Next Article in Journal
Potential Economic Impacts of Allocating More Land for Bioenergy Biomass Production in Virginia
Next Article in Special Issue
Spatial and Temporal Calcium Signaling and Its Physiological Effects in Moso Bamboo under Drought Stress
Previous Article in Journal
Hybrid Machine Learning Approaches for Landslide Susceptibility Modeling
Previous Article in Special Issue
Ecophysiological Responses of Carpinus turczaninowii L. to Various Salinity Treatments
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 10
Issue 2
10.3390/f10020158
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Analysis of a CPYC-Type Glutaredoxin Associated with Stress Response in Rubber Trees

by
Kun Yuan
1,
Xiuli Guo
2,
Chengtian Feng
1,
Yiyu Hu
1,
Jinping Liu
2,* and
Zhenhui Wang
1
1
Key Laboratory of Biology and Genetic Resources of Rubber Tree, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
2
Hainan Key Laboratory for Sustainable Utilization of Tropical Bioresources, Tropical Agriculture and Forestry Institute, Hainan University, Haikou 570228, China
*
Author to whom correspondence should be addressed.
Forests 2019, 10(2), 158; https://doi.org/10.3390/f10020158
Submission received: 17 January 2019 / Revised: 6 February 2019 / Accepted: 7 February 2019 / Published: 12 February 2019
(This article belongs to the Special Issue Physiological Responses to Abiotic and Biotic Stress in Forest Trees)
Browse Figures
Review Reports Versions Notes

Abstract

:
Glutaredoxins (GRXs) are a class of small oxidoreductases which modulate various biological processes in plants. Here, we isolated a GRX gene from the rubber tree (Hevea brasiliensis Müll. Arg.), named as HbSRGRX1, which encoded 107 amino acid residues with a CPYC active site. Phylogenetic analysis displayed that HbSRGRX1 was more correlated with GRXs from Manihot esculenta Crantz. and Ricinus communis L. HbSRGRX1 was localized in the nuclei of tobacco cells, and its transcripts were preferentially expressed in male flowers and in the high-yield variety Reyan 7-33-97 with strong resistance against cold. The expression levels of HbSRGRX1 significantly decreased in tapping panel dryness (TPD) trees. Furthermore, HbSRGRX1 was regulated by wounding, hydrogen peroxide (H2O2), and multiple hormones. Altogether, these results suggest important roles of HbSRGRX1 in plant development and defense response to TPD and multiple stresses.

1. Introduction

The rubber tree (Hevea brasiliensis Müll. Arg.) from the Euphorbiaceae family, as the major source of natural rubber, is thought to be one of the important industrial trees. The production of natural rubber is facing a serious threat caused by tapping panel dryness (TPD), which is identified by a part or complete cessation of latex flow. It is found that over exploitation, namely over tapping or excessive stimulation by ethephon (ET), might lead to the onset of TPD [1]. Although many researches have tried to reveal the mechanism of TPD, it is still unclear. Numerous genes related to TPD have been identified [2,3,4]. The onset of TPD is thought to be closely associated with reactive oxygen species (ROS) signaling [4]. The excessive generation of ROS can elicit oxidative damage to lipids, DNA, and proteins, leading to the plant cell death [5]. Plants have evolved various ROS scavenging systems, of which, gutaredoxins (GRXs) are important members that can maintain and modulate cellular redox status with the reducing power of glutathione (GSH) [6]. Increasing evidence indicates that GRXs have antioxidant functions in plant responses to oxidative stress [7,8,9,10]. According to the sequences of active sites, plant GRXs contain three main groups, CPY(F)C-, CGFS- and CC-type [6,11]. They take part in the regulation of growth and development, stress responses, and iron-sulfur cluster assembly [9,12,13,14,15]. There are 31 GRX members in Arabidopsis thaliana (L.) Heynh., 48 in Oryza sativa L., and 36 in Populus trichocarpa Torr. & A.Gray ex. Hook. Many researches into CGFS- and CC-type GRX genes have been carried out in plants [8,12,16,17]. However, there are few data about CPYC- type GRXs. Several CPYC-type GRX genes in Populus trichocarpa are reported to show differential expression patterns in various organs [11]. Recently, it was found that various treatments could induce the expression of rice OsGRX20, a CPYC-type GRX. Further analysis indicates that overexpression of OsGRX20 in the rice sensitive genotype strikingly increases resistance to bacterial blight [10]. Although many plant GRX genes have been characterized, the biological functions of GRXs in rubber treesremain unknown.
The transcript of the GRXC9 gene belonging to CC-type class shows decreased expression in TPD trees as compared to healthy ones [4,18], but their biological functions have not been researched in rubber trees. Previously, our proteomic analysis indicated that a GRX protein (ABZ88803.1/ EU295478.1) decreased in the latex of TPD plants compared with healthy ones [19]. Therefore, we postulate that this GRX gene might have critical roles during TPD onset, and it is essential to be further study its function. Here, we sequenced a stress-responsive GRX gene in rubber trees, named as HbSRGRX1, and the phylogenetic tree was constructed in the present research. Meanwhile, the expression profiles of HbSRGRX1 were systematically analyzed in various tissues and varieties, different degrees of TPD trees, wounding, hydrogen peroxide (H2O2), and various hormone treatments. The results demonstrated that HbSRGRX1 participated in response to TPD and other various stimuli, suggesting its crucial function in rubber trees.

