Dexmedetomidine Protects Cerebellar Neurons against Hyperoxia-Induced Oxidative Stress and Apoptosis in the Juvenile Rat
Abstract
:1. Introduction
2. Results
2.1. Dexmedetomidine Exerts Anti-Apoptotic Effects following High Oxygen Exposure
2.2. Dexmedetomidine Counteracts the Hyperoxia-Induced Oxidative Stress Response
2.3. Dexmedetomidine Promotes the Attenuation of the Hyperoxia-Induced Inflammatory Response
3. Discussion
4. Materials and Methods
4.1. Animal Welfare
4.2. Oxygen Exposure and Drug Administration
4.3. Tissue Preparation
4.4. RNA Extraction and Quantitative Real-Time PCR
4.5. Immunohistochemistry
4.6. Protein Extraction
4.7. Enzyme-Linked Immunosorbent Assays (ELISAs) for TNFα
4.8. Thiobarbituric Acid Reactive Substances (TBARS) Assay
4.9. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Perin, J.; Mulick, A.; Yeung, D.; Villavicencio, F.; Lopez, G.; Strong, K.L.; Prieto-Merino, D.; Cousens, S.; Black, R.E.; Liu, L. Global, regional, and national causes of under-5 mortality in 2000–19: An updated systematic analysis with implications for the Sustainable Development Goals. Lancet. Child Adolesc. Health 2022, 6, 106–115. [Google Scholar] [CrossRef] [PubMed]
- Lembo, C.; Buonocore, G.; Perrone, S. Oxidative Stress in Preterm Newborns. Antioxidants 2021, 10, 1672. [Google Scholar] [CrossRef] [PubMed]
- Perrone, S.; Santacroce, A.; Longini, M.; Proietti, F.; Bazzini, F.; Buonocore, G. The Free Radical Diseases of Prematurity: From Cellular Mechanisms to Bedside. Oxidative Med. Cell. Longev. 2018, 2018, 7483062. [Google Scholar] [CrossRef] [PubMed]
- Perrone, S.; Tataranno, M.L.; Stazzoni, G.; Buonocore, G. Biomarkers of oxidative stress in fetal and neonatal diseases. J. Matern.-Fetal Neonatal Med. 2012, 25, 2575–2578. [Google Scholar] [CrossRef]
- Panfoli, I.; Candiano, G.; Malova, M.; De Angelis, L.; Cardiello, V.; Buonocore, G.; Ramenghi, L.A. Oxidative Stress as a Primary Risk Factor for Brain Damage in Preterm Newborns. Front. Pediatr. 2018, 6, 369. [Google Scholar] [CrossRef]
- Torres-Cuevas, I.; Parra-Llorca, A.; Sanchez-Illana, A.; Nunez-Ramiro, A.; Kuligowski, J.; Chafer-Pericas, C.; Cernada, M.; Escobar, J.; Vento, M. Oxygen and oxidative stress in the perinatal period. Redox Biol. 2017, 12, 674–681. [Google Scholar] [CrossRef]
- Perez, M.; Robbins, M.E.; Revhaug, C.; Saugstad, O.D. Oxygen radical disease in the newborn, revisited: Oxidative stress and disease in the newborn period. Free. Radic. Biol. Med. 2019, 142, 61–72. [Google Scholar] [CrossRef]
- Saugstad, O.D. Update on oxygen radical disease in neonatology. Curr. Opin. Obstet. Gynecol. 2001, 13, 147–153. [Google Scholar] [CrossRef]
- Thibeault, D.W. The precarious antioxidant defenses of the preterm infant. Am. J. Perinatol. 2000, 17, 167–181. [Google Scholar] [CrossRef]
- Abdel Ghany, E.A.; Alsharany, W.; Ali, A.A.; Younass, E.R.; Hussein, J.S. Anti-oxidant profiles and markers of oxidative stress in preterm neonates. Paediatr. Int. Child Health 2015, 36, 134–140. [Google Scholar] [CrossRef]
