Identification of the Pathogen Causing Leaf Spot in Zinnia elegans and Its Sensitivity to Five Fungicides
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Pathogen Isolation and Purification
2.2. Pathogenicity Assay
2.3. Pathogen Identification and Phylogenetic Analyses
2.4. Determination of the Sensitivity of Strain BRJ2 to Fungicides
3. Results
3.1. Isolation of Pathogens and Pathogenicity Tests
3.2. Identification of the Strain BRJ2
3.3. Determination of the Sensitivity of Strain BRJ2 to Fungicides
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Francisco, J.C.; Souza, J.; Mayara, C.A. First report of Meloidogyne javanica infecting Zinnia elegans in Ceará State, Brazil. J Nematol. 2020, 52, 66. [Google Scholar]
- Beatri, M.B.; Francisco, M.P.V.; Heliel, Á.O.S. Ocorrência de oídio em Zinnia elegans no Estado do Ceará. Summa Phytopathol. 2017, 33, 421. [Google Scholar]
- Tânia, F.C.; Fernando, L.F.; Vanessa, R.D.S.; Ludmila, L.M.N.; José, J.B. Influência da sacarose e do corte da base da hastena longevidade de inflorescências de Zinnia elegans. Pesq. Agropec. Bras. 2002, 37, 1065–1070. [Google Scholar]
- Stimart, D.P.; Brown, D.J.; Solomos, T. Development of flowers and changes in carbon dioxide, ethylene, and various sugars of cut Zinnia elegans Jacq. J. Am. Soc. Hortic. Sci. 1983, 108, 651–655. [Google Scholar] [CrossRef]
- Mi, J.P.; Ji, H.P.; Hong, G.K.; Soon, G.L.; Yong, J.K.; Byung, S.K.; Byeongin, C.; Hyang, B.L.; Hyeon, D.S. Outbreak of Powdery Mildew on Zinnia elegans by Golovinomyces cichoracearum in Korea, 2008–2010. Plant Pathol. J. 2011, 27, 85–88. [Google Scholar]
- Stimart, D.P. Genetic and physiological studies of Zinnia elegans, Z. angustifolia and their interspecific hybrids. HortScience 1987, 22, 89–91. [Google Scholar] [CrossRef]
- Wen, L.; He, Y.Q.; Tao, F.; Li, L.; Feng, L.; Wang, Z.L.; Wang, G.L. First Report of Colletotrichum siamense Causing Anthracnose on Zinnia elegans in China. Plant Dis. 2021, 105, 1226. [Google Scholar]
- Mo, Z.; Jie, J.; Xiao, D.; Yong, F.L. First Report of Golovinomyces cichoracearum Causing Powdery Mildew on Zinnia elegans in China. Plant Dis. 2021, 105, 1213. [Google Scholar]
- Yi, T.X.; Yuan, M.S.; Chao, J.W.; Tung, C.H. First Report of Powdery Mildew on Zinnia elegans Caused by Podosphaera xanthii in Northeast China. Plant Dis. 2021, 105, 1201. [Google Scholar]
- Pascal, P. Pirone Diseases Andpests of Ornamental Plant, 3rd ed.; Wiley: Hoboken, NJ, USA, 1978; p. 537. [Google Scholar]
- He, L.; Liu, H.F.; Liu, F.Y.; Ni, Y.; Lu, B.; Deng, J.X. First Report of Leaf Spot Caused by Stemphylium lycopersici on Zinnia elegans in China. Plant Dis. 2019, 104, 578. [Google Scholar] [CrossRef]
- Zhao, Y.T.; Lu, B.H.; Bai, Q.R.; Gao, J. First Report of Xanthomonas campestris pv. zinniae Causing Bacterial Leaf and Flower Spot Disease of Zinnia elegans in Jilin Province, China. Plant Dis. 2015, 100, 208. [Google Scholar] [CrossRef]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in Filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef] [PubMed]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from Filamentous ascomycetes. Appl. Env. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kee, Y.J.; Hafifi, A.B.M.; Huda-Shakirah, A.R.; Wong, K.L.; Jin, X.L.; Zakaria, L.; Mohd, M.H. First report of reddish brown spot disease of red-fleshed dragon fruit (Hylocereus polyrhizus) caused by Nigrospora lacticolonia and Nigrospora sphaerica in Malaysia. Crop Prot. 2019, 122, 165–170. [Google Scholar] [CrossRef]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop, New Orleans, LA, USA, 14 November 2010. [Google Scholar] [CrossRef]
