Biological Activity and Component Analyses of Chamaecyparis obtusa Leaf Extract: Evaluation of Antiwrinkle and Cell Protection Effects in UVA-Irradiated Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Chemical and Reagents
2.3. Antioxidant Assays
2.3.1. Total Polyphenol Content
2.3.2. Total Flavonoid Content
2.3.3. Electron-Donating Ability
2.3.4. ABTS+ Radical Scavenging Assay
2.3.5. Superoxide Dismutase (SOD)-like Activity
2.3.6. Xanthine Oxidase Inhibition Assay
2.3.7. Ferric Reducing Antioxidant Power (FRAP)
2.4. Cell Protective Capacity
2.4.1. Cell Culture and UV Irradiation
2.4.2. Cell Viability Assay
2.5. Anti-Aging Effect
2.5.1. Elastase Inhibition Activity
2.5.2. Collagenase Inhibition Activity
2.5.3. qPCR
2.6. HPLC Analysis
2.7. Statistical Analysis
3. Results and Discussion
3.1. Antioxidant Effect of C. obtusa Extract
3.2. Effect of C. obtusa Extract on Fibroblast Damage under UVA Irradiation
3.3. Anti-Aging Effect of C. obtusa Extract
3.4. Quantitative Analysis of Four Structural Compounds in C. obtusa
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, S.; Duan, E. Fighting against skin aging: The way from bench to bedside. Cell Transpl. 2018, 27, 729–738. [Google Scholar] [CrossRef]
- Parrado, C.; Mercado-Saenz, S.; Perez-Davo, A.; Gilaberte, Y.; Gonzalez, S.; Juarranz, A. Environmental stressors on skin aging. Mechanistic insights. Front. Pharmacol. 2019, 10, 759. [Google Scholar] [CrossRef] [PubMed]
- Pourzand, C.; Albieri-Borges, A.; Raczek, N.N. Shedding a new light on skin aging, iron- and redox-homeostasis and emerging natural antioxidants. Antioxidants 2022, 11, 471. [Google Scholar] [CrossRef]
- Chen, X.; Yang, C.; Jiang, G. Research progress on skin photoaging and oxidative stress. Postep. Derm. Alergol. 2021, 38, 931–936. [Google Scholar] [CrossRef] [PubMed]
- Halliwell, B.; Cross, C.E. Oxygen-derived species: Their relation to human disease and environmental stress. Environ. Health Perspect. 1994, 102, 5–12. [Google Scholar] [CrossRef] [Green Version]
- Salim, S. Oxidative stress and the central nervous system. J. Pharm. Exp. Ther. 2017, 360, 201–205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barnes, L.; Ino, F.; Jaunin, F.; Saurat, J.-H.; Kaya, G. Inhibition of putative Hyalurosome platform in keratinocytes as a mechanism for corticosteroid-induced epidermal atrophy. J. Invest. Dermatol. 2013, 133, 1017–1026. [Google Scholar] [CrossRef] [Green Version]
- Aruoma, O.I. Methodological consideration for characterization for potential antioxidant actions of bioactive components in plants foods. Mutat. Res. 2003, 532, 9–20. [Google Scholar] [CrossRef]
- Mohammed, A.A.; Ibrahim, A.A. Pathological roles of reactive oxygen species and their defence mechanism. Saudi Pharm. J. 2004, 12, 1–18. [Google Scholar]
- Bagchi, K.; Puri, S. Freeradicals and antioxidants in health and disease: A review. East Mediterr. Health J. 1998, 4, 350–360. [Google Scholar] [CrossRef]