- Salim, S. Oxidative Stress and the Central Nervous System. J. Pharmacol. Exp. Ther. 2017, 360, 201–205. [Google Scholar] [CrossRef]
- Obst, S.; Herz, J.; Alejandre Alcazar, M.A.; Endesfelder, S.; Möbius, M.A.; Rüdiger, M.; Felderhoff-Müser, U.; Bendix, I. Perinatal Hyperoxia and Developmental Consequences on the Lung-Brain Axis. Oxidative Med. Cell. Longev. 2022, 2022, 5784146. [Google Scholar] [CrossRef] [PubMed]
- Tau, G.Z.; Peterson, B.S. Normal development of brain circuits. Neuropsychopharmacology 2010, 35, 147–168. [Google Scholar] [CrossRef] [PubMed]
- Lammertink, F.; Vinkers, C.H.; Tataranno, M.L.; Benders, M. Premature Birth and Developmental Programming: Mechanisms of Resilience and Vulnerability. Front. Psychiatry 2020, 11, 531571. [Google Scholar] [CrossRef] [PubMed]
- Tam, E.W.Y.; Chau, V.; Lavoie, R.; Chakravarty, M.M.; Guo, T.; Synnes, A.; Zwicker, J.; Grunau, R.; Miller, S.P. Neurologic Examination Findings Associated with Small Cerebellar Volumes after Prematurity. J. Child Neurol. 2019, 34, 586–592. [Google Scholar] [CrossRef]
- Anderson, P.J.; Treyvaud, K.; Neil, J.J.; Cheong, J.L.Y.; Hunt, R.W.; Thompson, D.K.; Lee, K.J.; Doyle, L.W.; Inder, T.E. Associations of Newborn Brain Magnetic Resonance Imaging with Long-Term Neurodevelopmental Impairments in Very Preterm Children. J. Pediatr. 2017, 187, 58–65.e1. [Google Scholar] [CrossRef]
- Spoto, G.; Amore, G.; Vetri, L.; Quatrosi, G.; Cafeo, A.; Gitto, E.; Nicotera, A.G.; Di Rosa, G. Cerebellum and Prematurity: A Complex Interplay Between Disruptive and Dysmaturational Events. Front. Syst. Neurosci. 2021, 15, 655164. [Google Scholar] [CrossRef]
- Limperopoulos, C.; Soul, J.S.; Gauvreau, K.; Huppi, P.S.; Warfield, S.K.; Bassan, H.; Robertson, R.L.; Volpe, J.J.; du Plessis, A.J. Late gestation cerebellar growth is rapid and impeded by premature birth. Pediatrics 2005, 115, 688–695. [Google Scholar] [CrossRef]
- Volpe, J.J. Cerebellum of the premature infant: Rapidly developing, vulnerable, clinically important. J. Child Neurol. 2009, 24, 1085–1104. [Google Scholar] [CrossRef]
- Morsing, E.; Lundgren, P.; Hård, A.L.; Rakow, A.; Hellström-Westas, L.; Jacobson, L.; Johnson, M.; Nilsson, S.; Smith, L.E.H.; Sävman, K.; et al. Neurodevelopmental disorders and somatic diagnoses in a national cohort of children born before 24 weeks of gestation. Acta Paediatr. 2022, 111, 1167–1175. [Google Scholar] [CrossRef]
- Pascal, A.; Govaert, P.; Oostra, A.; Naulaers, G.; Ortibus, E.; Van den Broeck, C. Neurodevelopmental outcome in very preterm and very-low-birthweight infants born over the past decade: A meta-analytic review. Dev. Med. Child Neurol. 2018, 60, 342–355. [Google Scholar] [CrossRef]
- Doyle, L.W.; Spittle, A.; Anderson, P.J.; Cheong, J.L.Y. School-aged neurodevelopmental outcomes for children born extremely preterm. Arch. Dis. Child. 2021, 106, 834–838. [Google Scholar] [CrossRef]
