Next Article in Journal
Determination and Visualization of Peimine and Peiminine Content in Fritillaria thunbergii Bulbi Treated by Sulfur Fumigation Using Hyperspectral Imaging with Chemometrics
Previous Article in Journal
Antioxidant and Anticancer Activities of Essential Oil from Gannan Navel Orange Peel
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Molecules
Volume 22
Issue 8
10.3390/molecules22081387
molecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii

by
Beibei Xiang
1,*,
Xiaoxue Li
2,
Yan Wang
1,
Xiaoxuan Tian
3,
Zhen Yang
1,
Lin Ma
1,
Xia Liu
4,* and
Yong Wang
2,*
1
School of Chinese Materia Medica, Tianjin University of Traditional Chinese Medicine, Anshan road 312, Tianjin 300193, China
2
College of Life Science, Nankai University, Weijin road 94, 300071 Tianjin, China
3
Tianjin State Key Laboratory of Modern Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Anshan road 312, Tianjin 300193, China
4
Key Laboratory of Food Nutrition and Safety, Tianjin University of Science and Technology, Ministry of Education, No. 29, 13th Street, TEDA 300457, Tianjin, China
*
Authors to whom correspondence should be addressed.
Molecules 2017, 22(8), 1387; https://doi.org/10.3390/molecules22081387
Submission received: 11 July 2017 / Revised: 12 August 2017 / Accepted: 15 August 2017 / Published: 22 August 2017
Browse Figures
Versions Notes

Abstract

:
Swertia mussotii is an important medicinal plant found on the Qinghai Tibetan Plateau that has great economic and medicinal value. This plant has enjoyed a long history of use as a curative for hepatitis. The biological activity of secoiridoids, including gentiopicroside and swertiamarin, has been mainly tested for its anti-hepatitis effects. Here, we identify two candidate genes (SmIS1 and SmIS2) that are homologues of iridoid synthase and that are components of the secoiridoid pathway in S. mussotii. Using sequencing and phylogenetic analyses, we confirm that SmIS1 and SmIS2 contain six conserved short-chain dehydrogenases/reductase (SDR) motifs and thus belong to the P5βRs group. The two purified Escherichia coli-expressed proteins reduced 8-oxogeranial to both nepetalactol and iridodials. A comparison of the kinetic parameters of SmIS1 and SmIS2 recombinant proteins revealed that SmIS2 has a lower affinity than SmIS1 for 8-oxogeranial. Transcript levels of the two genes were analysed in three different tissues of S. mussotii using semi-quantitative RT-PCR and RT-qPCR. SmIS1 and SmIS2 expression levels were more abundant in leaves and stems. This investigation adds to our knowledge of P5βRs genes in the secoiridoid synthesis pathway and provides candidate genes for genetically improving S. mussotii by enhancing secondary metabolite production.

1. Introduction

Swertia mussotii Franch belongs to the Gentianaceae family and grows on the Qinghai Tibetan Plateau at an altitude of greater than 3800 m [1,2]. The entire S. mussotii plant is used in Tibetan medicine known as Zang-Yin-Chen in Chinese. Zang-Yin-Chen has been widely used to treat diseases, such as liver disease and blood disease [3]. To date, a diverse array of pharmaceutically active compounds have been isolated from the S. mussotii plant [4], including xanthones and their derivatives, flavonoids, terpenoids, iridoids and secoiridoid glycosides, such as swertiamarin and gentiopicroside.
Gentiopicroside has been assessed to confirm its anti-inflammatory, analgesic, and anti-hepatitis effects [5,6], whereas swertiamarin has been reported to have anti-hepatitis [7], anti-cancer [8], anti-diabetics [9] and anti-arthritic [10] activities. These results undoubtedly demonstrate the importance of S. mussotii as a medicinal plant. Therefore, biological research concerning secondary metabolism in S. mussotii should be strengthened. The biosynthesis of swertiamarin and related compounds in Swertia chirayita has been investigated and some of the enzymes involved in the biosynthetic pathway have been reported [11].
At present, only one gene involved in swertiamarin biosynthesis has been characterized in S. mussotii [2]. To characterize other genes involved in this biosynthetic pathway in this important medicinal plant, we obtained the transcriptome in leaves of S. mussotii using RNA-sequencing. Based on the RNA-seq data and sequence similarity comparison with genes of Catharanthus roseus, we proposed assessing the secoiridoid biosynthesis pathway in S. mussotii, in which swertiamarin and gentiopicroside are processed via a classical MVA/MEP route of terpene biosynthesis followed by the secoiridoid pathway (Figure 1) [12]. Iridoid biosynthesis is initiated from geranyl diphosphate (GPP), a condensation product of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Secoiridoids are derived from iridoids via the opening of a cyclopentane ring. In this study, we were particularly interested in characterization of the gene(s) encoding iridoid synthase (IS) because the enzyme catalyses the crucial step in the biosynthesis of iridoids [13]. IS belongs to the plant progesterone 5β-reductase (P5βR) family and uses the linear monoterpene 8-oxogeranial as substrate, probably couples an initial NAD(P)H-dependent reduction step with a subsequent cyclization step via a Michael reaction [14]. Recently, it was reported that iridoid synthase activity is common among the plant progesterone 5β-reductases and two (CrIS and CrP5βR4) of six C. roseus P5βR genes may participate in secoiridoid biosynthesis [15]. In our RNA-seq data, only three P5βR gene homologs were recognized. We cloned the full-length cDNA of two genes, SmIS1 and SmIS2. After hetero expression in E. coli, we compared the structure by homology modelling and catalytic properties. We also compared the expression of these two genes in different organs.