2. Materials and Methods

2.1. Plant Materials

The rubber tree clone Reyan 7-33-97 from an experimental field of the Chinese Academy of Tropical Agricultural Sciences in China was used. Seven different tissues from 10-year-old trees were collected to study the tissue-specific expression of HbSRGRX1. This type of tree was similarly selected to analyze the influence of H2O2 and various hormones on HbSRGRX1 expression. To examine the variety-specific expression of HbSRGRX1, 5 different varieties, including Reyan 7-33-97, 7-20-59, 8-79, Reken 523, and PR107 were selected from 10-year-old trees. To study the effect of wounding on HbSRGRX1 expression, virgin trees from 8-years-old were used. To detect the influence of TPD on HbSRGRX1, 24-year-old trees with different TPD degrees (Grade 1, degree <25% tapping panel dry; Grade 2, degree 25% < tapping panel dry < 50%; and Grade 3, degree >50% tapping panel dry) were used. The healthy ones (Grade 0) were used as control (the images of rubber trees from different TPD degrees shown in Figure S1).

2.2. Wounding, H2O2 and Hormones Treatments

For the wounding treatment, eight stainless drawing pins were used to stick into the bark of each tree and left in place as described [20]. Four batches of 10 virgin trees were selected, 3 of which were wounded at 6, 12, 24, and 48 h before the first tapping, and the fourth batch was unwounded as the control. The H2O2 and hormone treatments were arranged according to the methods of Deng et al. [21] and Long et al. [22], respectively. Three batches (five trees each) were treated with 2% H2O2, 1.5% ET, 200 µmol/L abscisic acid (ABA), 0.005% methyl jasmonate (MeJA), 200 µmol/L salicylic acid (SA), 66 µmol/L 2,4-dichlorophenoxyacetic acid (2,4-D), 100 µmol/L gibberellic acid (GA3), 200 µmol/L 6-Benzylaminopurine (6-BA) and 100 µmol/L indole-3-acetic acid (IAA). Another one was used as the control. The H2O2 and hormones were treated at 6, 12, 24, and 48 h.

2.3. RNA Isolation and cDNA Synthesis

All latex total RNA was isolated as described [23]. RNA of other tissues was extracted using the RNAprep pure Plant Kit (TIANGEN, Beijing, China). The integrity and concentration of RNA was examined by agarose gel electrophoresis, and a spectrophotometer (Thermo, New York, NY, USA). The synthesis of First-strand cDNA was conducted with the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, Waltham, MA, USA)).

2.4. ORF Cloning of HbSRGRX1

According to the sequence of EU295478.1, several pairs of primers were designed (Table 1). The open reading frame (ORF) of HbSRGRX1 was flanked by the pair of primers HbSRGRX1-F (5’-ATGGCGATGACCAAGGCCAAG-3’) and HbSRGRX1-R (5’-TTTAAGCAGAAGCCTTAGCAAGAGCTCC-3’). The product was cloned into the pMD18-T vector, and then sequenced.

2.5. Sequence Analyses

The molecular weight (Mw) and isoelectric point (pI) of HbSRGRX1 were predicted by the ExPASy compute pI/Mw tool. The protein conserved domain was identified with the NCBI (National Center for Biotechnology Information) CDD (Conserved Domain Database) and SMART (Simple Modular Architecture Research Tool) [24]. The protein sequence was aligned by DNAMAN 6. The phylogenetic tree was constructed by MEGA (Molecular Evolutionary Genetics Analysis) 6.06 with neighbor-joining method [25]. A bootstrap test was performed using 1000 replicates.

2.6. Subcellular Localization

HbSRGRX1 was localized as described [21]. A pair of primers 1302-HbSRGRX1-F (5’-CTCCCATGGATGGCGATGACCAAGGCCAAG-3’) and 1302-HbSRGRX1-R (5’-CGCACTAGTTTAAGCAGAAGCCTTAGCAAGAGCTCC-3’) was used to amplify the coding sequence of HbSRGRX1 (Table 1). The product was cloned into the pMD18-T vector, the correct plasmids and pCAMBIA1302-GFP vector were digested with Nco I and Spe I, respectively. The products were ligated with T4-DNA ligase to obtain the recombinant vector pCAMBIA1302-HbSRGRX1-GFP, which was then transformed into A. tumefaciens strain EHA105. The A. tumefaciens harboring the recombinant vector was infiltrated into the N. benthamiana leaves. Fluorescence signals were examined using a confocal microscope (Fluo ViewTM FV1000).

2.7. Real-time Quantitative PCR (qPCR)

The expression patterns of HbSRGRX1 were examined by qPCR using the primers HbSRGRX1-QF and HbSRGRX1-QR (Table 1). The 18S rRNA gene (primers: Hb18SrRNA-QF and Hb18SrRNA-QR; Table 1) was used as the internal control. The qPCR was carried out on a LightCycler 2.0 system (Roche Diagnostics, Switzerland) using SYBR Premix Ex Taq™ II (Takara, Dalian, China). The PCR procedures and the calculation of the relative abundance of transcripts were performed as described [20]. All qPCR experiments were reproduced in triplicate, and the values were presented as mean ± SD (Standard Deviation). Figures were drawn by OriginPro 9.0 software (OriginLab Corporation, Northampton, MA, USA).