- Cheong, J.L.Y.; Olsen, J.E.; Lee, K.J.; Spittle, A.J.; Opie, G.F.; Clark, M.; Boland, R.A.; Roberts, G.; Josev, E.K.; Davis, N.; et al. Temporal Trends in Neurodevelopmental Outcomes to 2 Years After Extremely Preterm Birth. JAMA Pediatr. 2021, 175, 1035–1042. [Google Scholar] [CrossRef] [PubMed]
- Kanel, D.; Vanes, L.D.; Pecheva, D.; Hadaya, L.; Falconer, S.; Counsell, S.J.; Edwards, D.A.; Nosarti, C. Neonatal White Matter Microstructure and Emotional Development during the Preschool Years in Children Who Were Born Very Preterm. Eneuro 2021, 8, ENEURO.0546-20.2021. [Google Scholar] [CrossRef] [PubMed]
- Laverty, C.; Surtees, A.; O’Sullivan, R.; Sutherland, D.; Jones, C.; Richards, C. The prevalence and profile of autism in individuals born preterm: A systematic review and meta-analysis. J. Neurodev. Disord. 2021, 13, 41. [Google Scholar] [CrossRef] [PubMed]
- Johnson, S.; Marlow, N. Early and long-term outcome of infants born extremely preterm. Arch. Dis. Child. 2017, 102, 97–102. [Google Scholar] [CrossRef]
- Bouayed, J.; Bohn, T. Exogenous antioxidants--Double-edged swords in cellular redox state: Health beneficial effects at physiologic doses versus deleterious effects at high doses. Oxidative Med. Cell. Longev. 2010, 3, 228–237. [Google Scholar] [CrossRef]
- Moore, T.A.; Ahmad, I.M.; Zimmerman, M.C. Oxidative Stress and Preterm Birth: An Integrative Review. Biol. Res. Nurs. 2018, 20, 497–512. [Google Scholar] [CrossRef]
- Tataranno, M.L.; Perrone, S.; Longini, M.; Buonocore, G. New antioxidant drugs for neonatal brain injury. Oxidative Med. Cell. Longev. 2015, 2015, 108251. [Google Scholar] [CrossRef]
- Falsaperla, R.; Lombardo, F.; Filosco, F.; Romano, C.; Saporito, M.A.N.; Puglisi, F.; Piro, E.; Ruggieri, M.; Pavone, P. Oxidative Stress in Preterm Infants: Overview of Current Evidence and Future Prospects. Pharmaceuticals 2020, 13, 145. [Google Scholar] [CrossRef]
- Li, F.; Wang, X.; Deng, Z.; Zhang, X.; Gao, P.; Liu, H. Dexmedetomidine reduces oxidative stress and provides neuroprotection in a model of traumatic brain injury via the PGC-1α signaling pathway. Neuropeptides 2018, 72, 58–64. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Liu, S. The Effect of Dexmedetomidine on Oxidative Stress Response Following Cerebral Ischemia-Reperfusion in Rats and the Expression of Intracellular Adhesion Molecule-1 (ICAM-1) and S100B. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2017, 23, 867–873. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zeng, M.; Chen, W.; Liu, C.; Wang, F.; Han, X.; Zuo, Z.; Peng, S. Dexmedetomidine reduces isoflurane-induced neuroapoptosis partly by preserving PI3K/Akt pathway in the hippocampus of neonatal rats. PLoS ONE 2014, 9, e93639. [Google Scholar] [CrossRef]
- Endesfelder, S.; Makki, H.; von Haefen, C.; Spies, C.D.; Buhrer, C.; Sifringer, M. Neuroprotective effects of dexmedetomidine against hyperoxia-induced injury in the developing rat brain. PLoS ONE 2017, 12, e0171498. [Google Scholar] [CrossRef]