2. Results

2.1. Cloning, Sequencing and Phylogenetic Analysis of SmIS1 and SmIS2 cDNAs

The SmIS1 and SmIS2 gene sequences were retrieved from whole transcriptome data for S. mussotii using a BLAST similarity search program (http://www.ncbi.nlm.nih.gov/BLAST). The cDNA was cloned and its sequence was analysed using total RNA isolated from young leaves of the S. mussotii plant. The cDNA was used as a template for PCR, which was performed using primers designed for conserved regions in the 5′ and 3′ ends of the open reading frame (ORF). The sequences were submitted to GenBank and assigned accession numbers MF044036 (SmIS1) and MF044037 (SmIS2). The putative SmIS1 cDNA contained an ORF of 1173 bp that encoded a protein with 390 amino acid residues, and the putative SmIS2 cDNA contained an ORF of 1170 bp that encoded a protein with 389 amino acid residues. The calculated molecular mass and estimated pI of SmIS1 were 44.2 kDa and 6.08, respectively. The calculated molecular mass and estimated pI of SmIS2 were 43.9 kDa and 5.60, respectively.
To calculate the amino acid sequence identity of the two proteins and other orthologues, multiple alignments were performed. SmIS1 and SmIS2 sequences were highly similar to those of CrIS and OeIS. SmIS1 shared 76.47% and 70.05% identity with CrIS and OeIS, respectively. SmIS2 shared 58.26% and 58.29% identity with CrIS and OeIS, respectively.
The sequence analysis confirmed that SmIS1 and SmIS2 contained six conserved short-chain dehydrogenase/reductase (SDR) motifs and that these proteins therefore belong to the P5βRs group [16], which also includes CrIS and OeIS. Tyr180 (178) and Lys178 (146) were observed in the conserved motifs of SmIS1 and SmIS2, respectively. These residues may control the enzymatic activity and substrate specificity of the proteins (Figure 2). The 3D structures of the proteins were modelled based on plant P5βRs crystal structures that were available in the Protein Database (http://www.rcsb.org/pdb/home/home.do). Analyses of their entire lengths revealed that SmIS1 and SmIS2 were 57–78% identical to D. lanata 2V6G and C. roseus 5COB, which have solved protein structures. Using C. roseus CrIS (PDB: 5COB) as a template for homology modelling, we generated 3D models of SmIS1 and SmIS2 (Figure 3). The SmIS1 model was 36.15% a-helices, 10.26% β-strands, and 53.59% loop structures. The SmIS2 model was 35.99% a-helices, 11.31% β-strands, and 52.70% loop structures. Furthermore, the GMQE scores of the modelled SmIS1 and SmIS2 were 0.89 and 0.80, respectively, and their QMEAN Z-Scores were −1.29 and −1.88, respectively. These data confirm that the structural models are robust and potentially useful for generating hypotheses about their substrates.
We performed a phylogenetic analysis using the amino acid sequences of SmIS1 and SmIS2 and their homologues in other plants (Figure 4). All of the compared species belonged to the P5βRs group. SmIS2 belonged to one subclade that clustered with C. roseus P5bR4 (AIW09146.1), O. europaea 1,4-R1.1B (ALV83440.1), O. europaea 1,4-R1.2B (ALV83442.1), O. europaea 1,4-R1.2A (ALV83441.1), and O. europaea 1,4-R1.1A (ALV83439.1). However, SmIS1 belonged to another subgroup that clustered with C. acuminata CaIS (AON76722.1), L. japonica LjIS (AMB61018.1), C. roseus CrIS (AFW98981.1), O. europaea OeIS (ALV83438.1), D. purpurea P5bR2 (ACZ66261.1), and D. lanata P5bR2 (ADL28122.1). This result is similar to that reported by Alagna et al. [17], who suggested that iridoid synthases potentially originated from an ancestor exclusively common to Asterids.

2.2. Functional Characterization and Substrate Preferences of Recombinant SmIS1 and SmIS2

The full-length ORF of SmIS1 cDNA was subcloned into pETMALc-H. This vector was used to express a fusion protein with a maltose-binding protein at the N-terminus. The full-length ORF of SmIS2 cDNA was subcloned into pET-28a to produce a fusion protein with 6-His tags at both the N-terminus and C-terminus. Regarding SmIS1 heteroexpression, we also subcloned the SmIS1 ORF cDNA into the pET-28a vector to produce a fusion protein with His tags, which is a smaller tag. However, the SmIS1 recombinant protein always accumulated in inclusion bodies. Recombinant enzymes were produced in sufficient amounts to allow further characterization of SmIS1 and SmIS2. Affinity purification of both recombinant proteins resulted in single bands of the expected sizes that were visible on Coomassie-stained SDS-PAGE gels. A ~88 kDa protein band was observed in the SmIS1 lane (including 10 histidines and a MBP protein), and a ~46 kDa protein was observed in the SmIS2 lane (including two 6 histidines) (Figure 5). These findings indicated that SmIS1 and SmIS2 were successfully expressed in E. coli cells.
To determine whether recombinant SmIS1 and SmIS2 were both catalytically active, as we predicted, an in vitro assay to determine their enzyme activities and to detect their products was performed. We used 8-oxogeranial as a substrate for the enzyme assays in GC-MS. The enzymes were incubated with substrates in the presence of NADPH. Based on their mass, elemental composition, and fragmentation pattern and the enzyme activity of other known IS [13,15], the products were characterized as nepetalactol and iridodials (Figure 6: peak 3, peak 4 and peak 5). The substrate was a mixture of 8-oxoneral (peak 1) and 8-oxogeranial (peak 2). SmIS1 and SmIS2 turned over both substrates well (Figure 6) [13].
The steady-state kinetic constants of the reactions were determined using spectrophotometric NADPH consumption assays (Table 1, Figure S1). The Km of SmIS1 for 8-oxogeranial was similar to the Km values previously reported for CrIS and OeIS, which are in the 1 μM range. However, the catalytic efficiency of SmIS1 was reduced compared with that of CrIS and OeIS. Compared with SmIS1, SmIS2 had lower affinity for 8-oxogeranial but higher affinity for NADPH.

2.3. Tissue Profile of SmIS1 and SmIS2 Accumulation

The expression patterns of SmIS1 and SmIS2 were analysed in several S. mussotii tissues using semi-quantitative RT-PCR and RT-qPCR (Figure 7). The RNA transcripts of SmIS1 and SmIS2 were present in all of the organs that were tested and were more abundant in leaves and stems.

2.4. Prediction of Subcellular Localization of SmIS1 and SmIS2

We predicted the subcellular localization of SmIS1 and SmIS2 using WOLF PSORT, Predotar and ProtComp. We compared the prediction results in Table 2. WOLF PSORT predicted that SmIS1 was possibly localized to the endoplasmic reticulum or chloroplast. However, the corresponding scores were not high, and the Predotar and ProtComp predictions were inconsistent with the WOLF PSORT prediction results. The two programs predicted that SmIS1 was possibly localized to the cytoplasm. WOLF PSORT and ProtComp predicted that SmIS2 was possibly localized to the cytoplasm.