- Thring, T.S.; Hili, P.; Naughton, D.P. Anti-collagenase, anti-elastase and anti-oxidant activities of extracts from 21 plants. BMC Complement Altern. Med. 2009, 9, 27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lourenço, S.C.; Moldão-Martins, M.; Alves, V.D. Antioxidants of natural plant origins: From sources to food industry applications. Molecules 2019, 24, 4132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camera, E.; Mastrofrancesco, A.; Fabbri, C.; Daubrawa, F.; Picardo, M.; Sies, H.; Stahl, W. Astaxanthin, canthaxanthin and beta-carotene differently affect UVA-induced oxidative damage and expression of oxidative stress-responsive enzymes. Exp. Dermatol. 2009, 18, 222–231. [Google Scholar] [CrossRef] [PubMed]
- Inui, M.; Ooe, M.; Fujii, K.; Matsunaka, H.; Yoshida, M.; Ichihashi, M. Mechanisms of inhibitory effects of CoQ10 on UVB-induced wrinkle formation in vitro and in vivo. Biofactors 2008, 32, 237–243. [Google Scholar] [CrossRef]
- Jung, H.Y.; Shin, J.C.; Park, S.M.; Kim, N.R.; Kwak, W.; Choi, B.H. Pinus densiflora extract protects human skin fibroblasts against UVB-induced photoaging by inhibiting the expression of MMPs and increasing type I procollagen expression. Toxicol. Rep. 2014, 1, 658–666. [Google Scholar] [CrossRef] [Green Version]
- Ermi Hikmawanti, N.P.; Fatmawati, S.; Wulan Asri, A. The effect of ethanol concentrations as the extraction solvent on antioxidant activity of katuk (Sauropus androgynus (L.) Merr.) leaves extracts. IOP Conf. Ser. Earth Environ. Sci. 2021, 755, 012060. [Google Scholar] [CrossRef]
- Mohammed, E.A.; Abdalla, I.G.; Alfawaz, M.A.; Mohammed, M.A.; Al Maiman, S.A.; Osman, M.A.; Yagoub, A.E.A.; Hassan, A.B. Effects of extraction solvents on the total phenolic content, total flavonoid content, and antioxidant activity in the aerial part of root vegetables. Agriculture 2022, 12, 1820. [Google Scholar] [CrossRef]
- Ahn, C.; Lee, J.H.; Kim, J.W.; Park, M.J.; Lee, S.S.; Jeung, E.B. Alleviation effects of natural volatile organic compounds from Pinus densiflora and Chamaecyparis obtusa on systemic and pulmonary inflammation. Biomed. Rep. 2018, 9, 405–414. [Google Scholar] [CrossRef]
- Wang, W.; Hwang, C.; Lin, T.; Hwang, S. Historical biogeography and phylogenetic relationships of the genus Chamaecyparis (Cupressaceae) inferred from chloroplast DNA polymorphism. Plant Syst. Evol. 2003, 241, 13–28. [Google Scholar] [CrossRef]
- Jeong, E.J.; Hwang, L.; Lee, M.; Lee, K.Y.; Ahn, M.J.; Sung, S.H. Neuroprotective biflavonoids of Chamaecyparis obtusa leaves against glutamate-induced oxidative stress in HT22 hippocampal cells. Food Chem. Toxicol. 2014, 64, 397–402. [Google Scholar] [CrossRef]
- Madhuri, K.; Naik, P.R. Ameliorative effect of borneol, a natural bicyclic monoterpene against hyperglycemia, hyperlipidemia and oxidative stress in streptozotocin-induced diabetic Wistar rats. Biomed. Pharmacother. 2017, 96, 336–347. [Google Scholar] [CrossRef]
- Park, C.M.; Yoon, H.S. Anti-bacterial effects of lavender and peppermint oils on Streptococcus mutans. J. Korean Acad. Oral Health 2018, 42, 210. [Google Scholar] [CrossRef] [Green Version]
- Kwon, P.S.; Kim, D.-J.; Park, H. Improved antibacterial effect of blending essential oils. Korean J. Clin. Lab. Sci. 2017, 49, 256–262. [Google Scholar] [CrossRef] [Green Version]
- Joo, S.S.; Yoo, Y.M.; Ko, S.H.; Choi, W.; Park, M.J.; Kang, H.Y.; Choi, K.C.; Choi, I.G.; Jeung, E.B. Effects of essential oil from Chamaecyparis obtusa on the development of atopic dermatitis-like skin lesions and the suppression of Th cytokines. J. Derm. Sci. 2010, 60, 122–125. [Google Scholar] [CrossRef] [PubMed]
