Detection of Soybean-Derived Components in Dairy Products Using Proofreading Enzyme-Mediated Probe Cleavage Coupled with Ladder-Shape Melting Temperature Isothermal Amplification (Proofman–LMTIA)
Abstract
1. Introduction
2. Results
2.1. LMTIA Primer Design
2.2. Optimization of the Proofman–LMTIA Reaction Temperature
2.3. Specificity of the Proofman–LMTIA Assay
2.4. Sensitivity of the Proofman–LMTIA Assay
2.5. Sample Testing
3. Material and Methods
3.1. Target Sequence Selection and LMTIA Primer Design
3.2. DNA Extraction
3.3. Proofman–LMTIA Reaction
3.4. Proofman–LMTIA Reaction Temperature Optimization
3.5. Specificity Determination of Proofman–LMTIA Assay
3.6. Sensitivity Determination of Proofman–LMTIA Assay
3.7. Actual Sample Testing
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Li, H. Research on inventory management status of Chinese dairy production enterprises. China Manag. Inf. 2021, 24, 42–43. (In Chinese) [Google Scholar]
- Bai, Y.; Li, L.; Wang, F.; Zhang, L.; Xiong, L. Impact of dairy imports on raw milk production technology progress in China. Int. J. Environ. Res. Public Health. 2022, 19, 2911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, R.; Ji, L.; Zhang, S.; Ma, Y. Current situation of China’s dairy trade from the perspective of the whole industrial chain. China Dairy Ind. 2022, 02, 2–7. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, X.; Qiao, C.; Fu, S.; Jiao, Y.; Liu, Y. DNA-based qualitative and quantitative identification of bovine whey powder in goat dairy products. J. Dairy Sci. 2022, 105, 4749. [Google Scholar] [CrossRef] [Scilit]
- Mafra, I.; Honrado, M.; Amaral, J.S. Animal species authentication in dairy products. Foods. 2022, 11, 1124. [Google Scholar] [CrossRef] [Scilit]
- Giglioti, R.; Polli, H.; Azevedo, B.T.; Katiki, L.M.; Filho, A.E.V. Detection and quantification of adulteration in milk and dairy products: A novel and sensitive qPCR-based method. Food Chem. Mol. Sci. 2022, 4, 100074. [Google Scholar] [CrossRef] [Scilit]
- Sidra-tul-Muntaha; Iqbal, R.; Yasmin, I.; Tehseen, S.; Khaliq, A.; Chughtai, M.F.J.; Ahsan, S.; Khan, W.A.; Nadeem, M.; Hleba, L.; et al. Safety Assessment of milk and indigenous milk products from different areas of Faisalabad. J. Microbiol. Biotechnol. Food Sci. 2020, 9, 1197–1203. [Google Scholar] [CrossRef] [Scilit]
- Shari, R.V.; Aimei, Y. Media manipulation in the Sanlu milk contamination crisis. Public Relat. Rev. 2012, 38, 935–937. [Google Scholar] [CrossRef] [Scilit]
- Sun, W. Method for Separation and Identification of Bovine Milk Protein and Soy Protein. Master’s Thesis, Shaanxi University of Science and Technology, Xi’an, China, 2015. (In Chinese) [Google Scholar]
- Ji, Y.; Du, B.; Zhi, X.J. Rapid identification of milk brands and adulteration identification by NIR technology. Food Res. Dev. 2016, 37, 178–181. (In Chinese) [Google Scholar]
- Guo, Z.; Guo, C.; Sun, L.; Zuo, M.; Chen, Q.; EI-Seedi, H.R.; Zou, X. Identification of the apple spoilage causative fungi and prediction of the spoilage degree using electronic nose. J. Food Process Eng. 2021, 44, 8–16. [Google Scholar] [CrossRef] [Scilit]
- Xue, H.; Hu, W.; Song, H.; Han, Y.; Yang, Z.Y. Quantitative detection of bovine milk in goat milk by indirect ELISA. Food Sci. 2010, 31, 370–373. (In Chinese) [Google Scholar]
- Abedini, R.; Jahed Khaniki, G.; Molaee Aghaee, E.; Sadighara, P.; Nazmara, S.; Akbari-Adergani, B.; Naderi, M. Determination of melamine contamination in chocolates containing powdered milk by high-performance liquid chromatography (HPLC). J. Environ. Health Sci. Eng. 2021, 19, 165–171. [Google Scholar] [CrossRef] [Scilit]