- Sifringer, M.; von Haefen, C.; Krain, M.; Paeschke, N.; Bendix, I.; Buhrer, C.; Spies, C.D.; Endesfelder, S. Neuroprotective effect of dexmedetomidine on hyperoxia-induced toxicity in the neonatal rat brain. Oxidative Med. Cell. Longev. 2015, 2015, 530371. [Google Scholar] [CrossRef]
- Puls, R.; von Haefen, C.; Bührer, C.; Endesfelder, S. Protective Effect of Dexmedetomidine against Hyperoxia-Damaged Cerebral Neurodevelopment in the Juvenile Rat. Antioxidants 2023, 12, 980. [Google Scholar] [CrossRef]
- Reich, B.; Hoeber, D.; Bendix, I.; Felderhoff-Mueser, U. Hyperoxia and the Immature Brain. Dev. Neurosci. 2016, 38, 311–330. [Google Scholar] [CrossRef]
- Lithopoulos, M.A.; Toussay, X.; Zhong, S.; Xu, L.; Mustafa, S.B.; Ouellette, J.; Freitas-Andrade, M.; Comin, C.H.; Bassam, H.A.; Baker, A.N.; et al. Neonatal hyperoxia in mice triggers long-term cognitive deficits via impairments in cerebrovascular function and neurogenesis. J. Clin. Investig. 2022, 132, e146095. [Google Scholar] [CrossRef]
- Dilek, M.; Orallar, H.; Cetinkaya, A.; Bozat, G.; Pehlivan, F.; Bekdas, M.; Kabakus, N. Can Excessive Oxygen Cause Hyperactive Behavior Disorder in Preterm Children? Cognitive Effects of Hyperoxia in the Preterm Brain of Rats. Neurophysiology 2019, 51, 259–265. [Google Scholar] [CrossRef]
- Katheria, A.C.; Stout, J.; Morales, A.L.; Poeltler, D.; Rich, W.D.; Steen, J.; Nuzzo, S.; Finer, N. Association between early cerebral oxygenation and neurodevelopmental impairment or death in premature infants. J. Perinatol. 2021, 41, 743–748. [Google Scholar] [CrossRef]
- Ramani, M.; Kumar, R.; Halloran, B.; Lal, C.V.; Ambalavanan, N.; McMahon, L.L. Supraphysiological Levels of Oxygen Exposure During the Neonatal Period Impairs Signaling Pathways Required for Learning and Memory. Sci. Rep. 2018, 8, 9914. [Google Scholar] [CrossRef] [PubMed]
- Perrone, S.; Bracciali, C.; Di Virgilio, N.; Buonocore, G. Oxygen Use in Neonatal Care: A Two-edged Sword. Front. Pediatr. 2017, 4, 143. [Google Scholar] [CrossRef] [PubMed]
- Alva, R.; Mirza, M.; Baiton, A.; Lazuran, L.; Samokysh, L.; Bobinski, A.; Cowan, C.; Jaimon, A.; Obioru, D.; Al Makhoul, T.; et al. Oxygen toxicity: Cellular mechanisms in normobaric hyperoxia. Cell Biol. Toxicol. 2022, 39, 111–143. [Google Scholar] [CrossRef] [PubMed]
- Gandhi, S.; Abramov, A.Y. Mechanism of oxidative stress in neurodegeneration. Oxidative Med. Cell. Longev. 2012, 2012, 428010. [Google Scholar] [CrossRef] [PubMed]
- Forman, H.J.; Maiorino, M.; Ursini, F. Signaling functions of reactive oxygen species. Biochemistry 2010, 49, 835–842. [Google Scholar] [CrossRef] [PubMed]
- Endesfelder, S.; Weichelt, U.; Strauss, E.; Schlor, A.; Sifringer, M.; Scheuer, T.; Buhrer, C.; Schmitz, T. Neuroprotection by Caffeine in Hyperoxia-Induced Neonatal Brain Injury. Int. J. Mol. Sci. 2017, 18, 187. [Google Scholar] [CrossRef]