3. Discussion

S. mussotii plants grow mainly on the Qinghai Tibetan Plateau at altitudes greater than 3800 m, and their seeds germinate poorly when planted at low elevations [1]. Given that the entire plant is used in Tibetan medicine, overexploitation of this plant has resulted in limited wild resources [1]. Therefore, seeking other resources, e.g., growing the plant in other areas and/or developing organ or tissue culture systems, could represent a good strategy to address the gradual shortage in the S. mussotii plant supply. However, secondary metabolic pathways often change, and the reactive compounds in the cells or tissues of these systems accumulate much less compared to naturally growing plants. To regulate the production and accumulation of reactive compounds in the plant tissues, we should elucidate the related metabolic pathways, characterize genes involved in the metabolism and reveal their expression regulations.
Similar secondary metabolism pathways have been demonstrated in different plants, especially for the early biosynthetic steps. C. roseus has been used to characterize the secoiridoid biosynthesis pathway, and the gene encoding a key reaction step from 8-oxogeranial to iridoids, namely iridoid synthase (IS), has been recently identified [13]. IS genes belong to the P5βR gene family, and almost all P5βR proteins can reduce several substrates, such as progesterone, 8-oxogeranial and 2-cyclohexen-1-one, using NADPH as a co-substrate [15]. The homologous genes have also been studied in other species, underscoring their importance in secoiridoid biosynthesis [17,18].
In this study, based on the results of sequence and transcriptomic data mining in S. mussotii, we proposed the secoiridoid biosynthesis pathway (Figure 1). We also recognized three P5βR gene homologs and characterized two of these genes (SmIS1 and SmIS2). For the third homolog, we only obtained a partial mRNA sequence of 1008 nt, which exhibits 60.42% similarity to the corresponding portion of SmIS1 and SmIS2. As the 5’ end sequence is missing, we will clone it using 5′ RACE in the future.
Sequence and phylogenetic analyses demonstrated that the two SmIS genes belonged to the P5βRs group, the members of which convert progesterone to 5β-pregnane-3,20-dione in cardenolide-producing plants. This finding is in accordance with the statement that all IS proteins studied to date in cardenolide-free plants exhibit high sequence similarity with P5βRs [17].
The 3D model demonstrated strong conservation of the secondary structural elements between the modelled SmIS1 and SmIS2 proteins and CrIS and that the entire structure of IS is composed of a typical dinucleotide binding “Rossmann” fold (a characteristic feature of the SDR superfamily) [19,20] covered by a helical C-terminal extension (Figure 3). These results suggest that ISs are orthologues that are derived from a common ancestor in the P5βR family, which is similar to the findings reported in olive [17]. Further IS sequence phylogenetic analysis may elucidate how ISs have evolutionarily diverged from other P5βRs.
Both SmIS1 and SmIS2 catalyse the conversion of 8-oxogeranial, which demonstrates a redundancy of genes encoding IS enzyme activity in S. mussotii. IS gene redundancy in C. roseus has also been reported [15]. However, our enzyme assay analysis revealed that SmIS2 has approximately 8-fold reduced affinity than SmIS1 for 8-oxogeranial. In addition, phylogenetic analysis revealed that SmIS1 and SmIS2 were clustered in two groups. SmIS1 was clustered with ISs, whereas SmIS2 was clustered with P5βRs. These results suggested that SmIS2 could potentially be called SmP5βR1 and not be significantly involved in 8-oxogeranial conversion. Nevertheless, further experimental data are needed to elucidate its function in S. mussotii cell metabolism. The catalytic efficiency of SmIS1 was reduced compared with CrIS and OeIS. It is possible that the maltose-binding protein fusion observed in SmIS1 affected the conformation of SmIS1.
qRT-PCR results revealed that these two genes were co-expressed in three different S. mussotii tissues. The highest gene expression was noted in leaves. In a previous study, we also found that the transcript abundance of the GPPS gene was highest in leaves [21]. Although secoiridoids accumulate in all of the organs of the S. mussotii plant, the highest level was found in its flower [22]. This finding suggests the involvement of a transport mechanism wherein the metabolites are synthesized outside the storage tissue and later transported to floral tissue [23,24].
CrIS forms dimers or higher-order structures with exclusive cytosolic localization as assessed using fluorescent protein fusions and bimolecular fluorescence complementation assays [13]. In S. mussotii, based on prediction programs, both SmIS1 and SmIS2 are likely to be cytosolic (Table 2). Whether SmISs could also form homo or hetero dimers in S. mussotii requires future investigations.

4. Materials and Methods

4.1. Plant Materials

S. mussotii seeds were obtained from Yushu County in Qinghai Province. S. mussotii plants were grown locally in a greenhouse at NanKai University in Tianjin, China. The greenhouse was maintained at 25 °C with a 16-h photoperiod. Various organs, including leaves, stems and flowers, were collected from one-year-old S. mussotii plants.

4.2. Cloning and Sequencing of S. mussotii SmIS1 and SmIS2 Genes

Total RNA was isolated from the leaves of S. mussotii plants using an Eastep Super Total RNA Extraction Kit (Promega, Shanghai, China) according to the manufacturer’s instructions and then eluted in RNase-free water. The quality, purity and concentration of the RNA was estimated spectrophotometrically using A260 and A280 measurements (NanoDrop, Thermo Scientific, Wilmington, MA, USA) followed by visualization on ethidium bromide-stained agarose gels. Quality was then assessed using agarose gel electrophoresis (Liuyi, Beijing, China). Transcriptome sequencing was performed by Novogene Bioinformatics Technology (Beijing, China) and the methods for data processing, assembly and annotation were described in [25]. The transcriptome analysis of S. mussotii will be published separately.
Based on the whole transcriptome data of leaves in S. mussotii before the flowering period, which were obtained using the BLAST similarity search program (http://www.ncbi.nlm.nih.gov/BLAST), the entire coding sequences of SmIS1 and SmIS2 were amplified using the primer pairs as shown in Table 3. cDNA synthesis was performed using PrimeScript™ RT Master Mix (Dalian TaKaRa, Dalian, China) and oligo dT primers. For PCR, we used cDNA as the template with TransStart FastPfu Fly DNA Polymerase (TransGen Biotech, Beijing, China). Thermal cycling was performed using the following program: one cycle of initial denaturation for 5 min at 94 °C, 30 cycles consisting 30 s at 94 °C, 30 s at 60 °C, and 90 s at 72 °C, and a final step for 10 min at 72 °C. The obtained PCR products were subcloned into the pEASY-Blunt Simple vector (TransGen Biotech, Beijing, China). The fragments were sequenced at the Beijing Genomics Institute (BGI), Shenzhen, China.