- Park, D.; Jeon, J.H.; Kwon, S.C.; Shin, S.; Jang, J.Y.; Jeong, H.S.; Lee, I.; Kim, Y.B.; Joo, S.S. Antioxidative activities of white rose flower extract and pharmaceutical advantages of its hexane fraction via free radical scavenging effects. Biochem. Cell Biol. 2009, 87, 943–952. [Google Scholar] [CrossRef]
- Joung, Y.-W.; Kim, Y.-M.; Jang, Y.-A. Studies on the antioxidant and whitening effects of Chamaecyparis obtusa extract. J. Korean Appl. Sci. Technol. 2020, 37, 1496–1506. [Google Scholar]
- Pyo, Y.-H.; You, S.-H. A study on the latest research trends in natural products with anti-aging effects. J. Converg. Inf. Technol. 2019, 9, 286–293. [Google Scholar] [CrossRef]
- Selim, S.A.; Adam, M.E.; Hassan, S.M.; Albalawi, A.R. Chemical composition, antimicrobial and antibiofilm activity of the essential oil and methanol extract of the Mediterranean cypress (Cupressus sempervirens L.). BMC Complement Altern. Med. 2014, 14, 179. [Google Scholar] [CrossRef]
- Folin, O.; Denis, W. On phosphotungstic-phosphomolybdic compounds as color reagents. J. Biol. Chem. 1912, 12, 239–243. [Google Scholar] [CrossRef]
- Davies, R.; Massey, R.C.; McWeeny, D.J. The catalysis of the N-nitrosation of secondary amines by nitrosophenols. Food Chem. 1980, 6, 115–122. [Google Scholar] [CrossRef]
- Blois, M.S. Antioxidant determinations by the use of a stable free radical. Nature 1958, 181, 1199–1200. [Google Scholar] [CrossRef]
- Brand-Williams, W.; Cuvelier, M.E.; Berset, C. Use of a free radical method to evaluate antioxidant activity. LWT—Food Sci. Technol. 1995, 28, 25–30. [Google Scholar] [CrossRef]
- Marklund, S.; Marklund, G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 1974, 47, 469–474. [Google Scholar] [CrossRef] [PubMed]
- Stirpe, F.; Della Corte, E. The regulation of rat liver xanthine oxidase. Conversion in vitro of the enzyme activity from dehydrogenase (type D) to oxidase (type O). J. Biol. Chem. 1969, 244, 3855–3863. [Google Scholar] [CrossRef] [PubMed]
- Oyaizu, M. Studies on products of browning reaction. Antioxidative activities of products of browning reaction prepared from glucosamine. Jpn. J. Nutr. Diet. 1986, 44, 307–315. [Google Scholar] [CrossRef] [Green Version]
- Carmichael, J.; DeGraff, W.G.; Gazdar, A.F.; Minna, J.D.; Mitchell, J.B. Evaluation of a tetrazolium-based semiautomated colorimetric assay: Assessment of chemosensitivity testing. Cancer Res. 1987, 47, 936–942. [Google Scholar] [PubMed]
- Yoo, K.M.; Kim, D.O.; Lee, C.Y. Evaluation of different methods of antioxidant measurement. Food Sci. Biotechnol. 2007, 16, 177–182. [Google Scholar]
- Van Wart, H.E.; Steinbrink, D.R. A continuous spectrophotometric assay for Clostridium histolyticum collagenase. Anal. Biochem. 1981, 113, 356–365. [Google Scholar] [CrossRef] [PubMed]
- Köksal, E.; Gülçin, I.; Beyza, S.; Sarikaya, O.; Bursal, E. In vitro antioxidant activity of silymarin. J. Enzyme Inhib. Med. Chem. 2009, 24, 395–405. [Google Scholar] [CrossRef] [Green Version]
- Munteanu, I.G.; Apetrei, C. Analytical methods used in determining antioxidant activity: A review. Int. J. Mol. Sci. 2021, 22, 3380. [Google Scholar] [CrossRef]
- Guedes, A.C.; Amaro, H.M.; Gião, M.S.; Malcata, F.X. Optimization of ABTS radical cation assay specifically for determination of antioxidant capacity of intracellular extracts of microalgae and cyanobacteria. Food Chem. 2013, 138, 638–643. [Google Scholar] [CrossRef] [PubMed]
- Apak, R.; Güçlü, K.; Demirata, B.; Ozyürek, M.; Celik, S.E.; Bektaşoğlu, B.; Berker, K.I.; Ozyurt, D. Comparative evaluation of various total antioxidant capacity assays applied to phenolic compounds with the CUPRAC assay. Molecules 2007, 12, 1496–1547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amna, K.S.; Park, S.Y.; Choi, M.; Kim, S.Y.; Yoo, A.Y.; Park, J.K. Antioxidant activity of manno-oligosaccharides derived from the hydrolysis of polymannan by extracellular carbohydrase of Bacillus N3. J. Marine Biosci. Biotech. 2018, 10, 9–17. [Google Scholar] [CrossRef]
- Desco, M.C.; Asensi, M.; Márquez, R.; Martínez-Valls, J.; Vento, M.; Pallardó, F.V.; Sastre, J.; Viña, J. Xanthine oxidase is involved in free radical production in type 1 diabetes: Protection by allopurinol. Diabetes 2002, 51, 1118–1124. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, Y.R.; Kim, W.J. Characterization Natural Chamaecyparis Obtusa Leaf Extract to Remove Senile Body Odor. London J. Res. Sci. 2021, 21, 1–14. [Google Scholar]
- Kim, J.H.; Jeong, C.H.; Choi, G.N.; Kwak, J.H.; Choi, S.G.; Heo, H.J. Antioxidant and neuronal cell protective effects of methanol extract from Schisandra chinensis using an in vitro system. Korean J. Food Sci. Technol. 2009, 41, 712–716. [Google Scholar]
- Pittayapruek, P.; Meephansan, J.; Prapapan, O.; Komine, M.; Ohtsuki, M. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. Int. J. Mol. Sci. 2016, 17, 868. [Google Scholar] [CrossRef] [Green Version]
- Perron, N.R.; Brumaghim, J.L. A review of the antioxidant mechanisms of polyphenol compounds related to iron binding. Cell Biochem. Biophys. 2009, 53, 75–100. [Google Scholar] [CrossRef]
- Shin, J.W.; Kwon, S.H.; Choi, J.Y.; Na, J.I.; Huh, C.H.; Choi, H.R.; Park, K.C. Molecular mechanisms of dermal aging and antiaging approaches. Int. J. Mol. Sci. 2019, 20, 2126. [Google Scholar] [CrossRef] [Green Version]
- Ha, B.G.; Park, M.A.; Lee, C.M.; Kim, Y.C. Antioxidant activity and anti-wrinkle effects of Aceriphyllum rossii leaf ethanol extract. Toxicol. Res. 2015, 31, 363–369. [Google Scholar] [CrossRef] [Green Version]
- Jiratchayamaethasakul, C.; Ding, Y.; Hwang, O.; Im, S.T.; Jang, Y.; Myung, S.W.; Lee, J.M.; Kim, H.S.; Ko, S.C.; Lee, S.H. In vitro screening of elastase, collagenase, hyaluronidase, and tyrosinase inhibitory and antioxidant activities of 22 halophyte plant extracts for novel cosmeceuticals. Fish Aquatic. Sci. 2020, 23, 6. [Google Scholar] [CrossRef] [Green Version]
- Schmelzer, C.E.; Jung, M.C.; Wohlrab, J.; Neubert, R.H.; Heinz, A. Does human leukocyte elastase degrade intact skin elastin? FEBS J. 2012, 279, 4191–4200. [Google Scholar] [CrossRef] [PubMed]
- Widowati, W.; Rani, A.P.; Hamzah, R.A.; Arumwardana, S.; Afifah, E.; Kusuma, H.S.W.; Rihibiha, D.D.; Nufus, H.; Amalia, A. Antioxidant and antiaging assays of Hibiscus sabdariffa extract and its compounds. Nat. Prod. Sci. 2017, 23, 192–200. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.S.; Oh, Y.J.; Kim, J.W.; Han, K.M.; Kim, D.S.; Park, J.W.; Kim, H.M.; Kim, D.W.; Kim, Y.-S. Antioxidant, Whitening, Antiwrinkle, and Anti-Inflammatory Effect of Ajuga spectabilis Nakai Extract. Plants 2023, 12, 79. [Google Scholar] [CrossRef] [PubMed]
- Loo, Y.C.; Hu, H.C.; Yu, S.Y.; Tsai, Y.H.; Korinek, M.; Wu, Y.C.; Chang, F.R.; Chen, Y.J. Development on potential skin anti-aging agents of Cosmos caudatus Kunth via inhibition of collagenase, MMP-1 and MMP-3 activities. Phytomedicine 2023, 110, 154643. [Google Scholar] [CrossRef]
- Ting, Z.; Yang, N.; Kai-di, H.; Fan-Shu, B.U.; Xiao-Kun, B.; Qiu-Long, Z.; Sheng, G.; Er-Xin, S.; Da-Wei, Q.; Jin-Ao, D. Identification of metabolites of Zhali Nusi Prescription in rat plasma, bile, urine and feces after oral administration. Zhongguo Zhong Yao Za Zhi 2020, 45, 5280–5288. [Google Scholar] [PubMed]
- Park, N.-H.; Lee, C.-W.; Bae, J.H.; Na, Y.J. Protective effects of amentoflavone on Lamin A-dependent UVB-induced nuclear aberration in normal human fibroblasts. Bioorg. Med. Chem. Lett. 2011, 21, 6482–6484. [Google Scholar] [CrossRef]
Gene | Primer | Sequence (5′-3′) | Expected Size (bp) | Accession Number |
---|---|---|---|---|
COL1A1 | Forward Reverse | GATTCCCTGGACCTAAAGGTGC AGCCTCTCCATCTTTGCCAGCA | 107 | NM_000088.4 |
MMP-1 | Forward Reverse | GGGCTTGAAGCTGCTTACGA ACAGCCCAGTACTTATTCCCTTTG | 74 | NM_002421.4 |
MMP-3 | Forward Reverse | GATGCCCACTTTGATGATGATGAA AGTGTTGGCTGAGTGAAAGAGACC | 119 | NM_002422.5 |
TNF-α | Forward Reverse | CCCAGGGACCTCTCTCTAATC GGTTTGCTACAACATGGGCTACA | 97 | NM_000594.4 |
IL-6 | Forward Reverse | ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG | 149 | NM_000600.5 |
SOD1 | Forward Reverse | ACTGGTGGTCCATGAAAAAGC AACGACTTCCAGCGTTTCCT | 83 | NM_000454.5 |
GAPDH | Forward Reverse | ACTGCTTAGCACCCCTGGCCA TTGGCAGTGGGGACACGGAAG | 253 | NM_001357943.2 |
Extract | Total Phenolic Content (mg TAE/g) | Total Flavonoid Content (mg QE/g) |
---|---|---|
Water | 45.04 ± 1.07 | 0.99 ± 0.05 |
70% Ethanol | 103.41 ± 5.25 | 1.77 ± 0.08 |
Compound | Linear Range (mg/L) | Response Slope (a) | Response Factor (b) | Correlation Coefficient (R2) | LOD (mg/L) | LOQ (mg/L) | Content (mg/g) |
---|---|---|---|---|---|---|---|
Quercitrin | 5–100 | 20,574 | −63,278 | 0.9913 | 0.641 | 1.944 | 12.4 |
Myricetin | 10–200 | 0.364 | −5.115 | 0.9958 | 16.437 | 49.808 | 0.26 |
Amentoflavone | 5–100 | 41,878 | −27,887 | 0.9998 | 0.848 | 2.569 | 5 |
Hinokiflavone | 5–100 | 0.4401 | −0.4674 | 0.9795 | 18.774 | 56.891 | 0.88 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, Y.-A.; Kim, S.-G.; Kim, H.-K.; Lee, J.-T. Biological Activity and Component Analyses of Chamaecyparis obtusa Leaf Extract: Evaluation of Antiwrinkle and Cell Protection Effects in UVA-Irradiated Cells. Medicina 2023, 59, 755. https://doi.org/10.3390/medicina59040755
Jang Y-A, Kim S-G, Kim H-K, Lee J-T. Biological Activity and Component Analyses of Chamaecyparis obtusa Leaf Extract: Evaluation of Antiwrinkle and Cell Protection Effects in UVA-Irradiated Cells. Medicina. 2023; 59(4):755. https://doi.org/10.3390/medicina59040755
Chicago/Turabian StyleJang, Young-Ah, Se-Gie Kim, Hye-Kyung Kim, and Jin-Tae Lee. 2023. "Biological Activity and Component Analyses of Chamaecyparis obtusa Leaf Extract: Evaluation of Antiwrinkle and Cell Protection Effects in UVA-Irradiated Cells" Medicina 59, no. 4: 755. https://doi.org/10.3390/medicina59040755