3. Results

3.1. ORF Cloning, Sequence Alignment and Phylogenetic Analysis of HbSRGRX1

Primers HbSRGRX1-F and HbSRGRX1-R were designed to clone the ORF of HbSRGRX1 using latex cDNA of the clone Reyan 7-33-97 as the template. HbSRGRX1 contained a 324-bp ORF encoding 107 amino acid residues. The putative molecular mass was 11.3 kDa, and the pI was 6.71. HbSRGRX1 contained a conserved motif of the thioredoxin_like superfamily, a CPYC active site at 23–26 amino acids at the N-terminus and GSH binding sites, belonging to CPYC-type class (Figure 1A).
Multiple sequence alignment of HbSRGRX1 with its related CPY (F) C-type ones from several other plants revealed high identities with the GRXs from Manihot esculenta Crantz. Ricinus communis L. and Jatropha curcas L. (84.11%, 77.57%, and 75.23%, respectively). HbSRGRX1 had 73.39%, 71.17%, 68.42%, and 64.60% identity with GRXs from Populus trichocarpa, Arabidopsis thaliana, Vitis vinifera L., and Triticum aestivum L., respectively (Figure 1A). To establish the phylogenic relationships among plant GRXs, a phylogenetic tree was constructed between HbSRGRX1 and another 16 plant GRXs in CPY (F) C-type class, using the neighbor-joining method. As shown in Figure 1B, HbSRGRX1 was more closely related to MeGRX (Manihot esculenta, XP 021594601.1) and RcGRX (Ricinus communis, XP 002524673.1), which belonged to the same family as Hevea brasiliensis of Euphorbiaceae. This result demonstrated that the GRXs were highly conserved during evolution.

3.2. Subcellular Localization of HbSRGRX1

To further investigate the subcellular localization of HbSRGRX1 in cells, the N. benthamiana leaves were infiltrated with the A. tumefaciens harboring pCAMBIA1302-HbSRGRX1-GFP vector and observed with a confocal microscope. The results demonstrated that the fluorescent signal was examined in the nuclei (Figure 2), indicating that HbSRGRX1 was a nucleus located protein.

3.3. Expression of HbSRGRX1 in Different Tissues and Varieties

The expression of HbSRGRX1 was examined in seven tissues, including latex, leaf, bark, male flower, female flower, xylem, and petiole. As shown in Figure 3A, HbSRGRX1 displayed a tissue-specific expression profile. The expression of HbSRGRX1 was highest in male flowers, which was strikingly higher than in other tissues (p < 0.05), 38.9- and 617.5-fold over its expression in latex and leaf, respectively. In addition, HbSRGRX1 was differentially expressed in five different varieties of rubber trees, including Reyan 7-33-97, 7-20-59, 8-79, Reken 523, and PR107. The expression level of HbSRGRX1 was significantly higher in Reyan 7-33-97 than other varieties, the lowest in Reyan 7-20-59 and 8-79 (Figure 3B). Together, the above results indicated that HbSRGRX1 might have particular functions in different tissues and varieties.

3.4. Expression of HbSRGRX1 in Different Degrees of TPD Trees

The TPD of rubber tree is a complicated physiological disorder caused by over tapping or excessive stimulation by ET, seriously affecting natural rubber production [26]. To further analyze the expression of HbSRGRX1 at the transcriptional level, the bark and latex from different degrees of TPD trees (Grade 0, healthy trees; Grade 1, degree <25% tapping panel dry; Grade 2, degree 25% < tapping panel dry < 50%; and Grade 3, degree >50% tapping panel dry) were collected, respectively. In general, the expression of HbSRGRX1 was markedly higher in healthy plants than TPD ones (Figure 3C,D). Remarkably, the expression of HbSRGRX1 in bark showed a trend of constantly significant decline with the degree of TPD rising (Figure 3C), while did not change in latex of different degrees of TPD (1–3) except the healthy control (0) (Figure 3D). These results indicated that the expression levels of HbSRGRX1 were closely correlated with TPD severities.

3.5. Expression of HbSRGRX1 in Response to Different Treatments

Tapping is a kind of mechanical wounding, over tapping or excessive stimulation by ET can elicit oxidative stresses of laticifer cells and the balance between ROS production and scavenging is broken, resulting in ROS burst and the onset of TPD in Hevea brasiliensis [1]. Multiple hormones are reported to regulate the expression of GRX genes in rice [10,27]. Thus, the expression profiles of HbSRGRX1 in latex were systematically investigated in response to wounding, H2O2, ET, MeJA, ABA, SA, GA3, 2, 4-D, 6-BA, and IAA using qPCR method. As shown in Figure 4, all the treatments regulated the expression of HbSRGRX1, but the expression profiles showed obvious variations. After wounding and H2O2 treatments, HbSRGRX1 expression indicated an irregular fluctuation and was generally suppressed, with the lowest expression at 6 h and 24 h, respectively (Figure 4A,B). With ET treatment, the expression of HbSRGRX1 significantly decreased to the lowest level at 24 h (Figure 4C). Similarly, its expression was rapidly inhibited at 6 h after MeJA treatment and kept a similar expression level from 6 h to 48 h (Figure 4D). HbSRGRX1 showed similar expression profiles and was quickly induced, all rising to the highest point at 6 h, and then markedly declining at 12 h after ABA, SA, and GA3 treatments (Figure 4E–G). As for 2, 4-D, 6-BA, and IAA treatments, HbSRGRX1 exhibited a similar expression trend of first rising and then declining, reaching the peaks at 6 h, 12 h and 24 h, respectively (Figure 4H–J). Taken together, these results demonstrated that HbSRGRX1 might have distinct functions in response to wounding, H2O2, and hormones.