4.3. Sequence Alignment, Phylogenetic Analysis and Homology Modelling

A multiple sequence alignment of the amino acid sequences of the ISs was performed using DNAMAN software (version 7.0.2, Lynnon Corp., Pointe-Claire, QC, Canada) (www. lynnon.com). Phylogenetic analyses were performed using Molecular Evolutionary Genetics Analysis, version 7.0 (Biodesign Institute, Tempe, AZ, USA, http://www.megasoftware.net) [26] with the Neighbour-Joining method [27]. The robustness of the trees was tested by running 1000 bootstrap replications. Evolutionary distances were computed using the Jones-Taylor-Thornton model [28], and all positions that contained gaps and missing data were eliminated from the data set. Three-dimensional models of SmIS1 and SmIS2 were generated using the Swiss-model server (swissmodel.expasy.org) [29]. C. roseus CrIS (PDB: 5COB) was used as the template.

4.4. Heterologous Expression

The full-length ORF of SmIS1 cDNA was subcloned into the BamH I-Hind III sites of pETMALc-H (New England Biolabs, Ipswich, MA, USA). The resulting plasmid was used to express a fusion protein in which a maltose-binding protein was placed at the N-terminus. The full-length ORF of the SmIS2 cDNA was subcloned into the Nde I-Xho I sites of pET-28a (Novagen, Madison, WI, USA) to produce a fusion protein with 6-His tags at both the N-terminus and C-terminus. The constructed plasmids and the empty vector (used as a control) were transformed into E. coli BL21 (DE3) cells (Novagen, Madison, WI, USA). Correct in-frame insertion was verified using sequencing. A preculture (5 mL) was grown overnight at 37 °C in LB medium. This culture was used to inoculate 500 mL of fresh medium to a density with an OD600 of 0.4 at 25 °C. The cells were then grown for 12 h at 16 °C. Then, 0.3 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added to induce protein expression. The cells were harvested using centrifugation and disrupted using sonication. The soluble maltose-binding protein-tagged SmIS1 protein was then purified to apparent homogeneity as previously described by Gavidia et al. [30].
The SmIS2 protein was purified from the resulting soluble fraction using the His Trap FF (GE Healthcare, Hammersmith, UK). The concentration of the purified protein was quantified using the Bradford method, and the proteins were visualized using SDS–PAGE (Liuyi, Beijing, China).

4.5. GC-MS-Based Assays

The enzyme assays were performed essentially as previously described [13] using 20 mM MOPS (pH = 7.0) as a buffer. The protein concentration was set to 0.05 mg/mL. The substrate concentration was 0.03 mM. The NADPH concentration was 0.4 mM, and the final assay volume was 1 mL. The reaction was terminated after 1 h by adding 1 mL of dichloromethane at 25 °C. The reaction products were extracted, and the organic phase was evaporated at 25 °C. For the GC-MS analysis (Agilent, Palo Alto, CA, USA), the samples were dissolved in 100 μL of dichloromethane. 8-Oxogeranial was purchased from Toronto Research Chemicals (TRC) (Toronto Research Chemicals, Toronto, ON, Canada).
GC-MS analysis was performed in an Agilent 7890 A System coupled to an Agilent 5975 C MS detector (Agilent, Palo Alto, CA, USA). A J & W GC column (30 m × 0.25 mm × 0.25 μm) and helium gas (1.2 mL/min) were used. The program started at 60 °C, and the temperature was increased 5 °C/min to 150 °C, 20 °C/min to 240 °C, 20 °C/min to 290 °C and then maintained for 5 min at 290 °C.

4.6. Enzyme Kinetics of SmIS1 and SmIS2

SmIS1 and SmIS2 enzymatic activity was examined in 20 mM MOPS buffer (PH 7.0). Monoterpene substrates were stored as 50 mM stocks in tetrahydrofuran (THF) at −20 °C. Reductase activity was measured using a microplate reader (PerkinElmer, Waltham, USA). The conversion of NADPH to NADP+ was monitored at 340 nm over a time course of 5 min at 40 °C. The following reaction system was used: varying amounts of NADPH (0–100 mM) and substrate (0–70 mM). SmIS1 and SmIS2 proteins concentrations were set as 0.014 mg/mL and 0.02 mg/mL, respectively, in a final assay volume of 250 μL. Km and Vmax were calculated using the Michaelis-Menten equation with a non-linear regression. The Kcat value was calculated by dividing Vmax. by Et (the number of enzymes in each assay).

4.7. Transcript Analysis

RNA was isolated from different S. mussotii tissues using an Eastep Super Total RNA Extraction Kit (Promega, shanghai, China). After reverse transcription was performed, the cDNAs for Actin (used as a control), SmIS1 and SmIS2 were amplified using RT-PCR with specific primers (Table 3) [Note: The same specific primers were used in both the RT-PCR and real-time quantitative PCR (RT-qPCR) analyses]. The following program was used: 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min, and a final incubation cycle at 72 °C for 10 min. The RT-PCR products were electrophoresed on 1 % agarose gels and visualized under UV light using ethidium bromide. RT-qPCR was performed on an iCycler Thermal Cycler (Bio-Rad iQ5, Hercules, CA, USA) using SYBR Premix Ex Taq II (Dalian Takara, Dalian, China) according to the standard manufacturer’s protocol. The reaction mixture was heated to 95 °C for 30 s followed by 40 PCR cycles at 95 °C for 5 s, 58 °C for 30 s and 72 °C for 30 s. All primer pair efficiencies were between 95% and 105%, and the individual efficiency values were considered in the calculation of normalized relative expression. The difference in the relative expression levels of SmIS1 (or SmIS2) were calculated using the 2−ΔΔCT method after the data were normalized to actin. All values are shown as the mean ± standard error of the mean using at least three biological replicates.