- Baptista, M.; Cunha, J.T.; Domingues, L. DNA-based approaches for dairy products authentication: A review and perspectives. Trends Food Sci. Technol. 2021, 109, 386–397. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Meng, Z.; Qiu, K.; Dong, S.; Wu, Z.; Guo, X.; Zhong, Q. Species-specific PCR method to identify animal-derived ingredients of pork, beef, mutton, chicken and duck in canned food. Food Ferment. Ind. 2021, 47, 164–169. (In Chinese) [Google Scholar] [CrossRef]
- Chen, Y.; Zhang, J.; Ge, Y. A bibliometric analysis on technology innovation of food authentication. J. Food Saf. Qual. 2019, 10, 8183–8194. (In Chinese) [Google Scholar] [CrossRef]
- Bi, S.; Yue, S.; Zhang, S. Hybridization chain reaction: A versatile molecular tool for biosensing, bioimaging, and biomedicine. Chem. Soc. Rev. 2017, 46, 4281. [Google Scholar] [CrossRef] [Scilit]
- Saiki, R.K.; Scharf, S.; Faloona, F.; Mullis, K.B.; Horn, G.T.; Erlich, H.A.; Arnheim, N. Enzymatic amplification of β-globin genomic sequences and restrictions site analysis for diagnosis of sickle cell anaemia. Science 1985, 230, 1350–1354. [Google Scholar] [CrossRef] [Scilit]
- Saiki, R.K.; Gelfand, D.; Stoffel, S.; Scharf, S.; Higuchi, R.; Horn, G.; Mullis, K.; Erlich, H. Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase. Science 1988, 239, 487–491. [Google Scholar] [CrossRef] [Scilit]
- Barany, F. Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Nat. Acad. Sci. USA 1991, 88, 189–193. [Google Scholar] [CrossRef] [Scilit]
- Compton, J. Nucleic acid sequence-based amplification. Nature 1991, 350, 91–92. [Google Scholar] [CrossRef] [Scilit]
- Fahy, E.; Kwoh, D.Y.; Gingeras, T.R. Self-sustained sequence replication (3SR): An isothermal transcription-based amplification system alternative to PCR. Genome Res. 1991, 1, 25–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vincent, M.; Xu, Y.; Kong, H. Helicase-dependent isothermal DNA amplification. Embo. Rep. 2004, 5, 795–800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reid, M.S.; Le, X.C.; Zhang, H. Exponential isothermal amplification of nucleic acids and assays for proteins, cells, small molecules, and enzyme activities. Angew. Chem. Int. Ed. 2018, 57, 11856–11866. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.Y.; Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nature Chem. 2011, 3, 103–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lutz, S.; Weber, P.; Focke, M.; Faltin, B.; Hoffmann, J.; Müller, C.; Mark, D.; Roth, G.; Munday, P.; Armes, N. Microfluidic lab-on-a-foil for nucleic acid analysis based on isothermal recombinase polymerase amplification (RPA). Lab. Chip. 2010, 10, 887–893. [Google Scholar] [CrossRef] [Scilit]
- Yue, S.; Li, Y.; Qiao, Z.; Song, W.; Bi, S. Rolling circle replication for biosensing, bioimaging and biomedicine. Trends Biotechnol. 2021, 39, 1160–1172. [Google Scholar] [CrossRef] [Scilit]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucl. Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Scilit]
- Bodulev, O.L.; Sakharov, I.Y. Isothermal nucleic acid amplification techniques and their use in bioanalysis. Biochemistry 2020, 85, 147–166. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Brewster, J.; Paul, M.; Tomasula, P. Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification. Molecules 2015, 20, 6048–6059. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Wang, Y.; Wang, A. Study on false-positive amplification of loop-mediated isothermal amplification. J. Xuchang Univ. 2015, 34, 81–83. (In Chinese) [Google Scholar]
- Wang, D.; Wang, Y.; Zhang, M.; Zhang, Y.; Sun, J.; Song, C.; Xiao, F.; Ping, Y.; Pan, C.; Hu, Y.; et al. Ladder-shape melting temperature isothermal amplification of nucleic acids. BioTechniques 2021, 71, 359–369. [Google Scholar] [CrossRef] [Scilit]
- Kong, A.; Ai, X.; Wang, D. Study on the feasibility of LMTIA technology for detecting HPV nucleic acid. J. Xuchang Univ. 2022, 41, 72–75. (In Chinese) [Google Scholar]
- Gu, M.; Xiao, F.; Wang, D.; Ding, C. Research progress of nucleic acid detection technology for meat provenance detection. J. Food Saf. Qual. 2021, 12, 7514–7519. (In Chinese) [Google Scholar] [CrossRef]
- Ma, C.; Jing, H.; Zhang, P.; Han, L.; Zhang, M.; Wang, F.; Niu, S.; Shi, C. Ultrafast and one-step assay for visual detection of RNA virus. Chem. Commun. 2018, 54, 3118–3121. [Google Scholar] [CrossRef] [Scilit]
- Zhu, K.; Kang, H.; Wang, D. Detection of pork components in Common meat products by visual LAMP. Food Sci. 2019, 40, 296–302. (In Chinese) [Google Scholar]
- Zhang, Y.; Wang, Y.; Ouyang, X.; Wang, D.; Xiao, F.; Sun, J. Development of a Ladder-shape melting temperature isothermal amplification (LMTIA) assay for the identification of cassava component in sweet potato starch noodles. Molecules 2022, 27, 3414. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.; Chen, R.; Ding, S.; Li, M.; Wang, J.; Zou, J.; Du, F.; Dong, J.; Cui, X.; Huang, X.; et al. Recombinase assisted loop-mediated isothermal DNA amplification. Analyst 2019, 145, 440–444. [Google Scholar] [CrossRef] [Scilit]
- Ding, S.; Chen, G.; Wei, Y.; Dong, J.; Du, F.; Cui, X.; Huang, X.; Tang, Z. Sequence-specific and multiplex detection of COVID-19 virus (SARS-CoV-2) using proofreading enzyme-mediated probe cleavage coupled with isothermal amplification. Biosens. Bioelectron. 2021, 178, 113041. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wang, B.; Wang, D. Development of a Ladder-shape melting temperature isothermal amplification assay for detection of duck adulteration in beef. J. Food Prot. 2022, 85, 1203–1209. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Shang, J.; Xu, D.; Wang, D. Detection of mutton component by Ladder-shape melting temperature isothermal amplification (LMTIA) Method. J. Xuchang Univ. 2022, 41, 58–61. (In Chinese) [Google Scholar]
- Khatun, M.A.; Hossain, A.; Hossain, M.S.; Munshi, M.K.; Huque, R. Detection of species adulteration in meat products and Mozzarella-type cheeses using duplex PCR of mitochondrial cytb gene: A food safety concern in Bangladesh. Food Chem. Mol. Sci. 2021, 2, 100017. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primer | Sequence (5′–3′) |
|---|---|
| F | CGTGCACGCAAAGGGTTTTTCCACGCTCGAGACCAATCAC |
| B | TGCACGCACGCTCCCTTTTATGCTTAAACTCAGCGGGTAG |
| LF | TCCAGAACTGACCGGCTCGCA |
| LB | ACGAGACCTCAGGTCAGGCG |
| Pr | BHQ 1-ACGAGACCTCAGGTCAGGCG-FAM |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, F.; Gu, M.; Zhang, Y.; Xian, Y.; Zheng, Y.; Zhang, Y.; Sun, J.; Ding, C.; Zhang, G.; Wang, D. Detection of Soybean-Derived Components in Dairy Products Using Proofreading Enzyme-Mediated Probe Cleavage Coupled with Ladder-Shape Melting Temperature Isothermal Amplification (Proofman–LMTIA). Molecules 2023, 28, 1685. https://doi.org/10.3390/molecules28041685
Xiao F, Gu M, Zhang Y, Xian Y, Zheng Y, Zhang Y, Sun J, Ding C, Zhang G, Wang D. Detection of Soybean-Derived Components in Dairy Products Using Proofreading Enzyme-Mediated Probe Cleavage Coupled with Ladder-Shape Melting Temperature Isothermal Amplification (Proofman–LMTIA). Molecules. 2023; 28(4):1685. https://doi.org/10.3390/molecules28041685
Chicago/Turabian StyleXiao, Fugang, Menglin Gu, Yaoxuan Zhang, Yaodong Xian, Yaotian Zheng, Yongqing Zhang, Juntao Sun, Changhe Ding, Guozhi Zhang, and Deguo Wang. 2023. "Detection of Soybean-Derived Components in Dairy Products Using Proofreading Enzyme-Mediated Probe Cleavage Coupled with Ladder-Shape Melting Temperature Isothermal Amplification (Proofman–LMTIA)" Molecules 28, no. 4: 1685. https://doi.org/10.3390/molecules28041685
APA StyleXiao, F., Gu, M., Zhang, Y., Xian, Y., Zheng, Y., Zhang, Y., Sun, J., Ding, C., Zhang, G., & Wang, D. (2023). Detection of Soybean-Derived Components in Dairy Products Using Proofreading Enzyme-Mediated Probe Cleavage Coupled with Ladder-Shape Melting Temperature Isothermal Amplification (Proofman–LMTIA). Molecules, 28(4), 1685. https://doi.org/10.3390/molecules28041685