4. Discussion

Glutaredoxins (GRXs) are a class of small oxidoreductases whose size is commonly 10 to 15 kDa. Many studies have suggested that plant GRXs perform various roles, such as modulating organ development, response to oxidative stress, and hormone signaling [7,12,27]. However, there are few data about the rubber tree GRXs, and their functions are still unclear. In this study, a CPYC-type GRX gene HbSRGRX1, encoding 107 amino acids, was isolated from rubber trees. Sequence alignment and phylogenetic analysis indicated that HbSRGRX1 had high homology with MeGRX and RcGRX of Euphorbiaceae family, suggesting its conservation in the evolution. This research demonstrated that HbSRGRX1 was localized in the nuclei of tobacco cells. Nuclear localization of GRXs were previously found in other plants [10,27,28,29]. It is indicated that nuclear localization of a GRX protein belonging to CC-type class from Arabidopsis thaliana, ROXY1, is pivotal in controlling petal development [29]. The rice OsGRX8, localized in the nuclei and cytosol, is found to take part in response to osmotic, salinity and oxidative stresses [27].
In the present study, the qPCR method was used to systematically investigate the expression profiles of the rubber tree HbSRGRX1 gene in various tissues and varieties, different degrees of TPD trees, and under multiple treatments. It is reported that the GRXs genes are differentially expressed in various tissues in rice and poplar [10,11,30]. The rubber tree HbSRGRX1 gene had a tissue-specific expression profile, with the strongest expression in male flowers and weakest in leaves (Figure 3A), suggesting its vital function in the development of male flowers. The CYPC-type PtrcGrxC3 from Populus trichocarpa shows the highest expression in flowers and the lowest in leaves, which is similar to our results [11]. Additionally, the HbSRGRX1 gene had differential expression in five various varieties, with the highest level in Reyan 7-33-97, followed by Reken 523, PR107, Reyan 8-79, and 7-20-59 (Figure 3B). In the five varieties, Reyan 7-33-97 is a high-yield variety with strong resistance against cold, PR107 and 7-20-59 against wind, while the resistance of Reken 523 and Reyan 8-79 against cold and wind is the weakest. The differential expression of HbSRGRX1 in various varieties suggested its specific function in defense response of rubber trees.
ROS signaling is reported to be involved in the process of TPD onset, and some ROS-scavenging genes have been identified [4,31]. GRX, as a scavenger of ROS, is found to show down-regulated expression in TPD trees by using transcriptome analysis [4]. Consistently, the expression of the HbSRGRX1 gene significantly declined in TPD trees in this study (Figure 3C,D). Furthermore, the HbSRGRX1 expression was repressed by H2O2 treatment (Figure 4B). According to these results, we speculated that HbSRGRX1 might play an antioxidant role in TPD response.
Here, we found that the wounding and diverse hormones treatments could also regulate the expression of the HbSRGRX1 gene (Figure 4). Hormones are known to modulate plant development and environmental stress response. Many studies have demonstrated that the expression of GRX genes is affected by a number of hormones in plants. The Arabidopsis GRX480 (also known as GRXC9) may play a key role in SA/JA cross-talk [13], and its expression can be activated by UVB exposure through an SA-dependent and NPR1-independent pathway [32]. Overexpression of rice CC-type OsGRX8 reduces the sensitivity to plant hormones, ABA, and IAA [27]. The transcripts of rice GRX genes are reported to participate in response to a variety of hormones, including IAA, SA, JA, ABA, cytokinin, and ethylene derivatives [30]. In addition, the expression of the rice OsGRX20 gene significantly rises after 2, 4-D, JA, SA, and ABA treatments [10]. ET (an ethylene releaser) has been generally used in stimulating latex regeneration in rubber trees. However, the mechanism of ET regulating latex production remains poorly understood. In our study, HbSRGRX1 showed a significantly down-regulated expression after ET treatment (Figure 4C), suggesting its important function in the ethylene signaling pathway. In plants, JA is known to be a vital hormone involved in controlling a variety of physiological responses [33,34,35,36]. It has been demonstrated that laticifer differentiation can be induced by exogenous JA in H. brasiliensis, and the number of laticifers is closely correlated with latex production [37]. JA is also indicated to be a key signal molecule in the modulation of rubber biosynthesis [38]. The present results displayed that JA markedly down-regulated the expression of the HbSRGRX1 gene (Figure 4D). It was possible that HbSRGRX1 played an important role in JA-regulating rubber biosynthesis. Besides ET and JA, HbSRGRX1 expression was induced by hormones ABA, SA, GA3, 2, 4-D, 6-BA, and IAA, reaching the highest level at different times after treatments (Figure 4E-J). Altogether, our results suggest a critical function of HbSRGRX1 in plant development and response to TPD, wounding, H2O2, and various hormones, and would make a foundation for further characterizing the function of HbSRGRX1 in Hevea brasiliensis.

5. Conclusions

HbSRGRX1 encoded a protein for CPYC-type GRX with CPYC active site. HbSRGRX1 was significantly down-regulated in TPD trees and might play important roles during the onset of TPD. HbSRGRX1 was preferentially expressed in male flower and might regulate the development of the male flower. HbSRGRX1 was involved in defense response to wounding and other various stresses. To better understand the relation between HbSRGRX1 and TPD, it is necessary to study the function of HbSRGRX1 in-depth in the future.