4.8. Subcellular Localization Prediction

We predicted the subcellular localization of SmIS1 and SmIS2 using WOLF-PSORT tool (http://www.genscript.com/wolf-psort.html), Predotar (http://urgi.versailles.inra.fr), and ProtComp (http://www.softberry.com/) [31,32,33].

5. Conclusions

In conclusion, iridoid synthases (SmIS1 and SmIS2) were isolated from S. mussotii and then heterologously expressed and biochemically characterized for the first time. These two proteins contained the same specific motifs and conserved active amino acids that have been reported in other P5βRs obtained from cardenolide plants or cardenolide-free plants. The two purified E. coli-expressed proteins reduced 8-oxogeranial to both nepetalactol and iridodials. This result confirmed the notion that ‘IS activity’ is indeed an intrinsic capacity of angiosperm P5βR proteins. In the future, we will analyse the functions of the two genes in the secoiridoid synthetic pathway of S. mussotii using gene silencing. In addition, we will identify more candidate genes in the secoiridoid synthesis pathway using transcriptome data analysis. The current investigation has added to our knowledge base of P5βRs genes in the secoiridoid synthesis pathway and provided candidate genes for genetically improving S. mussotii by enhancing its secondary metabolite production.

Supplementary Materials

Supplementary materials are available online.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China (No. 81303303) and the Tianjin City High School Science & Technology Fund Planning Project (No. 20130203).

Author Contributions

Y.W. and X.L. (Xia Liu) conceived and designed the experiments; X.T. and X.L. (Xiaoxue Li) performed the experiments; B.X. and L.M. analysed the data; Y.W. and Z.Y. contributed reagents/materials/analysis tools; B.X. wrote the paper. All authors read and approved the final manuscript.

Conflicts of Interest

There is no conflict of interest.

