F.C.H.; Franklin-Tong, V.E. MAP Kinase PrMPK9-1 Contributes to the Self-Incompatibility Response. Plant Physiol. 2017, 174, 1226–1237. [Google Scholar] [CrossRef] [Green Version]
- Lin, Z.; Xie, F.; Triviño, M.; Karimi, M.; Bosch, M.; Franklin-Tong, V.E.; Nowack, M.K. Ectopic Expression of a Self-Incompatibility Module Triggers Growth Arrest and Cell Death in Vegetative Cells. Plant Physiol. 2020, 183, 1765–1779. [Google Scholar] [CrossRef]
- Su, S.; Dai, H.; Wang, X.; Wang, C.; Zeng, W.; Huang, J.; Duan, Q. Ethylene Negatively Mediates Self-Incompatibility Response in Brassica Rapa. Biochem. Biophys. Res. Commun. 2020, 525, 600–606. [Google Scholar] [CrossRef]
- Tsuruta, M.; Iwaki, R.; Lian, C.; Mukai, Y. Decreased RNase Activity Under High Temperature Is Related to Promotion of Self-Pollen Tube Growth in the Pistil of the Japanese Flowering Cherry, Prunus × Yedoensis ‘Somei-Yoshino’. Hortic. J. 2020, 89, 306–310. [Google Scholar] [CrossRef] [Green Version]
- Aloisi, I.; Distefano, G.; Antognoni, F.; Potente, G.; Parrotta, L.; Faleri, C.; Gentile, A.; Bennici, S.; Mareri, L.; Cai, G.; et al. Temperature-Dependent Compatible and Incompatible Pollen-Style Interactions in Citrus Clementina Hort. Ex Tan. Show Different Transglutaminase Features and Polyamine Pattern. Front. Plant Sci. 2020, 11, 1018. [Google Scholar] [CrossRef]
- Yu, J.; Wang, B.; Fan, W.; Fan, S.; Xu, Y.; Liu, C.; Lv, T.; Liu, W.; Wu, L.; Xian, L.; et al. Polyamines Involved in Regulating Self-Incompatibility in Apple. Genes 2021, 12, 1797. [Google Scholar] [CrossRef]
- Ye, M.; Peng, Z.; Tang, D.; Yang, Z.; Li, D.; Xu, Y.; Zhang, C.; Huang, S. Generation of Self-Compatible Diploid Potato by Knockout of S-RNase. Nat. Plants 2018, 4, 651–654. [Google Scholar] [CrossRef]
- Enciso-Rodriguez, F.; Manrique-Carpintero, N.C.; Nadakuduti, S.S.; Buell, C.R.; Zarka, D.; Douches, D. Overcoming Self-Incompatibility in Diploid Potato Using CRISPR-Cas9. Front. Plant Sci. 2019, 10, 376. [Google Scholar] [CrossRef]
Primer | Sequence (5’➝3’) |
---|---|
IPT5f | GAATCCGACGGTCCATTGGT |
IPT5r | GCTGGAAAATGGGTGGCAAG |
Ef1af | CCTGGTCAAATTGGAAACGG |
Ef1ar | CAGATCGCCTGTCAATCTTGG |
Time after Pollination | Self-Compatible Pollination (Control), Length of PTs (μm) | Self-Compatible Pollination + Zeatin (10 µM), Length of PTs (μm) |
---|---|---|
2 h | 1345 ± 68 | 250 ± 50 |
4 h | 2840 ± 105 | 480 ± 35 |
6 h | 5488 ± 324 | 1278 ± 87 |
24 h | Reached the ovary | 2898 ± 176 |
Time after Pollination | Self-Incompatible Pollination (Control), Length of PTs (μm) | Self-Incompatible Pollination + Zeatin, Length of PTs (μm) |
---|---|---|
2 h | 1298 ± 45 | 0 |
4 h | 1601 ± 59 | 0 |
6 h | 1691 ± 87 | 0 |
24 h | 1898 ± 102 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zakharova, E.; Khanina, T.; Knyazev, A.; Milyukova, N.; Kovaleva, L.V. Hormonal Signaling during dPCD: Cytokinin as the Determinant of RNase-Based Self-Incompatibility in Solanaceae. Biomolecules 2023, 13, 1033. https://doi.org/10.3390/biom13071033
Zakharova E, Khanina T, Knyazev A, Milyukova N, Kovaleva LV. Hormonal Signaling during dPCD: Cytokinin as the Determinant of RNase-Based Self-Incompatibility in Solanaceae. Biomolecules. 2023; 13(7):1033. https://doi.org/10.3390/biom13071033
Chicago/Turabian StyleZakharova, Ekaterina, Tatiana Khanina, Andrey Knyazev, Natalia Milyukova, and Lidia V. Kovaleva. 2023. "Hormonal Signaling during dPCD: Cytokinin as the Determinant of RNase-Based Self-Incompatibility in Solanaceae" Biomolecules 13, no. 7: 1033. https://doi.org/10.3390/biom13071033