Survey of Commercial Food Products for Detection of Walnut (Juglans regia) by Two ELISA Methods and Real Time PCR
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Chemicals
2.2. Experimental Binary Mixtures
2.3. Heterologous Species and Commercial Products
2.4. Protein and DNA Extraction
2.5. Sandwich ELISA Kit for Detection of Walnut in Food Samples
2.6. Direct ELISA with Multimeric scFv
2.7. Real time PCR Analysis
2.8. SDS-PAGE and Western Blotting Analysis
2.9. Protein Identification
3. Results and Discussion
3.1. Evaluation of the Sandwich ELISA Kit for Detection of Walnut
3.2. Evaluation of the Walnut Direct ELISA with Multimeric scFv
3.3. Identification of the Walnut Proteins Recognized by the JrBSF scFv
3.4. Analysis of Commercial Products
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hayes, D.; Angove, M.J.; Tucci, J.; Dennis, C. Walnuts (Juglans regia) Chemical Composition and Research in Human Health. Crit. Rev. Food Sci. Nutr. 2013, 56, 1231–1241. [Google Scholar] [CrossRef]
- Blankestijn, M.A.; Remington, B.C.; Houben, G.F.; Baumert, J.L.; Knulst, A.C.; Blom, W.M.; Klemans, R.J.; Taylor, S.L. Threshold Dose Distribution in Walnut Allergy. J. Allergy Clin. Immunol. Pract. 2017, 5, 376–380. [Google Scholar] [CrossRef] [PubMed]
- Ballmer-Weber, B.K.; Lidholm, J.; Lange, L.; Pascal, M.; Lang, C.; Gernert, S.; Lozano-Blasco, J.; Gräni, N.; Guillod, C.; Wangorsch, A.; et al. Allergen Recognition Patterns in Walnut Allergy Are Age Dependent and Correlate with the Severity of Allergic Reactions. J. Allergy Clin. Immunol. Pract. 2019, 7, 1560–1567. [Google Scholar] [CrossRef]
- Burney, P.G.J.; Potts, J.; Kummeling, I.; Mills, E.N.C.; Clausen, M.; Dubakiene, R.; Barreales, L.; Fernandez-Perez, C.; Fernandez-Rivas, M.; Le, T.-M.; et al. The prevalence and distribution of food sensitization in European adults. Allergy 2013, 69, 365–371. [Google Scholar] [CrossRef] [Green Version]
- Graham, F.; Eigenmann, P.A. Clinical implications of food allergen thresholds. Clin. Exp. Allergy 2018, 48, 632–640. [Google Scholar] [CrossRef] [PubMed]
- European Union Regulation (EU) No 1169/2011 on the Provision of Food Information to Consumers, Amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006, and Repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commission Directive 1999/10/EC, Di. Off; Publications Office of the European Union: Luxembourg, 2011; Volume 304, pp. 18–63.