References

  1. Xiang, B.; Li, X.; Qian, J.; Wang, L.; Ma, L.; Tian, X.; Wang, Y. The complete chloroplast genome sequence of the medicinal plant Swertia mussotii using the PacBio RS II platform. Molecules 2016, 21. [Google Scholar] [CrossRef] [PubMed]
  2. Wang, J.; Liu, Y.; Cai, Y.; Zhang, F.; Xia, G.; Xiang, F. Cloning and functional analysis of geraniol 10-Hydroxylase, a cytochrome P450 from Franch. Biosci. Biotechnol. Biochem. 2010, 74, 1583–1590. [Google Scholar] [CrossRef] [PubMed]
  3. Jing, L.; Zhang, Y.J.; Chen, Z.; University, Q.N. Research progress on chemical components and pharmacological actions of Swertia mussotil. Sci. Technol. Qinghai Agric. For. 2014, 5, 55–57. [Google Scholar]
  4. Ji, L.; Bao, Y.; Chen, G.; Zhao, M.; Sun, H. Determination of active constituents in fifteen species Swertia of genus by high performance liquid chromatography. Acta Bot. Boreali-Occident. Sin. 2004, 24, 1298–1302. [Google Scholar]
  5. Chang-Liao, W.L.; Chien, C.F.; Lin, L.C.; Tsai, T.H. Isolation of gentiopicroside from Gentianae Radix and its pharmacokinetics on liver ischemia/reperfusion rats. J. Ethnopharmacol. 2012, 141, 668–673. [Google Scholar] [CrossRef] [PubMed]
  6. Liu, S.B.; Ma, L.; Guo, H.J.; Feng, B.; Guo, Y.Y.; Li, X.Q.; Sun, W.J.; Zheng, L.H.; Zhao, M.G. Gentiopicroside attenuates morphine rewarding effect through down regulation of GluN2B receptors in nucleus accumbens. CNS Neurosci. Ther. 2012, 18, 652–658. [Google Scholar] [CrossRef] [PubMed]
  7. Wang, J.; Zhao, C.; Chang, L.; Xia, G.; Xiang, F. Introgression of Swertia mussotii gene into Bupleurum scorzonerifolium via somatic hybridization. BMC Plant Biol. 2011, 11, 71. [Google Scholar] [CrossRef] [PubMed]
  8. Kavimani, S.; Manisenthlkumar, K.T. Effect of methanolic extract of Enicostemma littorale on Dalton’s ascitic lymphoma. J. Ethnopharmacol. 2000, 71, 349–352. [Google Scholar] [CrossRef]
  9. Vaidya, H.; Goyal, R.K.; Cheema, S.K. Anti-diabetic activity of swertiamarin is due to an active metabolite, gentianine, that upregulates PPAR-γ gene expression in 3T3-L1 cells. Phytother. Res. PTR 2013, 27, 624–627. [Google Scholar] [CrossRef] [PubMed]
  10. Saravanan, S.; Islam, V.I.H.; Babu, N.P.; Pandikumar, P.; Thirugnanasambantham, K.; Chellappandian, M.; Raj, C.S.D.; Paulraj, M.G.; Ignacimuthu, S. Swertiamarin attenuates inflammation mediators via modulating NF-κB/I κB and JAK2/STAT3 transcription factors in adjuvant induced arthritis. Eur. J. Pharm. Sci. Off. J. Eur. Fed. Pharm. Sci. 2014, 56, 70–86. [Google Scholar] [CrossRef] [PubMed]
  11. Padhan, J.K.; Kumar, V.; Sood, H.; Singh, T.R.; Chauhan, R.S. Contents of therapeutic metabolites in Swertia chirayita correlate with the expression profiles of multiple genes in corresponding biosynthesis pathways. Phytochemistry 2015, 116, 38–47. [Google Scholar] [CrossRef] [PubMed]
  12. Miettinen, K.; Dong, L.; Navrot, N.; Schneider, T.; Burlat, V.; Pollier, J.; Woittiez, L.; van der Krol, S.; Lugan, R.; Ilc, T.; et al. The seco-iridoid pathway from Catharanthus roseus. Nat. Commun. 2014, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Geuflores, F.; Sherden, N.H.; Courdavault, V.; Burlat, V.; Glenn, W.S.; Wu, C.; Nims, E.; Cui, Y.; O’Connor, S.E. An alternative route to cyclic terpenes by reductive cyclization in iridoid biosynthesis. Nature 2012, 492, 138–142. [Google Scholar] [CrossRef] [PubMed]
  14. Lindner, S.; Geuflores, F.; Bräse, S.; Sherden, N.H.; O’Connor, S.E. Conversion of substrate analogs suggests a Michael cyclization in iridoid biosynthesis. Chem. Biol. 2014, 21, 1452–1456. [Google Scholar]
  15. Munkert, J.; Pollier, J.; Miettinen, K.; van Moerkercke, A.; Payne, R.; Muller-Uri, F.; Burlat, V.; O’Connor, S.E.; Memelink, J.; Kreis, W.; et al. Iridoid synthase activity is common among the plant progesterone 5β-reductase family. Mol. Plant 2015, 8, 136–152. [Google Scholar] [CrossRef] [PubMed]
  16. Thorn, A.; Egerersieber, C.; Jäger, C.M.; Herl, V.; Mülleruri, F.; Kreis, W.; Muller, Y.A. The crystal structure of progesterone 5beta-reductase from Digitalis lanata defines a novel class of short chain dehydrogenases/reductases. J. Bio. Chem. 2008, 283, 17260–17269. [Google Scholar] [CrossRef] [PubMed]
  17. Alagna, F.; Geuflores, F.; Kries, H.; Panara, F.; Baldoni, L.; O’Connor, S.E.; Osbourn, A. Identification and characterization of the iridoid synthase involved in oleuropein biosynthesis in olive (Olea europaea) fruits. J. Biol. Chem. 2016, 291, 5542–5554. [Google Scholar] [CrossRef] [PubMed]
  18. Sadre, R.; Magallaneslundback, M.; Pradhan, S.; Salim, V.; Mesberg, A.; Jones, A.D.; Dellapenna, D. Metabolite diversity in alkaloid biosynthesis: A multi-lane (diastereomer) highway for camptothecin synthesis in Camptotheca acuminata. Plant Cell 2016, 28, 1926–1944. [Google Scholar] [CrossRef] [PubMed]
  19. Rao, S.T.; Rossmann, M.G. Comparison of super-secondary structures in proteins. J. Mol. Biol. 1973, 76, 241–256. [Google Scholar] [CrossRef]
  20. Qin, L.; Yun, Z.; Ding, Z.; Zhang, X.; Sheng, Y.; Zhang, R. Structure of iridoid synthase in complex with NADP + /8-oxogeranial reveals the structural basis of its substrate specificity. J. Struct. Biol. 2016, 194, 224–230. [Google Scholar] [CrossRef] [PubMed]
  21. Xiang, B.; Li, X.; Wang, Y.; Tian, X.; Yang, L.; Ma, L. Cloning and expression of geranyl pyrophosphate synthase gene in Swertia mussotii. Chin. Tradit. Herb. Drugs 2017, 48, 962–970. [Google Scholar]
  22. Ma, Y.; Chen, G.; Ji, W.; Lu, X. RP-HPLC determination of three medicinal bioactive components in different parts of Swertia mussotii Franch. Chin. J. Pharm. Anal. 2005, 25, 1079–1081. [Google Scholar]
  23. Shitan, N.; Morita, M.; Yazaki, K. Identification of a nicotine transporter in leaf vacuoles of Nicotiana tabacum. Plant Signal Behav. 2009, 4, 530–532. [Google Scholar] [CrossRef] [PubMed]