Supplementary Materials

The following are available online at https://www.mdpi.com/1999-4907/10/2/158/s1, Figure S1: Rubber trees from different TPD degrees.

Author Contributions

The experiments were designed by Z.W. and J.L. The manuscript was written by K.Y. The experiments were carried out by X.G. The experimental materials were collected by C.F. and Y.H.

Funding

This research was funded by the China Agriculture Research System-Natural Rubber (CARS-34-GW5) and the Ministry of Agriculture of China (1630022018009).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Faridah, Y.; Siti Arija, M.; Ghandimathi, H. Changes in some physiological latex parameters in relation to over exploitation and onset of induced tapping panel dryness. J. Nat. Rubber Res. 1996, 10, 182–186. [Google Scholar]
  2. Chen, S.; Peng, S.; Huang, G.; Wu, K.; Fu, X.; Chen, Z. Association of decreased expression of a Myb transcription factor with the TPD (tapping panel dryness) syndrome in Hevea brasiliensis. Plant Mol. Biol. 2003, 51, 51–58. [Google Scholar] [CrossRef] [PubMed]
  3. Venkatachalam, P.; Thulaseedharan, A.; Raghothama, K. Identification of expression profiles of tapping panel dryness (TPD) associated genes from the latex of rubber tree (Hevea brasiliensis Muell. Arg.). Planta 2007, 226, 499–515. [Google Scholar] [CrossRef] [PubMed]
  4. Li, D.; Deng, Z.; Chen, C.; Xia, Z.; Wu, M.; He, P.; Chen, S. Identification and characterization of genes associated with tapping panel dryness from Hevea brasiliensis latex using suppression subtractive hybridization. BMC Plant Biol. 2010, 10, 140. [Google Scholar] [CrossRef] [PubMed]
  5. Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed]
  6. Rouhier, N.; Gelhaye, E.; Jacquot, J.P. Plant glutaredoxins: Still mysterious reducing systems. Cell Mol. Life Sci. 2004, 61, 1266–1277. [Google Scholar] [CrossRef] [PubMed]
  7. Cheng, N.H. AtGRX4, an Arabidopsis chloroplastic monothiol glutaredoxin, is able to suppress yeast grx5 mutant phenotypes and respond to oxidative stress. FEBS Lett. 2008, 582, 848–854. [Google Scholar] [CrossRef] [PubMed]
  8. Laporte, D.; Olate, E.; Salinas, P.; Salazar, M.; Jordana, X.; Holuigue, L. Glutaredoxin GRXS13 plays a key role in protection against photooxidative stress in Arabidopsis. J. Exp. Bot. 2012, 63, 503–515. [Google Scholar] [CrossRef] [PubMed]
  9. Wu, Q.Y.; Lin, J.; Liu, J.Z.; Wang, X.F.; Lim, W.; Oh, M.; Park, J.; Rajashekar, C.B.; Whitham, S.A.; Cheng, N.H.; Hirschi, K.D.; Park, S. Ectopic expression of Arabidopsis glutaredoxin AtGRXS17 enhances thermotolerance in tomato. Plant Biotech. J. 2012, 10, 945–955. [Google Scholar] [CrossRef]
  10. Ning, X.; Sun, Y.; Wang, C.; Zhang, W.; Sun, M.; Hu, H.; Liu, J.; Yang, L. A rice CPYC-type glutaredoxin OsGRX20 in protection against bacterial blight, methyl viologen and salt stresses. Front. Plant Sci. 2018, 9, 111. [Google Scholar] [CrossRef] [PubMed]
  11. Rouhier, N.; Couturier, J.; Jacquot, J.P. Genome-wide analysis of plant glutaredoxin systems. J. Exp. Bot. 2006, 57, 1685–1696. [Google Scholar] [CrossRef] [PubMed]
  12. Xing, S.; Rosso, M.G.; Zachgo, S. ROXY1, a member of the plant glutaredoxin family, is required for petal development in Arabidopsis thaliana. Development 2005, 132, 1555–1565. [Google Scholar] [CrossRef] [PubMed]
  13. Ndamukong, I.; Al Abdallat, A.; Thurow, C.; Fode, B.; Zander, M.; Weigel, R.; Gatz, C. SA-inducible Arabidopsis glutaredoxin interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. Plant J. 2007, 50, 128–139. [Google Scholar] [CrossRef] [PubMed]
  14. Bandyopadhyay, S.; Gama, F.; Molina-Navarro, M.M.; Gualberto, J.M.; Claxton, R.; Naik, S.G.; Huynh, B.H.; Herrero, E.; Jacquot, J.P.; Johnson, M.K.; et al. Chloroplast monothiol glutaredoxins as scaffold proteins for the assembly and delivery of [2Fe-2S] clusters. EMBO J. 2008, 27, 1122–1133. [Google Scholar] [CrossRef] [PubMed]
  15. Yang, F.; Bui, H.T.; Pautler, M.; Llaca, V.; Johnston, R.; Lee, B.H.; Kolbe, A.; Sakai, H.; Jackson, D. A maize glutaredoxin gene, Abphyl2, regulates shoot meristem size and phyllotaxy. Plant Cell 2015, 27, 121–131. [Google Scholar] [CrossRef] [PubMed]