- Zhang, H.; Forman, H.J. Glutathione synthesis and its role in redox signaling. Semin. Cell Dev. Biol. 2012, 23, 722–728. [Google Scholar] [CrossRef]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive Oxygen Species in Inflammation and Tissue Injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef]
- Khan, J.Y.; Black, S.M. Developmental changes in murine brain antioxidant enzymes. Pediatr. Res. 2003, 54, 77–82. [Google Scholar] [CrossRef]
- Aspberg, A.; Tottmar, O. Development of antioxidant enzymes in rat brain and in reaggregation culture of fetal brain cells. Dev. Brain Res. 1992, 66, 55–58. [Google Scholar] [CrossRef]
- Juan, C.A.; Pérez de la Lastra, J.M.; Plou, F.J.; Pérez-Lebeña, E. The Chemistry of Reactive Oxygen Species (ROS) Revisited: Outlining Their Role in Biological Macromolecules (DNA, Lipids and Proteins) and Induced Pathologies. Int. J. Mol. Sci. 2021, 22, 4642. [Google Scholar] [CrossRef] [PubMed]
- Saha, R.N.; Pahan, K. Signals for the induction of nitric oxide synthase in astrocytes. Neurochem. Int. 2006, 49, 154–163. [Google Scholar] [CrossRef] [PubMed]
- Bal-Price, A.; Brown, G.C. Inflammatory neurodegeneration mediated by nitric oxide from activated glia-inhibiting neuronal respiration, causing glutamate release and excitotoxicity. J. Neurosci. 2001, 21, 6480–6491. [Google Scholar] [CrossRef] [PubMed]
- Pacher, P.; Beckman, J.S.; Liaudet, L. Nitric oxide and peroxynitrite in health and disease. Physiol. Rev. 2007, 87, 315–424. [Google Scholar] [CrossRef] [PubMed]
- Fleury, C.; Mignotte, B.; Vayssière, J.L. Mitochondrial reactive oxygen species in cell death signaling. Biochimie 2002, 84, 131–141. [Google Scholar] [CrossRef]
- Hu, Y.; Zhou, H.; Zhang, H.; Sui, Y.; Zhang, Z.; Zou, Y.; Li, K.; Zhao, Y.; Xie, J.; Zhang, L. The neuroprotective effect of dexmedetomidine and its mechanism. Front. Pharmacol. 2022, 13, 965661. [Google Scholar] [CrossRef]
- Dahmani, S.; Rouelle, D.; Gressens, P.; Mantz, J. Effects of dexmedetomidine on hippocampal focal adhesion kinase tyrosine phosphorylation in physiologic and ischemic conditions. Anesthesiology 2005, 103, 969–977. [Google Scholar] [CrossRef]
- Zhang, F.; Ding, T.; Yu, L.; Zhong, Y.; Dai, H.; Yan, M. Dexmedetomidine protects against oxygen-glucose deprivation-induced injury through the I2 imidazoline receptor-PI3K/AKT pathway in rat C6 glioma cells. J. Pharm. Pharmacol. 2012, 64, 120–127. [Google Scholar] [CrossRef]
- Qiu, Z.; Lu, P.; Wang, K.; Zhao, X.; Li, Q.; Wen, J.; Zhang, H.; Li, R.; Wei, H.; Lv, Y.; et al. Dexmedetomidine Inhibits Neuroinflammation by Altering Microglial M1/M2 Polarization Through MAPK/ERK Pathway. Neurochem. Res. 2020, 45, 345–353. [Google Scholar] [CrossRef]
- Zhang, X.; Yan, F.; Feng, J.; Qian, H.; Cheng, Z.; Yang, Q.; Wu, Y.; Zhao, Z.; Li, A.; Xiao, H. Dexmedetomidine inhibits inflammatory reaction in the hippocampus of septic rats by suppressing NF-κB pathway. PLoS ONE 2018, 13, e0196897. [Google Scholar] [CrossRef]
- Wang, K.; Zhu, Y. Dexmedetomidine protects against oxygen-glucose deprivation/reoxygenation injury-induced apoptosis via the p38 MAPK/ERK signalling pathway. J. Int. Med. Res. 2018, 46, 675–686. [Google Scholar] [CrossRef] [PubMed]
- Lima Giacobbo, B.; Doorduin, J.; Klein, H.C.; Dierckx, R.; Bromberg, E.; de Vries, E.F.J. Brain-Derived Neurotrophic Factor in Brain Disorders: Focus on Neuroinflammation. Mol. Neurobiol. 2019, 56, 3295–3312. [Google Scholar] [CrossRef] [PubMed]
- Janke, E.L.; Samra, S. Dexmedetomidine and neuroprotection. Semin. Anesth. Perioper. Med. Pain 2006, 25, 71–76. [Google Scholar] [CrossRef]
- Karakaya, D.; Cakir-Aktas, C.; Uzun, S.; Soylemezoglu, F.; Mut, M. Tailored Therapeutic Doses of Dexmedetomidine in Evolving Neuroinflammation after Traumatic Brain Injury. Neurocritical Care 2022, 36, 802–814. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. Blocking IL-1 in systemic inflammation. J. Exp. Med. 2005, 201, 1355–1359. [Google Scholar] [CrossRef] [PubMed]
- Goshen, I.; Kreisel, T.; Ounallah-Saad, H.; Renbaum, P.; Zalzstein, Y.; Ben-Hur, T.; Levy-Lahad, E.; Yirmiya, R. A dual role for interleukin-1 in hippocampal-dependent memory processes. Psychoneuroendocrinology 2007, 32, 1106–1115. [Google Scholar] [CrossRef]
- Liu, X.; Quan, N. Microglia and CNS Interleukin-1: Beyond Immunological Concepts. Front. Neurol. 2018, 9, 8. [Google Scholar] [CrossRef]
- Pérez-Rodríguez, D.R.; Blanco-Luquin, I.; Mendioroz, M. The Participation of Microglia in Neurogenesis: A Review. Brain Sci. 2021, 11, 658. [Google Scholar] [CrossRef]
- Tchélingérian, J.L.; Le Saux, F.; Jacque, C. Identification and topography of neuronal cell populations expressing TNF alpha and IL-1 alpha in response to hippocampal lesion. J. Neurosci. Res. 1996, 43, 99–106. [Google Scholar] [CrossRef]
- French, R.A.; VanHoy, R.W.; Chizzonite, R.; Zachary, J.F.; Dantzer, R.; Parnet, P.; Bluthé, R.M.; Kelley, K.W. Expression and localization of p80 and p68 interleukin-1 receptor proteins in the brain of adult mice. J. Neuroimmunol. 1999, 93, 194–202. [Google Scholar] [CrossRef]
- Motoki, K.; Kishi, H.; Hori, E.; Tajiri, K.; Nishijo, H.; Muraguchi, A. The direct excitatory effect of IL-1beta on cerebellar Purkinje cell. Biochem. Biophys. Res. Commun. 2009, 379, 665–668. [Google Scholar] [CrossRef] [PubMed]
- Ravizza, T.; Vezzani, A. Status epilepticus induces time-dependent neuronal and astrocytic expression of interleukin-1 receptor type I in the rat limbic system. Neuroscience 2006, 137, 301–308. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Wu, W.; Lin, X.; Shen, M.; Yang, Z.; Yu, S.; Luo, Y. Protective effects of dexmedetomidine in vital organ injury: Crucial roles of autophagy. Cell. Mol. Biol. Lett. 2022, 27, 34. [Google Scholar] [CrossRef] [PubMed]
- Xue, H.; Wu, Z.; Xu, Y.; Gao, Q.; Zhang, Y.; Li, C.; Zhao, P. Dexmedetomidine post-conditioning ameliorates long-term neurological outcomes after neonatal hypoxic ischemia: The role of autophagy. Life Sci. 2021, 270, 118980. [Google Scholar] [CrossRef]
- Yi, C.; Fu, Z.; Luo, X. Dexmedetomidine on autophagy of hippocampal neurons in aged rats under sevoflurane anesthesia. Exp. Ther. Med. 2018, 16, 837–841. [Google Scholar] [CrossRef]
- Luo, C.; Ouyang, M.W.; Fang, Y.Y.; Li, S.J.; Zhou, Q.; Fan, J.; Qin, Z.S.; Tao, T. Dexmedetomidine Protects Mouse Brain from Ischemia-Reperfusion Injury via Inhibiting Neuronal Autophagy through Up-Regulating HIF-1α. Front. Cell. Neurosci. 2017, 11, 197. [Google Scholar] [CrossRef]
- Unchiti, K.; Leurcharusmee, P.; Samerchua, A.; Pipanmekaporn, T.; Chattipakorn, N.; Chattipakorn, S.C. The potential role of dexmedetomidine on neuroprotection and its possible mechanisms: Evidence from in vitro and in vivo studies. Eur. J. Neurosci. 2021, 54, 7006–7047. [Google Scholar] [CrossRef]
- Feng, X.; Ma, W.; Zhu, J.; Jiao, W.; Wang, Y. Dexmedetomidine alleviates early brain injury following traumatic brain injury by inhibiting autophagy and neuroinflammation through the ROS/Nrf2 signaling pathway. Mol. Med. Rep. 2021, 24, 661. [Google Scholar] [CrossRef]
- Chen, L.; Cao, J.; Cao, D.; Wang, M.; Xiang, H.; Yang, Y.; Ying, T.; Cong, H. Protective effect of dexmedetomidine against diabetic hyperglycemia-exacerbated cerebral ischemia/reperfusion injury: An in vivo and in vitro study. Life Sci. 2019, 235, 116553. [Google Scholar] [CrossRef]
- Huang, Z.; Liu, G.; Zeng, Q.; Gao, R.; Zhang, S.; Wang, L.; Liu, B.; Yu, Y.; Zhao, A.; Li, R.; et al. MiR-29b expression is associated with a dexmedetomidine-mediated protective effect against oxygen-glucose deprivation-induced injury to SK-N-SH cells in vitro. Cell Biol. Int. 2018, 42, 344–352. [Google Scholar] [CrossRef]
- Zhu, Y.; Li, S.; Liu, J.; Wen, Q.; Yu, J.; Yu, L.; Xie, K. Role of JNK Signaling Pathway in Dexmedetomidine Post-Conditioning-Induced Reduction of the Inflammatory Response and Autophagy Effect of Focal Cerebral Ischemia Reperfusion Injury in Rats. Inflammation 2019, 42, 2181–2191. [Google Scholar] [CrossRef] [PubMed]
- Leveque, C.; Mrakic-Sposta, S.; Lafère, P.; Vezzoli, A.; Germonpré, P.; Beer, A.; Mievis, S.; Virgili, F.; Lambrechts, K.; Theunissen, S.; et al. Oxidative Stress Response’s Kinetics after 60 Minutes at Different (30% or 100%) Normobaric Hyperoxia Exposures. Int. J. Mol. Sci. 2022, 24, 664. [Google Scholar] [CrossRef] [PubMed]
- Angelova, P.R.; Choi, M.L.; Berezhnov, A.V.; Horrocks, M.H.; Hughes, C.D.; De, S.; Rodrigues, M.; Yapom, R.; Little, D.; Dolt, K.S.; et al. Alpha synuclein aggregation drives ferroptosis: An interplay of iron, calcium and lipid peroxidation. Cell Death Differ. 2020, 27, 2781–2796. [Google Scholar] [CrossRef] [PubMed]
- Giszas, V.; Strauß, E.; Bührer, C.; Endesfelder, S. The Conflicting Role of Caffeine Supplementation on Hyperoxia-Induced Injury on the Cerebellar Granular Cell Neurogenesis of Newborn Rats. Oxidative Med. Cell. Longev. 2022, 2022, 5769784. [Google Scholar] [CrossRef] [PubMed]
- Gustorff, C.; Scheuer, T.; Schmitz, T.; Bührer, C.; Endesfelder, S. GABAB Receptor-Mediated Impairment of Intermediate Progenitor Maturation During Postnatal Hippocampal Neurogenesis of Newborn Rats. Front. Cell. Neurosci. 2021, 15, 651072. [Google Scholar] [CrossRef]
- Heise, J.; Schmitz, T.; Bührer, C.; Endesfelder, S. Protective Effects of Early Caffeine Administration in Hyperoxia-Induced Neurotoxicity in the Juvenile Rat. Antioxidants 2023, 12, 295. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Oligonucleotide Sequence 5′-3′ | Accession No. | |
---|---|---|
AIF | ||
forward | CACAAAGACACTGCAGTTCAGACA | NM_031356.1 |
reverse | AGGTCCTGAGCAGAGACATAGAAAG | |
probe | 6-FAM-AGAAGCATCTATTTCCAGCC-TAMRA | |
Casp3 | ||
forward | ACAGTGGAACTGACGATGATATGG | NM_012922.2 |
reverse | AATAGTAACCGGGTGCGGTAGA | |
probe | 6-FAM-ATGCCAGAAGATACCAGTGG-TAMRA | |
GCLC | ||
forward | GGAGGACAACATGAGGAAACG | NM_012815.2 |
reverse | GCTCTGGCAGTGTGAATCCA | |
probe | 6-FAM-TCAGGCTCTTTGCACGATAA-TAMRA | |
HPRT | ||
forward | GGAAAGAACGTCTTGATTGTTGAA | NM_012583.2 |
reverse | CCAACACTTCGAGAGGTCCTTTT | |
probe | 6-FAM-CTTTCCTTGGTCAAGCAGTACAGCCCC-TAMRA | |
IL1β | ||
forward | CTCCACCTCAATGGACAGAACA | NM_031512.2 |
reverse | CACAGGGATTTTGTCGTTGCT | |
probe | 6-FAM-CTCCATGAGCTTTGTACAAG-TAMRA | |
iNOS | ||
forward | AGCTGTAGCACTGCATCAGAAATG | NM_012611.3 |
reverse | CAGTAATGGCCGACCTGATGT | |
probe | 6-FAM-CAGACACATACTTTACGCCAC-TAMRA | |
Nrf2 | ||
forward | ACTCCCAGGTTGCCCACAT | NM_031789.2 |
reverse | GCGACTCATGGTCATCTACAAATG | |
probe | 6-FAM-CTTTGAAGACTGTATGCAGC-TAMRA | |
SOD1 | ||
forward | CAGAAGGCAAGCGGTGAAC | NM_017050.1 |
reverse | CCCCATATTGATGGACATGGA | |
probe | 6-FAM-TACAGGATTAACTGAAGGCG-TAMRA | |
SOD2 | ||
forward | GACCTACGTGAACAATCTGAACGT | NM_017051.2 |
reverse | AGGCTGAAGAGCAACCTGAGTT | |
probe | 6-FAM-ACCGAGGAGAAGTACCACGA-TAMRA | |
SOD3 | ||
forward | GGAGAGTCCGGTGTCGACTTAG | NM_012880.1 |
reverse | CTCCATCCAGATCTCCAGGTCTT | |
probe | 6-FAM-CTGGTTGAGAAGATAGGCGA-TAMRA | |
TNFα | ||
forward | CCCCCAATCTGTGTCCTTCTAAC | NM_012675.3 |
reverse | CGTCTCGTGTGTTTCTGAGCAT | |
probe | 6-FAM-TAGAAAGGGAATTGTGGCTC-TAMRA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Puls, R.; von Haefen, C.; Bührer, C.; Endesfelder, S. Dexmedetomidine Protects Cerebellar Neurons against Hyperoxia-Induced Oxidative Stress and Apoptosis in the Juvenile Rat. Int. J. Mol. Sci. 2023, 24, 7804. https://doi.org/10.3390/ijms24097804
Puls R, von Haefen C, Bührer C, Endesfelder S. Dexmedetomidine Protects Cerebellar Neurons against Hyperoxia-Induced Oxidative Stress and Apoptosis in the Juvenile Rat. International Journal of Molecular Sciences. 2023; 24(9):7804. https://doi.org/10.3390/ijms24097804
Chicago/Turabian StylePuls, Robert, Clarissa von Haefen, Christoph Bührer, and Stefanie Endesfelder. 2023. "Dexmedetomidine Protects Cerebellar Neurons against Hyperoxia-Induced Oxidative Stress and Apoptosis in the Juvenile Rat" International Journal of Molecular Sciences 24, no. 9: 7804. https://doi.org/10.3390/ijms24097804