  24. Nour-Eldin, H.H.; Andersen, T.G.; Burow, M.; Madsen, S.R.; Jørgensen, M.E.; Olsen, C.E.; Dreyer, I.; Hedrich, R.; Geiger, D.; Halkier, B.A. NRT/PTR transporters are essential for translocation of glucosinolate defence compounds to seeds. Nature 2012, 488, 531–534. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, Y.; Xu, M.; Luo, Q.; Wang, J.; Li, H. De novo transcriptome analysis of Liriodendron chinense petals and leaves by Illumina sequencing. Gene 2014, 534, 155–162. [Google Scholar] [CrossRef] [PubMed]
  26. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis Version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  27. Saitou, N.N.M.; Nei, M.C. The neighbor-joining method—A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [PubMed]
  28. Jones, D.T.; Taylor, W.R.; Thornton, J.M. The rapid generation of mutation data matrices from protein sequences. Bioinformatics 1992, 8, 275–282. [Google Scholar] [CrossRef]
  29. Arnold, K.; Bordoli, L.; Schwede, T. The SWISS-MODEL workspace: A web-based environment for protein structure homology modelling. Bioinformatics 2006, 22, 195–201. [Google Scholar] [CrossRef] [PubMed]
  30. Gavidia, I.; Tarrío, R.; Rodrígueztrelles, F.; Pérezbermúdez, P.; Seitz, H.U. Plant progesterone 5beta-reductase is not homologous to the animal enzyme. Molecular evolutionary characterization of P5betaR from Digitalis purpurea. Phytochemistry 2007, 68, 853–864. [Google Scholar] [CrossRef] [PubMed]
  31. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adamscollier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, 585–587. [Google Scholar] [CrossRef] [PubMed]
  32. Lan, J.; Guo, D.; Hu, W.; Niu, X. The prediction of a pathogenesis-related secretome of Puccinia helianthithrough high-throughput transcriptome analysis. Bmc. Bioinform. 2017, 18. [Google Scholar] [CrossRef]
  33. Lee, S.S.; Park, H.J.; Jung, W.Y.; Lee, A.; Yoon, D.H.; You, Y.N.; Kim, H.S.; Kim, B.G.; Ahn, J.C.; Cho, H.S. OsCYP21-4, a novel Golgi-resident cyclophilin, increases oxidative stress tolerance in rice. Front. Plant Sci. 2015, 6. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the Swertia mussotii are available from the authors.
Molecules 22 01387 g001 550
Figure 1. Schematic representation of the proposed in secoiridoid pathway. GPPS, geranyl diphosphate synthase; GES, geraniol synthase; G8H, geraniol 8-hydroxylase; 8-HGO, 8-hydroxygeraniol oxidoreductase; IS, iridoid synthase; IO, iridoid oxidase; 7-DLGT, 7-deoxyloganetic acid glucosyltransferase; 7-DLH, 7-deoxyloganic acid hydroxylase; LAMT, loganic acid O-methyltransferase; SLS, secologanin synthase. Genes in bold letters were previously cloned in S. mussotii; the gene in red was identified in this study.
Figure 1. Schematic representation of the proposed in secoiridoid pathway. GPPS, geranyl diphosphate synthase; GES, geraniol synthase; G8H, geraniol 8-hydroxylase; 8-HGO, 8-hydroxygeraniol oxidoreductase; IS, iridoid synthase; IO, iridoid oxidase; 7-DLGT, 7-deoxyloganetic acid glucosyltransferase; 7-DLH, 7-deoxyloganic acid hydroxylase; LAMT, loganic acid O-methyltransferase; SLS, secologanin synthase. Genes in bold letters were previously cloned in S. mussotii; the gene in red was identified in this study.
Molecules 22 01387 g001
Molecules 22 01387 g002 550
Figure 2. Amino acid sequence comparison of SmIS1 and Smis2 with other ISs. CrIS (C. roseus, GenBank: AFW98981.1); OeIS (O. europaea, GenBank: ALV83438.1). The conserved motifs of the P5βRs are indicated with bars. The highly conserved residues are highlighted in black, whereas similar residues are highlighted in grey.
Figure 2. Amino acid sequence comparison of SmIS1 and Smis2 with other ISs. CrIS (C. roseus, GenBank: AFW98981.1); OeIS (O. europaea, GenBank: ALV83438.1). The conserved motifs of the P5βRs are indicated with bars. The highly conserved residues are highlighted in black, whereas similar residues are highlighted in grey.
Molecules 22 01387 g002
Molecules 22 01387 g003 550
Figure 3. Predicted three-dimensional homology structure of SmIS1 (A) and SmIS2 (B) using recombinant CrIS from C. roseus (5COB) as a template. Helices and sheets are represented in red and blue, respectively.
Figure 3. Predicted three-dimensional homology structure of SmIS1 (A) and SmIS2 (B) using recombinant CrIS from C. roseus (5COB) as a template. Helices and sheets are represented in red and blue, respectively.
Molecules 22 01387 g003
Molecules 22 01387 g004 550
Figure 4. Phylogenetic tree of SmIS1 and SmIS2 together with 34 known P5βRs. The phylogenetic tree was drawn using P. patens (GenBank: EDQ81106.1) as an outgroup and the following amino acid sequences with accession IDs noted in brackets: C. roseus P5bR1 (AIW09143.1); C. roseus P5bR3(AIW09145.1); Nerium oleander P5bR-B (ADG56540.1); C. roseus P5bR2 (AIW09144.1); Gomphocarpus fruticosus P5bR (ADG56546.1); Asclepias curassavica P5bR (ADG56538.1); Withania somnifera P5bR (AEY82379.1); Nicotiana tabacum P5bR (BAH47641.1); Duboisia hopwoodii P5bR (AFZ41795.1); Genlisea aurea P5bR (EPS65468.1); Mentha x piperita P5bR (ADG46022.1); Digitalis lanata P5bR1(AAS93804.1); Digitalis purpurea P5bR1(AAS93805.1); Vitis vinifera P5bR (ALB78111.1); Thlaspi densiflorum P5bR (ALD83449.1); Arabidopsis thaliana At4g24220 (NP_001078438.1); Medicago truncatula P5bR1 (AIW09149.1); Medicago truncatula P5bR2 (AIW09150.1); Passiflora incarnata P5bR (AFW16644.1); C. roseus P5bR 4 (AIW09146.1); Olea europaea 1,4-R 1.1B (ALV83440.1); Olea europaea 1,4-R 1.1A (ALV83439.1); Olea europaea 1,4-R 1.2B (ALV83442.1); Olea europaea 1,4-R 1.2A (ALV83441.1); Camptotheca acuminata CaIS (AON76722.1); Lonicera japonica LjIS (AMB61018.1); C. roseus CrIS (AFW98981.1); Olea europaea OeIS (ALV83438.1); D. purpurea P5bR2 (ACZ66261.1); D. lanata P5bR2 (ADL28122.1); C. roseus P5bR6 (AIW09148.1); Medicago truncatula P5bR3 (AIW09151.1); Medicago truncatula P5bR3 (AIW09152.1).