- De la Cruz, S.; López-Calleja, I.; Martín, R.; González, I.; Alcocer, M.; García, T. Recent advances in the detection of allergens in foods. Meth. Mol. Biol. 2017, 1592, 263–295. [Google Scholar]
- Linacero, R.; Ballesteros, I.; Sanchiz, A.; Prieto, N.; Iniesto, E.; Martín, B.C.; Pedrosa, M.M.; Muzquiz, M.; Cabanillas, B.; Rovira, M.; et al. Detection by real time PCR of walnut allergen coding sequences in processed foods. Food Chem. 2016, 202, 334–340. [Google Scholar] [CrossRef]
- López-Calleja, I.M.; De La Cruz, S.; González, I.; García, T.; Martín, R. Market analysis of food products for detection of allergenic walnut (Juglans regia) and pecan (Carya illinoinensis) by real-time PCR. Food Chem. 2015, 177, 111–119. [Google Scholar] [CrossRef] [PubMed]
- Costa, J.; Fernandes, T.J.; Villa, C.; Oliveira, M.B.P.; Mafra, I. Advances in Food Allergen Analysis. In Food Safety; Wiley: Hoboken, NJ, USA, 2016; pp. 305–360. [Google Scholar]
- E Johnson, P.; Baumgartner, S.; Aldick, T.; Bessant, C.; Giosafatto, V.; Heick, J.; Mamone, G.; O’Connor, G.; Poms, R.; Popping, B.; et al. Current Perspectives and Recommendations for the Development of Mass Spectrometry Methods for the Determination of Allergens in Foods. J. AOAC Int. 2011, 94, 1026–1033. [Google Scholar] [CrossRef]
- DunnGalvin, A.; Chan, C.-H.; Crevel, R.; Grimshaw, K.; Poms, R.; Schnadt, S.; Taylor, S.L.; Turner, P.; Allen, K.J.; Austin, M.; et al. Precautionary allergen labelling: Perspectives from key stakeholder groups. Allergy 2015, 70, 1039–1051. [Google Scholar] [CrossRef]
- Allen, K.J.; Taylor, S.L. The Consequences of Precautionary Allergen Labeling: Safe Haven or Unjustifiable Burden? J. Allergy Clin. Immunol. Pract. 2018, 6, 400–407. [Google Scholar] [CrossRef] [PubMed]
- Thompson, M.; Ellison, S.L.R.; Wood, R. Harmonized guidelines for single-laboratory validation of methods of analysis (IUPAC Technical Report). Pure Appl. Chem. 2002, 74, 835–855. [Google Scholar] [CrossRef]
- Madrid, R.; De La Cruz, S.; García-García, A.; Alcocer, M.J.; González, I.; García, T.; Martín, R. Multimeric recombinant antibody (scFv) for ELISA detection of allergenic walnut. An alternative to animal antibodies. J. Food Compos. Anal. 2018, 67, 201–210. [Google Scholar] [CrossRef]
- Borkowska, P.; Zielińska, A.; Paul-Samojedny, M.; Stojko, R.; Kowalski, J. Evaluation of reference genes for quantitative real-time PCR in Wharton’s Jelly-derived mesenchymal stem cells after lentiviral transduction and differentiation. Mol. Biol. Rep. 2019, 47, 1107–1115. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef]
- Sechi, S.; Chait, B.T. Modification of Cysteine Residues by Alkylation. A Tool in Peptide Mapping and Protein Identification. Anal. Chem. 1998, 70, 5150–5158. [Google Scholar] [CrossRef] [PubMed]
- Vencia, W.; Minale, P.; Migone, L.; Lazzara, F.; Vito, G.; Ferrari, A.; Razzuoli, E. Effects of thermal treatment on walnut detection and allergenicity. J. Sci. Food Agric. 2019, 99, 2636–2640. [Google Scholar] [CrossRef]
- Cabanillas, B.; Novak, N. Effects of daily food processing on allergenicity. Crit. Rev. Food Sci. Nutr. 2019, 59, 31–42. [Google Scholar] [CrossRef]
- Blankestijn, M.A.; Jager, C.F.D.H.; Blom, W.M.; Otten, H.G.; De Jong, G.A.H.; Gaspari, M.; Houben, G.F.; Knulst, A.C.; Verhoeckx, K.C.M.; De Jong, G.A.H. A subset of walnut allergic adults is sensitized to walnut 11S globulin Jug r 4. Clin. Exp. Allergy 2018, 48, 1206–1213. [Google Scholar] [CrossRef] [Green Version]
- Downs, M.L.; Baumert, J.L.; Taylor, S.L.; Mills, E. Mass spectrometric analysis of allergens in roasted walnuts. J. Proteom. 2016, 142, 62–69. [Google Scholar] [CrossRef]
- Costa, J.; Carrapatoso, I.; Oliveira, M.B.; Mafra, I. Walnut allergens: Molecular characterization, detection and clinical relevance. Clin. Exp. Allergy 2014, 44, 319–341. [Google Scholar] [CrossRef] [PubMed]
- Remington, B.C.; Westerhout, J.; Meima, M.Y.; Blom, W.M.; Kruizinga, A.G.; Wheeler, M.W.; Taylor, S.L.; Houben, G.F.; Baumert, J.L. Updated population minimal eliciting dose distributions for use in risk assessment of 14 priority food allergens. Food Chem. Toxicol. 2020, 139, 111259. [Google Scholar] [CrossRef]
- Ozdal, T.; Capanoglu, E.; Altay, F. A review on protein–phenolic interactions and associated changes. Food Res. Int. 2013, 51, 954–970. [Google Scholar] [CrossRef]
- Niemann, L.; Taylor, S.L.; Hefle, S.L. Detection of Walnut Residues in Foods Using an Enzyme-Linked Immunosorbent Assay. J. Food Sci. 2009, 74, T51–T57. [Google Scholar] [CrossRef]
- Labuckas, D.O.; Maestri, D.M.; Perelló, M.; Martínez, M.L.; Lamarque, A.L. Phenolics from walnut (Juglans regia L.) kernels: Antioxidant activity and interactions with proteins. Food Chem. 2008, 107, 607–612. [Google Scholar] [CrossRef]
- Ford, L.S.; Taylor, S.L.; Pacenza, R.; Niemann, L.M.; Lambrecht, D.M.; Sicherer, S.H. Food allergen advisory labeling and product contamination with egg, milk, and peanut. J. Allergy Clin. Immunol. 2010, 126, 384–385. [Google Scholar] [CrossRef] [PubMed]
- European Union Directive 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the Protection of Animals Used for Scientific Purposes; Publications Office of the European Union: Luxembourg, 2010; pp. 33–79.
- Holzhauser, T. Protein or No Protein? Opportunities for DNA-Based Detection of Allergenic Foods. J. Agric. Food Chem. 2018, 66, 9889–9894. [Google Scholar] [CrossRef] [PubMed]
Detected Species | Primer and Probe | Length (bp) | Sequence (5′ → 3′) | nM | Cycling Conditions |
---|---|---|---|---|---|
Walnut | WalITSdir | 20 | GACAATCGGTGGTTGAGAAA | 300 | Initial denaturation: 10 min 95 °C Amplification: 50 cycles at 95 °C for 5 s 60 °C for 30 s 72 °C for 1 s Cooling: 40 °C for 30 s. |
WallITSinv | 20 | GTCGAGGAGCACCTTCACAG | 900 | ||
WalITSP | 18 | 6FAM-TGACCCGTCGTGTGTTGCCC-BBQ | 2000 | ||
Pecan | PecITSdir | 18 | ATGAAAGCTGCCCACCGC | 300 | |
PecITSinv | 18 | CATTGTTCGACCGGGAAG | 900 | ||
PecITSP | 19 | 6FAM-CGGGTCAGTCTCCTCGTTC-BBQ | 2000 | ||
18S | 18Sdir | 16 | TGGTGCCAGCAGCCGC | 300 | |
18Sinv | 25 | TCCAACTACGAGCTTTTTAACTGCA | 900 | ||
18SP | 22 | 6FAM-CGCTATTGGAGCTGGAATTACC-BBQ | 2000 |
Sample | ABS 450 nm | SD | Estimated Walnut Concentration (mg kg−1) |
---|---|---|---|
Walnut | 3.055 * | 0.112 | * |
Pecan | 0.358 | 0.019 | 3.04 |
Almond | 0.274 | 0.052 | 2.38 |
Hazelnut | 0.007 | 0.002 | ND |
Cashew | 0.022 | 0.003 | ND |
Pistachio | 0.041 | 0.006 | ND |
Macadamia nut | 0.029 | 0.015 | ND |
Brazil nut | 0.014 | 0.011 | ND |
Peanut | 0.055 | 0.008 | ND |
Soja | 0.008 | 0.021 | ND |
Gel Band | Protein Identification | Accession Number | Sequence Coverage | Total Score | Peptide Sequences |
---|---|---|---|---|---|
1 | 11S globulin seed storage protein 2-like [Juglans regia] | XP_018818401.1 | 31% | 107 | R.FRSFLLAGGEPR.D R.IRHNLDTQTESDVFSR.Q R.HNLDTQTESDVFSR.Q R.VNIVNQHKLPILR.Y K.GHLFPNALYTPHWSMTDNR.V R.VQIVDDNGDNVFDER.V R.VQIVDDNGDNVFDERVKK.R K.RGDVYVIPQFYATTAR.A R.GDVYVIPQFYATTAR.A R.AGNNGFEYVTIK.T K.TSGQPMKSPMAGYTSVIR.A K.TSGQPMKSPMAGYTSVIR.A K.TSGQPMKSPMAGYTSVIR.A K.SPMAGYTSVIR.A R.AMPIDVLTNSFQMSPR.E R.AMPIDVLTNSFQMSPR.E K.HNRGHQSFLLSSSR.S R.GHQSFLLSSSR.S |
Label Statement | Product | Number of Samples | Multimeric scFv ELISA | Walnut Kit Alertox® | ITS Real Time PCR |
---|---|---|---|---|---|
Walnut declared as ingredient | Biscuit Nut bar Breakfast cereals Chocolate Sauce Bread Beverage Ice cream Snack Yoghurt Sandwich | 5 5 1 2 1 3 1 1 1 5 2 | +(5) +(5) +(1) +(1)/−(1) −(1) +(3) −(1) −(1) +(1) −(5) +(1)/−(1) | +(5) +(5) +(1) +(1)/−(1) +(1) +(3) +(1) +(1) +(1) +(5) +(2) | +(5) +(5) +(1) +(1)/−(1) +(1) +(3) +(1) +(1) +(1) +(5) +(2) |
May contain walnut | Chocolate Yoghurt | 1 1 | −(1) −(1) | −(1) −(1) | −(1) −(1) |
Contains other tree nuts | Biscuit Nut bar Breakfast cereals Chocolate Breadstick Beverage Ice cream | 4 9 10 2 1 2 2 | −(4) −(9) +(5)/−(5) −(2) −(1) −(2) −(2) | −(4) −(9) +(7)/−(3) −(2) −(1) −(2) −(2) | −(4) −(9) +(6)/−(4) −(2) −(1) −(2) −(2) |
May contain tree nuts traces | Biscuit Nut bar Breakfast cereals Chocolate Beverage Ice cream | 6 5 3 10 1 1 | −(6) −(5) −(3) −(10) −(1) −(1) | −(6) −(5) −(3) +(2)/- (8) −(1) −(1) | −(6) −(5) −(3) +(3)/−(7) −(1) −(1) |
Not declaring nuts or traces as ingredient | Biscuit Nut bar Breakfast cereals Chocolate Sauce Bread Beverage Ice cream Snack | 3 1 3 1 1 1 2 2 1 | −(3) −(1) −(3) −(1) −(1) −(1) −(2) −(2) −(1) | −(3) −(1) −(3) −(1) −(1) −(1) −(2) −(2) −(1) | −(3) −(1) −(3) −(1) −(1) −(1) −(2) −(2) −(1) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Madrid, R.; García-García, A.; Cabrera, P.; González, I.; Martín, R.; García, T. Survey of Commercial Food Products for Detection of Walnut (Juglans regia) by Two ELISA Methods and Real Time PCR. Foods 2021, 10, 440. https://doi.org/10.3390/foods10020440
Madrid R, García-García A, Cabrera P, González I, Martín R, García T. Survey of Commercial Food Products for Detection of Walnut (Juglans regia) by Two ELISA Methods and Real Time PCR. Foods. 2021; 10(2):440. https://doi.org/10.3390/foods10020440
Chicago/Turabian StyleMadrid, Raquel, Aina García-García, Pablo Cabrera, Isabel González, Rosario Martín, and Teresa García. 2021. "Survey of Commercial Food Products for Detection of Walnut (Juglans regia) by Two ELISA Methods and Real Time PCR" Foods 10, no. 2: 440. https://doi.org/10.3390/foods10020440