  16. Cheng, N.H.; Liu, J.Z.; Liu, X.; Wu, Q.; Thompson, S.M.; Lin, J.; Chang, J.; Whitham, S.A.; Park, S.; Cohen, J.D.; et al. Arabidopsis monothiol glutaredoxin, AtGRXS17, is critical for temperature-dependent postembryonic growth and development via modulating auxin response. J. Biol. Chem. 2011, 286, 20398–20406. [Google Scholar] [CrossRef] [PubMed]
  17. Xing, S.; Zachgo, S. ROXY1 and ROXY2, two Arabidopsis glutaredoxin genes, are required for another development. Plant J. 2008, 53, 790–801. [Google Scholar] [CrossRef] [PubMed]
  18. Li, D.; Wang, X.; Deng, Z.; Liu, H.; Yang, H.; He, G. Transcriptome analyses reveal molecular mechanism underlying tapping panel dryness of rubber tree (Hevea brasiliensis). Sci. Rep. 2016, 6, 23540. [Google Scholar] [CrossRef]
  19. Yuan, K.; Wang, Z.; Zhou, X.; Zou, Z.; Yang, L. The identification of differentially expressed latex proteins in healthy and tapping panel dryness (TPD) Hevea brasiliensis trees by iTRAQ and 2D LC-MS/MS. Acta Agric. Univ. Jiangxiensis 2014, 36, 650–655. [Google Scholar]
  20. Tang, C.; Huang, D.; Yang, J.; Liu, S.; Sakr, S.; Li, H.; Zhou, Y.; Qin, Y. The sucrose transporter HbSUT3 plays an active role in sucrose loading to laticifer and rubber productivity in exploited trees of Hevea brasiliensis (para rubber tree). Plant Cell Environ. 2010, 33, 1708–1720. [Google Scholar] [CrossRef]
  21. Deng, Z.; Zhao, M.; Liu, H.; Wang, Y.; Li, D. Molecular cloning, expression profiles and characterization of a glutathione reductase in Hevea brasiliensis. Plant Physiol. Bioch. 2015, 96, 53–63. [Google Scholar] [CrossRef] [PubMed]
  22. Long, X.; He, B.; Wang, C.; Fang, Y.; Qi, J.; Tang, C. Molecular identification and characterization of the pyruvate decarboxylase gene family associated with latex regeneration and stress response in rubber tree. Plant Physiol. Bioch. 2015, 87, 35–44. [Google Scholar] [CrossRef] [PubMed]
  23. Tang, C.; Qi, J.; Li, H.; Zhang, C.; Wang, Y. A convenient and efficient protocol for isolating high-quality RNA from latex of Hevea brasiliensis (para rubber tree). J. Biochem. Bioph. Meth. 2007, 70, 749–754. [Google Scholar] [CrossRef] [PubMed]
  24. Schultz, J.; Milpetz, F.; Bork, P.; Ponting, C.P. SMART, a simple modular architecture research tool: Identification of signaling domains. Proc. Natl. Acad. Sci. USA 1998, 95, 5857–5864. [Google Scholar] [CrossRef] [PubMed]
  25. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
  26. Jacob, J.L.; Prevot, J.C.; Laccrotte, R. Tapping panel dryness in Hevea brasiliensis. Plant Rech. Dev. 1994, 2, 15–21. [Google Scholar]
  27. Sharma, R.; Priya, P.; Jain, M. Modified expression of an auxin responsive rice CC-type glutaredoxin gene affects multiple abiotic stress responses. Planta 2013, 238, 871–884. [Google Scholar] [CrossRef]
  28. Hong, L.; Tang, D.; Zhu, K.; Wang, K.; Li, M.; Cheng, Z. Somatic and reproductive cell development in rice anther is regulated by a putative glutaredoxin. Plant Cell 2012, 24, 577–588. [Google Scholar] [CrossRef]
  29. Li, S.; Lauri, A.; Ziemann, M.; Busch, A.; Bhave, M.; Zachgo, S. Nuclear activity of ROXY1, a glutaredoxin interacting with TGA factors, is required for petal development in Arabidopsis thaliana. Plant Cell 2009, 21, 429–441. [Google Scholar] [CrossRef]
  30. Garg, R.; Jhanwar, S.; Tyagi, A.K.; Jain, M. Genome-wide survey and expression analysis suggest diverse roles of glutaredoxin gene family members during development and response to various stimuli in rice. DNA Res. 2010, 17, 353–367. [Google Scholar] [CrossRef]
  31. Putranto, R.A.; Herlinawati, E.; Rio, M.; Leclercq, J.; Piyatrakul, P.; Gohet, E.; Sanier, C.; Oktavia, F.; Pirrello, J.; Kuswanhadi; et al. Involvement of ethylene in the latex metabolism and tapping panel dryness of Hevea brasiliensis. Int. J. Mol. Sci. 2015, 16, 17885–17908. [Google Scholar] [CrossRef] [PubMed]
  32. Herrera-Vásquez, A.; Carvallo, L.; Blanco, F.; Tobar, M.; Villarroel-Candia, E.; Vicente-Carbajosa, J.; Salinas, P.; Holuigue, L. Transcriptional control of glutaredoxin GRXC9 expression by a salicylic acid-dependent and NPR1-Independent pathway in Arabidopsis. Plant Mol. Biol. Report. 2015, 33, 624–637. [Google Scholar] [CrossRef] [PubMed]
  33. McConn, M.; Creelman, R.A.; Bell, E.; Mullet, J.E.; Browse, J. Jasmonate is essential for insect defense in Arabidopsis. Proc. Natl. Acad. Sci. USA 1997, 94, 5473–5477. [Google Scholar] [CrossRef] [PubMed]