Figure 4. Phylogenetic tree of SmIS1 and SmIS2 together with 34 known P5βRs. The phylogenetic tree was drawn using P. patens (GenBank: EDQ81106.1) as an outgroup and the following amino acid sequences with accession IDs noted in brackets: C. roseus P5bR1 (AIW09143.1); C. roseus P5bR3(AIW09145.1); Nerium oleander P5bR-B (ADG56540.1); C. roseus P5bR2 (AIW09144.1); Gomphocarpus fruticosus P5bR (ADG56546.1); Asclepias curassavica P5bR (ADG56538.1); Withania somnifera P5bR (AEY82379.1); Nicotiana tabacum P5bR (BAH47641.1); Duboisia hopwoodii P5bR (AFZ41795.1); Genlisea aurea P5bR (EPS65468.1); Mentha x piperita P5bR (ADG46022.1); Digitalis lanata P5bR1(AAS93804.1); Digitalis purpurea P5bR1(AAS93805.1); Vitis vinifera P5bR (ALB78111.1); Thlaspi densiflorum P5bR (ALD83449.1); Arabidopsis thaliana At4g24220 (NP_001078438.1); Medicago truncatula P5bR1 (AIW09149.1); Medicago truncatula P5bR2 (AIW09150.1); Passiflora incarnata P5bR (AFW16644.1); C. roseus P5bR 4 (AIW09146.1); Olea europaea 1,4-R 1.1B (ALV83440.1); Olea europaea 1,4-R 1.1A (ALV83439.1); Olea europaea 1,4-R 1.2B (ALV83442.1); Olea europaea 1,4-R 1.2A (ALV83441.1); Camptotheca acuminata CaIS (AON76722.1); Lonicera japonica LjIS (AMB61018.1); C. roseus CrIS (AFW98981.1); Olea europaea OeIS (ALV83438.1); D. purpurea P5bR2 (ACZ66261.1); D. lanata P5bR2 (ADL28122.1); C. roseus P5bR6 (AIW09148.1); Medicago truncatula P5bR3 (AIW09151.1); Medicago truncatula P5bR3 (AIW09152.1).
Molecules 22 01387 g004
Molecules 22 01387 g005 550
Figure 5. Heterologous expression of SmIS1 and Smis2 cDNA in E. coli. Lane SmIS1, purified recombinant SmIS1; lane SmIS2, purified recombinant SmIS2.
Figure 5. Heterologous expression of SmIS1 and Smis2 cDNA in E. coli. Lane SmIS1, purified recombinant SmIS1; lane SmIS2, purified recombinant SmIS2.
Molecules 22 01387 g005
Molecules 22 01387 g006 550
Figure 6. Functional characterization of SmIS1 and Smis2. (A) Analysis of the reaction product by GC-MS. Control, the reaction in the presence of denatured SmIS1 or SmIS2 proteins; (B) MS spectra of the substrates (peaks 1 and 2) and products (peaks 3, 4, and 5).
Figure 6. Functional characterization of SmIS1 and Smis2. (A) Analysis of the reaction product by GC-MS. Control, the reaction in the presence of denatured SmIS1 or SmIS2 proteins; (B) MS spectra of the substrates (peaks 1 and 2) and products (peaks 3, 4, and 5).
Molecules 22 01387 g006
Molecules 22 01387 g007 550
Figure 7. Expression pattern of the SmIS1 and SmIS2 genes in planta. (A) Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis in leaf, stems, and flower. Actin gene was used as a loading control; (B) Real-time quantitative PCR (RT-qPCR) analysis in leaf, stems, and flower.
Figure 7. Expression pattern of the SmIS1 and SmIS2 genes in planta. (A) Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis in leaf, stems, and flower. Actin gene was used as a loading control; (B) Real-time quantitative PCR (RT-qPCR) analysis in leaf, stems, and flower.
Molecules 22 01387 g007
Table
Table 1. Compared kinetic parameters of recombinant of SmIS1 and SmIS2.
Table 1. Compared kinetic parameters of recombinant of SmIS1 and SmIS2.
EnzymeSubstrate
8-OxogeranialNADPH
KmKcatKcat/KmKmKcatKcat/Km
(μM)(s−1)(s−1M−1)(μM)(s−1)(s−1M−1)
SmIS17.29 ± 1.590.11 ± 0.00715,559.6 ± 4354.377.94 ± 6.030.135 ± 0.011731.7 ± 11.3
SmIS254.37 ± 4.290.034 ± 0.001628.6 ± 75.941.83 ± 7.20.026 ± 0.01628 ± 104.7
The data represent the mean of three independent measurements ± SD. (n = 3).
Table
Table 2. Prediction of SmIS1 and SmIS2 subcellular localization using website programs.
Table 2. Prediction of SmIS1 and SmIS2 subcellular localization using website programs.
EnzymeSubcellular Localization Prediction Methods
WOLF PSORTPredotarProtComp
SmIS1ER6Mito0.09Cyto8.44
Chlo5Plastid0.01ER0.13
Mito1ER0Chlo0.84
Plastid1Else0.9Vacuolar0.38
SmIS2Cyto9Mito0.01Cyto8.32
Cysk3Plastid0.01ER0.27
Plastid1ER0Chlo0.82
Else0.98Vacuolar0.43
For WoLF PSORT, Predotar and ProtComp predictions, the favourable localizations are reported with corresponding scores. ER, endoplasmic reticulum; Chlo, chloroplast; Mito, mitochondria; Cyto, cytoplasm; Cysk, cytoskeleton.
Table
Table 3. Primers used in this study.
Table 3. Primers used in this study.
Primer usageGeneForward (5′-3′)Reverse (5′-3′)
ORF CloningSmIS1gcggatccATGAGCTGGTGGcccaagcttCTATGGGATAAATTTG
TGGAAAAGAAGTCTCTC
SmIS2 ggaattccatATGAGCTGGTGccctcgagAGGAACAATTTTATGA
GTGGACTGGTGCTTTCATT
RT-PCRSmIS1 AAGCATGAAAAAAAGCCAATATATCCCACCATTTCCAT
CATTAGT
SmIS2 AAGCATGAAAATGTTCCATTCTCGTCGAATTCCACGTA
TTTCAC
Actin ACTGGTGTTATGGTTGGTCGGTGAGAAGTATAGGGTGCGG
TATTGG
qRT-PCRSmIS1 AAGCATGAAAAAAAGCCAATATATCCCACCATTTCCAT
CATTAGT
SmIS2 AAGCATGAAAATGTTCCATTCTCGTCGAATTCCACGTA
TTTCAC
Actin ACTGGTGTTATGGTTGGTCGGTGAGAAGTATAGGGTGC
TATGG
Lower case letters indicate the protective bases and restriction enzymes sites.

Share and Cite

MDPI and ACS Style

Xiang, B.; Li, X.; Wang, Y.; Tian, X.; Yang, Z.; Ma, L.; Liu, X.; Wang, Y. Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii. Molecules 2017, 22, 1387. https://doi.org/10.3390/molecules22081387

AMA Style

Xiang B, Li X, Wang Y, Tian X, Yang Z, Ma L, Liu X, Wang Y. Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii. Molecules. 2017; 22(8):1387. https://doi.org/10.3390/molecules22081387

Chicago/Turabian Style

Xiang, Beibei, Xiaoxue Li, Yan Wang, Xiaoxuan Tian, Zhen Yang, Lin Ma, Xia Liu, and Yong Wang. 2017. "Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii" Molecules 22, no. 8: 1387. https://doi.org/10.3390/molecules22081387

APA Style

Xiang, B., Li, X., Wang, Y., Tian, X., Yang, Z., Ma, L., Liu, X., & Wang, Y. (2017). Cloning and Characterization of Two Iridoid Synthase Homologs from Swertia Mussotii. Molecules, 22(8), 1387. https://doi.org/10.3390/molecules22081387

Article Metrics

Back to TopTop