- Xing, K.; Liu, Y.F.; Shen, X.Q.; Zhu, X.; Li, X.Y.; Miao, X.M.; Feng, Z.Z.; Peng, X.; Qin, S. Effect of o-chitosan nanoparticles on the development and membrane permeability of Verticillium dahliae. Carbohydr. Polym. 2017, 165, 334–343. [Google Scholar] [CrossRef]
- Mo, F.; Hu, X.; Ding, Y.; Li, R.; Li, M. Naturally produced magnolol can significantly damage the plasma membrane of Rhizoctonia solani. Pestic. Biochem. Physiol. 2021, 178, 104942. [Google Scholar] [CrossRef] [PubMed]
- Raza, M.; Zhang, Z.F.; Hyde, K.D. Culturable plant pathogenic fungi associated with sugarcane in southern China. Fungal. Divers. 2019, 6, 104. [Google Scholar] [CrossRef]
- Dong, J.L.; Lee, J.S.; Lee, H.B. Four Endophytic Ascomycetes New to Korea: Cladosporium anthropophilum, C. pseudocladosporioides, Daldinia eschscholtzii, and Nigrospora chinensis. Kor. J. Mycol. 2019, 3, 47. [Google Scholar]
- Wang, Y.F.; Yao, J.A.; Li, Z.Q.; Huo, J.F.; Zhou, S.Q.; Liu, W.D.; Wu, H.X. Genome Sequence Resource for Nigrospora oryzae, an Important Pathogenic Fungus Threatening Crop Production. Mol. Plant Microbe Interact. 2021, 34, 835–838. [Google Scholar] [CrossRef]
- Jones, D.R.; Stover, R.H. Fungal Diseases of Banana Fruit; Jones, D.R., Ed.; CABI Publishing: Wallingford, UK, 2000; pp. 173–211. [Google Scholar]
- Wang, M.; Liu, F.; Crous, P.W.; Cai, L. Phylogenetic reassessment of Nigrospora: Ubiquitous endophytes, plant and human pathogens. Persoonia 2017, 39, 118–142. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.P.; Pen, A.T.; Lin, J.F.; Song, X.B.; Chen, B.P.; Chen, X. Isolation and Identification of Pathogen of Sugarcane Black Spot Disease and Fungicide Screening Test. Guangdong Agric. Sci. 2021, 48, 78–86. [Google Scholar]
- Hester, S.; Moore, T.; Padgett, W.T. The hepatocarcinogenic conazoles: Cyproconazole, epoxiconazole, and propiconazole induce a common set of toxicological and transcriptional responses. Toxicol. Sci. 2012, 127, 54–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S.Q.; Ma, J.; Wang, M.; Wang, X.H.; Li, Y.Q.; Chen, J. Combined application of Trichoderma harzianum SH2303 and difenoconazole propiconazole in controlling southern corn leaf blight disease caused by Cochliobolus heterostrophus in maize. J. Lintegr. Agr. 2019, 9, 2063–2071. [Google Scholar] [CrossRef]
- Shi, N.N.; Ruan, H.C.; Jie, Y.L.; Chen, F.R.; Du, Y.X. Characterization, fungicide sensitivity and efficacy of Colletotrichum spp. from chili in Fujian, China. Crop Prot. 2021, 143, 105572. [Google Scholar] [CrossRef]
- Xu, J.Q.; Diao, X.W.; Li, H.; Yang, X.; Wang, B.B.; Liu, Q.T. Sensitivity to difenoconazole and tebuconazole of Rhizoctonia cerealis in Henan Province in China. Chin. J. Pestic. Sci. 2016, 18, 582–588. [Google Scholar]
- Rallos, L.E.E.; Baudoin, A.B. Co-occurrence of two allelic variants of CYP51 in Erysiphe necator and their correlation with over-expression for DMI resistance. PLoS ONE. 2016, 11, e0148025. [Google Scholar] [CrossRef] [PubMed]
- Lichtemberg, P.S.F.; Luo, Y.; Morales, R.G.; Muehlmann, F.J.M.; Mi, C.T.J.; de Mio, L.L.M. The point mutation G461S inthe MfCYP51 gene is associated with tebuconazole resistance in Monilinia fructicola populations in Brazil. Phytopathology. 2017, 107, 1507–1514. [Google Scholar] [CrossRef] [PubMed]
- Li, B.H.Y.; Shi, J.; Tian, Y.Y.; Nie, L.X.; Wang, Y.Z. The sensitivity to ima-zalil and cross-resistance against several other synthetic fungicides in grapevine white rot pathogen Coniella diplodiella. J. Plant Prot. 2021, 48, 774–780. [Google Scholar]
- Éva, L.; Gall, T.; Csernoch, L.; Pocsi, I. Biofungicide utilizations of antifungal proteins of filamentous ascomycetes: Current and foreseeable future developments. Bio. Control. 2017, 62, 125–138. [Google Scholar]
Target Sequence | Primer | Primer Sequence (5′-3′) | Reference |
---|---|---|---|
ITS | ITS1 | CTTGGTCATTTAGAGGAAGTAA | [13] |
ITS4 | TCCTCCGCTTATTGATATGC | [14] | |
TEF1-α | EF1-728F | CATCGAGAAGTTCGAGAAGG | [15] |
EF1-986R | TACTTGAAGGAACCCTTACC | ||
TUB2 | T1 | AACATGCGTGAGATTGTAAGT | [16] |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | [17] |
Species | Strain No. | GeneBank Accession Number | ||
---|---|---|---|---|
ITS | TUB | TEF1-α | ||
Nigrospora. bambus | CGMCC3.18327 * | KY385307 | KY385319 | KY385313 |
Nigrospora. camelliae-sinen | CGMCC3.18125 * | KX985986 | KY019460 | KY019293 |
Nigrospora. gorlenkoana | CBS 480.73 * | KX986048 | KY019456 | KY019420 |
Nigrospora. guilinensis | CGMCC3.18124 * | KX985983 | KY019459 | KY019292 |
Nigrospora. hainanensis | CGMCC3.18129 * | KX986091 | KY019464.1 | KY019415 |
Nigrospora. musae | CBS 319.34 * | NR153478 | KY019455 | KY019419 |
Nigrospora. oryzae | LC6759 | KX986054 | KY019572.1 | KY019374.1 |
Nigrospora. pyriformis | CGMCC3.18122 * | KX985940 | KY019457.1 | KY019290.1 |
Nigrospora. rubi | CGMCC3.18326 * | KX985948 | KY019475 | KY019302 |
Nigrospora. sphaerica | LC 7312 | KX985935 | KY019618 | KY019414 |
Nigrospora. zimmermanii | CBS 167.26 | KY385308 | KY385318 | KY385312 |
Nigrospora. singularis sp. nov | CGMCC 3.19335 | MN215793 | MN329956 | MN264032 |
Nigrospora. vesicularifera | CGMCC 3.19333 | MN215812 | MN329975 | MN264051 |
Arthrinium malaysianum | CBS 102053 | KF144896.1 | KF144988.1 | KF145030.1 |
Fungicides | Concentrations (ug/mL) | Regression Equation of Toxicity | EC50 (mg/L) | Correlation Coefficient (r) |
---|---|---|---|---|
Prochloraz Manganese 50% WP | 0.25, 0.5, 1, 2, 4 | y = 1.3000x + 4.9061 | 1.1809 ± 0.11 | 0.9884 |
Difenoconazole 10% WG | 0.25, 0.74, 2.22, 6.66, 20 | y = 0.5188x + 5.6129 | 0.0658 ± 0.08 | 0.959 |
Trifloxystrobin·Tebuconazole 75% WG | 0.0375, 0.075, 0.15, 0.3, 0.6 | y = 1.3004x + 5.9678 | 0.1802 ± 0.07 | 0.9965 |
Cnidium Lactone 1% EW | 0.375, 0.75, 1.5, 3,9 | y = 1.1128x + 4.8046 | 1.4984 ± 0.16 | 0.9696 |
Shenqinmycin 1% SC | 1.5625, 3.125, 6.25, 12.5, 25 | y = 1.4781x + 4.0336 | 4.5066 ± 0.16 | 0.9826 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Yao, Q.; Liang, S.; Li, C.; Chen, X.; Li, Z. Identification of the Pathogen Causing Leaf Spot in Zinnia elegans and Its Sensitivity to Five Fungicides. Pathogens 2022, 11, 1454. https://doi.org/10.3390/pathogens11121454
Liu Y, Yao Q, Liang S, Li C, Chen X, Li Z. Identification of the Pathogen Causing Leaf Spot in Zinnia elegans and Its Sensitivity to Five Fungicides. Pathogens. 2022; 11(12):1454. https://doi.org/10.3390/pathogens11121454
Chicago/Turabian StyleLiu, Yu, Qiuyu Yao, Shuang Liang, Cheng Li, Xiangsheng Chen, and Zhong Li. 2022. "Identification of the Pathogen Causing Leaf Spot in Zinnia elegans and Its Sensitivity to Five Fungicides" Pathogens 11, no. 12: 1454. https://doi.org/10.3390/pathogens11121454