  34. Yuan, Z.; Zhang, D. Roles of jasmonate signalling in plant inflorescence and flower development. Curr. Opin. Plant Biol. 2015, 27, 44–51. [Google Scholar] [CrossRef] [PubMed]
  35. Farooq, M.A.; Gill, R.A.; Islam, F.; Ali, B.; Liu, H.; Xu, J.; He, S.; Zhou, W. Methyl jasmonate regulates antioxidant defense and suppresses arsenic uptake in Brassica napus L. Front Plant Sci. 2016, 7, 468. [Google Scholar] [CrossRef] [PubMed]
  36. Hu, Y.; Jiang, Y.; Han, X.; Wang, H.; Pan, J.; Yu, D. Jasmonate regulates leaf senescence and tolerance to cold stress: Crosstalk with other phytohormones. J. Exp. Bot. 2017, 68, 1361–1369. [Google Scholar] [CrossRef] [PubMed]
  37. Hao, B.Z.; Wu, J.L. Laticifer differentiation in Hevea brasiliensis: Induction by exogenous jasmonic acid and linolenic acid. Ann. Bot. 2000, 85, 37–43. [Google Scholar] [CrossRef]
  38. Zeng, R.Z.; Duan, C.F.; Li, X.Y.; Tian, W.M.; Nie, Z.Y. Vacuolar-type inorganic pyrophosphatase located on the rubber particle in the latex is an essential enzyme in regulation of the rubber biosynthesis in Hevea brasiliensis. Plant Sci. 2009, 176, 602–607. [Google Scholar]
Forests 10 00158 g001 550
Figure 1. Sequence alignment and phylogenetic analyses of HbSRGRX1 and other plant GRXs. (A) Dark and gray indicate identical and similar amino acids, respectively. The straight line, asterisk, and dotted line represent the conserved motif of the thioredoxin_like superfamily, GSH binding site, and active site, respectively. (B) The phylogenetic tree was generated by MEGA (Molecular Evolutionary Genetics Analysis) 6.06 using the neighbor-joining method with 1000 bootstrap tests. The scale bar represents the estimated number of amino acid substitutions per site. The accession numbers of GRX proteins are as follows: Manihot esculenta (MeGRX, XP 021594601.1), Ricinus communis (RcGRX, XP 002524673.1), Populus trichocarpa (PtGRX, XP 002298529.2), Prunus mume (PmGRX, XP 008230572.1), Arabidopsis thaliana (AtGRX, NP 198853.1), Jatropha curcas (JcGRX, NP 001295635.1 ), Theobroma cacao (TcGRX, XP 007031532.1), Juglans regia (JrGRX, XP 018842397.1), Solanum pennellii (SpGRX, XP 015077482.1), Nicotiana attenuate (NaGRX, XP 019224739.1), Morus notabilis (MnGRX, XP 024029530.1), Vitis vinifera (VvGRX, XP 002276266.1), Triticum aestivum (TaGRX, AAP80853.1), Elaeis guineensis (EgGRX, XP 010940165.1), Zea mays (ZmGRX, NP 001158948.1), Oryza sativa (OsGRX, XP 015626005.1).
Figure 1. Sequence alignment and phylogenetic analyses of HbSRGRX1 and other plant GRXs. (A) Dark and gray indicate identical and similar amino acids, respectively. The straight line, asterisk, and dotted line represent the conserved motif of the thioredoxin_like superfamily, GSH binding site, and active site, respectively. (B) The phylogenetic tree was generated by MEGA (Molecular Evolutionary Genetics Analysis) 6.06 using the neighbor-joining method with 1000 bootstrap tests. The scale bar represents the estimated number of amino acid substitutions per site. The accession numbers of GRX proteins are as follows: Manihot esculenta (MeGRX, XP 021594601.1), Ricinus communis (RcGRX, XP 002524673.1), Populus trichocarpa (PtGRX, XP 002298529.2), Prunus mume (PmGRX, XP 008230572.1), Arabidopsis thaliana (AtGRX, NP 198853.1), Jatropha curcas (JcGRX, NP 001295635.1 ), Theobroma cacao (TcGRX, XP 007031532.1), Juglans regia (JrGRX, XP 018842397.1), Solanum pennellii (SpGRX, XP 015077482.1), Nicotiana attenuate (NaGRX, XP 019224739.1), Morus notabilis (MnGRX, XP 024029530.1), Vitis vinifera (VvGRX, XP 002276266.1), Triticum aestivum (TaGRX, AAP80853.1), Elaeis guineensis (EgGRX, XP 010940165.1), Zea mays (ZmGRX, NP 001158948.1), Oryza sativa (OsGRX, XP 015626005.1).
Forests 10 00158 g001
Forests 10 00158 g002 550
Figure 2. Subcellular localization of HbSRGRX1. GFP alone (top row) was localized throughout the whole cell and pCAMBIA1302-HbSRGRX1-GFP (bottom row) in the nuclei of tobacco epidermal cells. Bar = 20 µm.
Figure 2. Subcellular localization of HbSRGRX1. GFP alone (top row) was localized throughout the whole cell and pCAMBIA1302-HbSRGRX1-GFP (bottom row) in the nuclei of tobacco epidermal cells. Bar = 20 µm.
