The Effects of Genistein at Different Concentrations on MCF-7 Breast Cancer Cells and BJ Dermal Fibroblasts
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Makki, J. Diversity of Breast Carcinoma: Histological Subtypes and Clinical Relevance. Clin. Med. Insights Pathol. 2015, 8, 23–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Health Organization (WHO). Global Health Estimates 2020: Deaths by Cause, Age, Sex, by Country and by Region, 2000–2019. 2020. Available online: https://www.who.int/data/gho/data/themes/mortality-and-global-health-estimates/ghe-leading-causes-of-death (accessed on 16 October 2021).
- Krzemieniecki, K.; Komorowski, K.; Wysocki. Interna Szczeklika. Podręcznik Chorób Wewnętrznych; Medycyna praktyczna: Cracow, Poland, 2013. [Google Scholar]
- Krzakowski, M.; Potemski, P.; Warzocha, K. Onkologia kliniczna tom 2; Via Medica: Gdansk, Poland, 2015. [Google Scholar]
- McDonald, E.; Clark, A.; Tchou, J.; Zhang, P.; Freedman, G. Clinical Diagnosis and Management of Breast Cancer. J. Nucl. Med. Febr. 2016, 57, 9S–16S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gamal, H.; Tawfik, W.; Fahmy, H.M.; El-Sayyad, H.H. Breakthroughs of using Photodynamic Therapy and Gold Nanoparticles in Cancer Treatment. In Proceedings of the 021 IEEE International Conference on Nanoelectronics, Nanophotonics, Nanomaterials, Nanobioscience & Nanotechnology (5NANO), Kottayam, Kerala, India, 29–30 April 2021; pp. 1–4. [Google Scholar] [CrossRef]
- Somogyi, R. Breast reconstruction. Can. Fam. Physician 2018, 64, 424–432. [Google Scholar]
- Gass, J.; Mitchell, S.; Hanna, M. How do breast cancer surgery scars impact survivorship? Findings from a nationwide survey in the United States. BMC Cancer 2019, 19, 342. [Google Scholar] [CrossRef] [PubMed]
- Jabłońska, B.; Brańka, J.; Lampe, P. Od Halsteda do leczenia oszczędzającego, czyli krótka historia chirurgii raka gruczołu piersiowego. Postępy Nauk. Med. 2011, 1, 29–32. [Google Scholar]
- Křížová, L.; Dadáková, K.; Kašparovská, J.; Kašparovský, T. Isoflavoes. Molecules 2019, 24, 1076. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.M.; Huh, J.S.; Lim, Y.; Cho, M. Soy Isoflavone Glycitin (4′-Hydroxy-6-Methoxyisoflavone-7-D-Glucoside) Promotes Human Dermal Fibroblast Cell Proliferation and Migration via TGF-β Signaling. Phytother. Res. 2015, 29, 757–769. [Google Scholar] [CrossRef] [PubMed]
- Czerpak, R.; Pietryczuk, A.; Jabłońska-Trypuć, A.; Obrębska, K. Aktywność biologiczna izoflawonoidów i ich znaczenie terapeutyczne i kosmetyczne. Borgis. Postępy Fitoter. 2009, 2, 113–121. [Google Scholar]
- Irrera, N.; Pizzino, G.; D’Anna, R.; Vaccaro, M.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bittol, A. Dietary Management of Skin Health: The Role of Genistein. Nutrients 2017, 9, 622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chin, G.S.; Liu, W.; Steinbrech, D.; Hsu, M.; Levinson, H.; Longaker, M.T. Cellular signaling by tyrosine phosphorylation in keloid and normal human dermal fibroblasts. Plast. Reconstr. Surg. 2000, 106, 1532–1540. [Google Scholar] [CrossRef]
- Cao, C.; Li, S.; Dai, X.; Chen, Y.; Feng, Z.; Zhao, Y.; Wu, J. Genistein inhibits proliferation and functions of hypertrophic scar fibroblasts. Burns 2009, 35, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Jurzak, M.; Adamczyk, K.; Antończak, P.; Garncarczyk, A.; Kuśmierz, D.; Latocha, M. Evaluation of genistein ability to modulate CTGF mRNA/protein expression, genes expression of TGFβ isoforms and expression of selected genes regulating cell cycle in keloid fibroblasts in vitro. Acta Pol. Pharm. 2014, 71, 972–986. [Google Scholar] [PubMed]
- Jurzak, M.; Adamczyk, K. Influence of genistein on c-Jun, c-Fos and Fos-B of AP-1 subunits expression in skin keratinocytes, fibroblasts and keloid fibroblasts cultured in vitro. Acta Pol. Pharm. 2013, 70, 205–213. [Google Scholar] [PubMed]
- Sienkiewicz, P.; Surazyński, A.; Pałka, J.; Miltyk, W. Nutritional concentration of genistein protects human dermal fibroblasts from oxidative stress-induced collagen biosynthesis inhibition through IGF-I receptor-mediated signaling. Acta Pol. Pharm. 2008, 65, 203–211. [Google Scholar] [PubMed]
- Park, E.; Lee, S.M.; Jung, I.K.; Lim, Y.; Kim, J.H. Effects of genistein on early-stage cutaneous wound healing. Biochem. Biophys. Res. Commun. 2011, 410, 514–519. [Google Scholar] [CrossRef] [PubMed]
- Emmerson, E.; Campbell, L.; Ashcroft, G.S.; Hardman, M.J. The phytoestrogen genistein promotes wound healing by multiple independent mechanisms. Mol. Cell. Endocrinol. 2010, 321, 184–193. [Google Scholar] [CrossRef] [PubMed]
- Marini, H.; Polito, F.; Altavilla, D.; Irrera, N.; Minutoli, L.; Calò, M.; Adamo, E.B.; Vaccaro, M.; Squadrito, F.; Bitto, A. Genistein aglycone improves skin repair in an incisional model of wound healing: A comparison with raloxifene and oestradiol in ovariectomized rats. Br. J. Pharmacol. 2010, 160, 1185–1194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Polito, F.; Marini, H.; Bitto, A.; Irrera, N.; Vaccaro, M.; Adamo, E.B.; Micali, A.; Squadrito, F.; Minutoli, L.; Altavilla, D. Genistein aglycone, a soy-derived isoflavone, improves skin changes induced by ovariectomy in rats. Br. J. Pharmacol. 2012, 165, 994–1005. [Google Scholar] [CrossRef] [Green Version]
- Kloska, A.; Jakóbkiewicz-Banecka, J.; Narajczyk, M.; Banecka-Majkutewicz, Z.; Węgrzyn, G. Effects of flavonoids on glycosaminoglycan synthesis: Implications for substrate reduction therapy in Sanfilippo disease and other mucopolysaccharidoses. Metab. Brain Dis. 2011, 26, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Isoherranen, K.; Punnonen, K.; Jansen, C.; Uotila, P. Ultraviolet irradiation induces cyclooxygenase-2 expression in keratinocytes. Br. J. Dermatol. 1999, 140, 1017–1022. [Google Scholar] [CrossRef]
- Iovine, B.; Iannella, M.L.; Gasparri, F.; Monfrecola, G.; Bevilacqua, M.A. Synergic Effect of Genistein and Daidzein on UVB-Induced DNA Damage: An Effective Photoprotective Combination. J. Biomed. Biotechnol. 2011, 2011, 692846. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.N.; Wu, W.; Chen, H.C.; Fang, H. Genistein protects against UVB-induced senescence-like characteristics in human dermal fibroblast by p66Shc down-regulation. J. Dermatol. Sci. 2010, 58, 19–27. [Google Scholar] [CrossRef]
- Kessel, B. Alternatives to estrogen for menopausal women. Soc. Exp. Biol. Med. 1998, 217, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Izumi, T.; Saito, M.; Obata, A.; Arii, M.; Yamaguchi, H.; Matsuyama, A. Oral intake of soy isoflavone aglycone improves the aged skin of adult women. J. Nutr. Sci. Vitaminol. Tokyo 2007, 53, 57–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva, L.A.; Ferraz Carbonel, A.A.; de Moraes, A.R.B.; Simões, R.S.; Sasso, G.R.D.S.; Goes, L.; Nunes, W.; Simões, M.J.; Patriarca, M.T. Collagen concentration on the facial skin of postmenopausal women after topical treatment with estradiol and genistein: A randomized double-blind controlled trial. Gynecol. Endocrinol. 2017, 33, 845–848. [Google Scholar] [CrossRef]
- Patriarca, M.T.; Barbosa de Moraes, A.R.; Nader, H.B.; Petri, V.; Martins, J.R.; Gomes, R.C.; Soares, J.M., Jr. Hyaluronic acid concentration in postmenopausal facial skin after topical estradiol and genistein treatment: A double-blind, randomized clinical trial of efficacy. Menopause 2013, 20, 336–341. [Google Scholar] [CrossRef] [PubMed]
- Moraes, A.B.; Haidar, M.A.; Soares Júnior, J.M.; Simões, M.J.; Baracat, E.C.; Patriarca, M.T. The effects of topical isoflavones on postmenopausal skin: Double-blind and randomized clinical trial of efficacy. Eur. J. Obstet. Gynecol. Reprod. Biol. 2009, 146, 188–192. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.; Saladi, R.; Lu, Y.; Wang, Y.; Palep, S.R.; Moore, J.; Phelps, R.; Shyong, E.; Lebwohl, M.G. Isoflavone genistein: Photoprotection and clinical implications in dermatology. J. Nutr. 2003, 133 (Suppl. 1), 3811S–3819S. [Google Scholar] [CrossRef] [Green Version]
- Sharifi-Rad, J.; Quispe, C.; Imran, M.; Rauf, A.; Nadeem, M.; Gondal, T.A.; Ahmad, B.; Atif, M.; Mubarak, M.S.; Sytar, O. Genistein: An Integrative Overview of Its Mode of Action, Pharmacological Properties, and Health Benefits. Oxidative Med. Cell. Longev. 2021, 2021, 3268136. [Google Scholar] [CrossRef]
- Kabała-Dzik, A.; Rzepecka-Stojko, A.; Kubina, R.; Iriti, M.; Wojtyczka, R.D.; Buszman, E.; Stojko, J. Flavonoids, bioactive components of propolis, exhibit cytotoxic activity and induce cell cycle arrest and apoptosis in human breast cancer cells MDA-MB-231 and MCF-7—A comparative study. Cell. Mol. Biol. 2018, 64, 1. [Google Scholar] [CrossRef] [Green Version]
- Choi, E.J.; Jung, J.Y.; Kim, G.H. Genistein inhibits the proliferation and differentiation of MCF-7 and 3T3-L1 cells via the regulation of ERα expression and induction of apoptosis. Exp. Ther. Med. 2014, 8, 454–458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsuboy, M.S.; Marcarini, J.C.; de Souza, A.O.; de Paula, N.A.; Dorta, D.J.; Mantovani, M.S.; Ribeirol, L.R. Genistein at Maximal Physiologic Serum Levels Induces G0/G1 Arrest in MCF-7 and HB4a Cells, But Not Apoptosis. J. Med. Food. 2014, 17, 218–225. [Google Scholar] [CrossRef] [PubMed]
- Uifălean, A.; Schneider, S.; Gierok, P.; Ionescu, C.; Iuga, C.A.; Lalk, M. The Impact of Soy Isoflavones on MCF-7 and MDA-MB-231 Breast Cancer Cells Using a Global Metabolomic Approach. Int. J. Mol. Sci. 2016, 17, 1443. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lavigne, J.A.; Takahashi, Y.; Chandramouli, G.V.R.; Liu, H.; Perkins, S.N.; Hursting, S.D.; Wang, T.T.Y. Concentration-dependent effects of genistein on global gene expression in MCF-7 breast cancer cells: An oligo microarray study. Breast. Cancer Res. Treat. 2008, 110, 85–98. [Google Scholar] [CrossRef] [PubMed]
- Chinni, S.R.; Alhasan, S.A.; Multani, A.S.; Pathak, S.; Sarkar, F.H. Pleotropic effects of genistein on MCF-7 breast cancer cells. Int. J. Mol. Med. 2003, 12, 29–34. [Google Scholar] [CrossRef]
- Prietsch, R.F.; Monte, L.G.; da Silva, F.A.; Beira, F.T.; del Pino, F.A.B.; Campos, V.F.; Collares, T.; Pinto, L.S.; Spanevello, R.M.; Gamaro, G.D.; et al. Genistein induces apoptosis and autophagy in human breast MCF-7 cells by modulating the expression of proapoptotic factors and oxidative stress enzymes. Mol. Cell Biochem. 2014, 390, 235–242. [Google Scholar] [CrossRef]
- Chen, J.; Lin, C.; Yong, W.; Ye, Y.; Huang, Z. Calycosin and genistein induce apoptosis by inactivation of HOTAIR/p-Akt signaling pathway in human breast cancer MCF-7 cells. Cell Physiol. Biochem. 2015, 35, 722–728. [Google Scholar] [CrossRef]
- Chen, J.; Duan, Y.; Zhang, X.; Ye, Y.; Ge, B.; Chen, J. Genistein induces apoptosis by the inactivation of the IGF-1R/p-Akt signaling pathway in MCF-7 human breast cancer cells. Food Funct. 2015, 6, 995–1000. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Forward Sequence | Reverse Sequence | Product Size (bp) |
---|---|---|---|
BCl2 | ATCGCCCTGTGGATGACTGAGT | GCCAGGAGAAATCAAACAGAGGC | 140 |
MKI67 | GAAAGAGTGGCAACCTGCCTTC | GCACCAAGTTTTACTACATCTGCC | 151 |
EGFR | AACACCCTGGTCTGGAAGTACG | TCGTTGGACAGCCTTCAAGACC | 106 |
AKT1 | TGGACTACCTGCACTCGGAGAA | GTGCCGCAAAAGGTCTTCATGG | 154 |
BIRC5 | CCACTGAGAACGAGCCAGACTT | GTATTACAGGCGTAAGCCACCG | 115 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pawlicka, M.A.; Zmorzyński, S.; Popek-Marciniec, S.; Filip, A.A. The Effects of Genistein at Different Concentrations on MCF-7 Breast Cancer Cells and BJ Dermal Fibroblasts. Int. J. Mol. Sci. 2022, 23, 12360. https://doi.org/10.3390/ijms232012360
Pawlicka MA, Zmorzyński S, Popek-Marciniec S, Filip AA. The Effects of Genistein at Different Concentrations on MCF-7 Breast Cancer Cells and BJ Dermal Fibroblasts. International Journal of Molecular Sciences. 2022; 23(20):12360. https://doi.org/10.3390/ijms232012360
Chicago/Turabian StylePawlicka, Magda Aleksandra, Szymon Zmorzyński, Sylwia Popek-Marciniec, and Agata Anna Filip. 2022. "The Effects of Genistein at Different Concentrations on MCF-7 Breast Cancer Cells and BJ Dermal Fibroblasts" International Journal of Molecular Sciences 23, no. 20: 12360. https://doi.org/10.3390/ijms232012360