Forests 10 00158 g002
Forests 10 00158 g003 550
Figure 3. Expression profiles of HbSRGRX1 gene in different tissues and varieties, and in bark and latex from different tapping panel dryness (TPD) levels. Expression profiles of HbSRGRX1 in different tissues (A), barks from different varieties (B), bark (C), and latex (D) from different TPD levels. 0, 1, 2, and 3 indicated healthy trees (Grade 0), Grade 1 (degree <25% tapping panel dry), Grade 2 (degree 25% < tapping panel dry < 50%) and Grade 3 (degree >50% tapping panel dry), respectively. Relative expression was normalized using 18S rRNA gene. Values represent mean ± SD of three independent replicates. Different letters indicate significant difference (p < 0.05).
Figure 3. Expression profiles of HbSRGRX1 gene in different tissues and varieties, and in bark and latex from different tapping panel dryness (TPD) levels. Expression profiles of HbSRGRX1 in different tissues (A), barks from different varieties (B), bark (C), and latex (D) from different TPD levels. 0, 1, 2, and 3 indicated healthy trees (Grade 0), Grade 1 (degree <25% tapping panel dry), Grade 2 (degree 25% < tapping panel dry < 50%) and Grade 3 (degree >50% tapping panel dry), respectively. Relative expression was normalized using 18S rRNA gene. Values represent mean ± SD of three independent replicates. Different letters indicate significant difference (p < 0.05).
Forests 10 00158 g003
Forests 10 00158 g004 550
Figure 4. Expression profiles of the HbSRGRX1 gene under different treatments. Expression profiles of HbSRGRX1 in latex at 6, 12, 24, and 48h after wounding (A), hydrogen peroxide (H2O2) (B), ethephon (ET) (C), methyl jasmonate (MeJA) (D), abscisic acid (ABA) (E), salicylic acid (SA) (F), gibberellic acid (GA3) (G), 2,4-dichlorophenoxyacetic acid (2,4-D) (H), 6-Benzylaminopurine (6-BA) (I), and indole-3-acetic acid (IAA) (J) treatments. Untreated trees were used as the control (0 h). Relative expression was normalized using 18S rRNA gene. Values represent mean ± SD of three independent replicates. Different letters indicate significant difference (p < 0.05).
Figure 4. Expression profiles of the HbSRGRX1 gene under different treatments. Expression profiles of HbSRGRX1 in latex at 6, 12, 24, and 48h after wounding (A), hydrogen peroxide (H2O2) (B), ethephon (ET) (C), methyl jasmonate (MeJA) (D), abscisic acid (ABA) (E), salicylic acid (SA) (F), gibberellic acid (GA3) (G), 2,4-dichlorophenoxyacetic acid (2,4-D) (H), 6-Benzylaminopurine (6-BA) (I), and indole-3-acetic acid (IAA) (J) treatments. Untreated trees were used as the control (0 h). Relative expression was normalized using 18S rRNA gene. Values represent mean ± SD of three independent replicates. Different letters indicate significant difference (p < 0.05).
Forests 10 00158 g004
Table
Table 1. Primer sequences.
Table 1. Primer sequences.
Primer NamePrimer Sequence (5’→3’)Use
HbSRGRX1-FATGGCGATGACCAAGGCCAAGORF cloning
HbSRGRX1-RTTTAAGCAGAAGCCTTAGCAAGAGCTCCORF cloning
1302-HbSRGRX1-FCTCCCATGGATGGCGATGACCAAGGCCAAGSubcellular localization analysis
1302-HbSRGRX1-RCGCACTAGTTTAAGCAGAAGCCTTAGCAAGAGCTCCSubcellular localization analysis
HbSRGRX1-QFCGTTTCTTCCAATTCTGTTGTCGTTReal-time PCR analysis
HbSRGRX1-QRCAATGTGCTTGCCACTGATGReal-time PCR analysis
Hb18SrRNA-QFGCTCGAAGACGATCAGATACCReal-time PCR analysis
Hb18SrRNA-QRTTCAGCCTTGCGACCATACReal-time PCR analysis
Underline represents the restriction enzyme sites.

Share and Cite

MDPI and ACS Style

Yuan, K.; Guo, X.; Feng, C.; Hu, Y.; Liu, J.; Wang, Z. Identification and Analysis of a CPYC-Type Glutaredoxin Associated with Stress Response in Rubber Trees. Forests 2019, 10, 158. https://doi.org/10.3390/f10020158

AMA Style

Yuan K, Guo X, Feng C, Hu Y, Liu J, Wang Z. Identification and Analysis of a CPYC-Type Glutaredoxin Associated with Stress Response in Rubber Trees. Forests. 2019; 10(2):158. https://doi.org/10.3390/f10020158

Chicago/Turabian Style

Yuan, Kun, Xiuli Guo, Chengtian Feng, Yiyu Hu, Jinping Liu, and Zhenhui Wang. 2019. "Identification and Analysis of a CPYC-Type Glutaredoxin Associated with Stress Response in Rubber Trees" Forests 10, no. 2: 158. https://doi.org/10.3390/f10020158

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop