Circular RNA circHIPK3 Promotes the Proliferation and Differentiation of Chicken Myoblast Cells by Sponging miR-30a-3p
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Primers
2.3. Cell Culture and Transfection
2.4. RNA Exaction, cDNA Synthesis and Quantitative Real-Time PCR (qRT-PCR)
2.5. Validation of circHIPK3
2.6. Plasmids Construction and RNA Oligonucleotides
2.7. 5-Ethynyl-2′-Deoxyuridine (EdU) Assay
2.8. Flow Cytometry of the Cell Cycle
2.9. Cell Counting Kit 8 (CCK-8) Assay
2.10. Immunofluorescence
2.11. Binding Relationship Prediction and Dual-Luciferase Reporter Assay
2.12. Western Blotting
2.13. Statistical Analysis
3. Results
3.1. circHIPK3 Differentially Expressed during Embryonic Leg Muscle Development
3.2. circHIPK3 Interacts with miR-30a-3p
3.3. miR-30a-3p Inhibits Myoblast Proliferation
3.4. MEF2C Is a Target Gene of miR-30a-3p
3.5. miR-30a-3p Represses CPM Differentiation
3.6. circHIPK3 Promotes the Proliferation of CPMs
3.7. circHIPK3 Promotes the Differentiation of CPMs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Scanes, C.G.; Harvey, S.; Marsh, J.A.; King, D.B. Hormones and Growth in Poultry. Poult. Sci. 1984, 63, 2062–2074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Güller, I.; Russell, A.P. MicroRNAs in skeletal muscle: Their role and regulation in development, disease and function. J. Physiol. 2010, 588, 4075–4087. [Google Scholar] [CrossRef] [PubMed]
- Flisar, T.; Malovrh, Š.; Terčič, D.; Holcman, A.; Kovač, M. Thirty-four generations of divergent selection for 8-week body weight in chickens. Poult. Sci. 2014, 93, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Chen, J.-F.; Mandel, E.M.; Thomson, J.M.; Wu, Q.; Callis, T.E.; Hammond, S.M.; Conlon, F.L.; Wang, D.-Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 2006, 38, 228–233. [Google Scholar] [CrossRef] [PubMed]
- Van Rooij, E.; Liu, N.; Olson, E.N. MicroRNAs flex their muscles. Trends Genet. 2008, 24, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Ouyang, H.; Wang, Z.; Chen, B.; Nie, Q. A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p. Cells 2018, 7, 199. [Google Scholar] [CrossRef] [PubMed]
- Luo, W.; Wu, H.; Ye, Y.; Li, Z.; Hao, S.; Kong, L.; Zheng, X.; Lin, S.; Nie, Q.; Zhang, X. The transient expression of miR-203 and its inhibiting effects on skeletal muscle cell proliferation and differentiation. Cell Death Dis. 2014, 5, e1347. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.; Ouyang, H.; Abdalla, B.A.; Xu, H.; Nie, Q.; Zhang, X. miR-16 controls myoblast proliferation and apoptosis through directly suppressing Bcl2 and FOXO1 activities. Biochim. Biophys. Acta 2017, 1860, 674–684. [Google Scholar] [CrossRef] [PubMed]
- Ma, M.; Cai, B.; Jiang, L.; Abdalla, B.A.; Li, Z.; Nie, Q.; Zhang, X. lncRNA-Six1 Is a Target of miR-1611 that Functions as a ceRNA to Regulate Six1 Protein Expression and Fiber Type Switching in Chicken Myogenesis. Cells 2018, 7, 243. [Google Scholar] [CrossRef]
- Qi, B.; Wang, Y.; Chen, Z.-J.; Li, X.-N.; Qi, Y.; Yang, Y.; Cui, G.-H.; Guo, H.-Z.; Li, W.-H.; Zhao, S. Down-regulation of miR-30a-3p/5p promotes esophageal squamous cell carcinoma cell proliferation by activating the Wnt signaling pathway. World J. Gastroenterol. 2017, 23, 7965–7977. [Google Scholar] [CrossRef]
- Wang, W.; Lin, H.; Zhou, L.; Zhu, Q.; Gao, S.; Xie, H.; Liu, Z.; Xu, Z.; Wei, J.; Huang, X.; et al. MicroRNA-30a-3p inhibits tumor proliferation, invasiveness and metastasis and is downregulated in hepatocellular carcinoma. Eur. J. Surg. Oncol. 2014, 40, 1586–1594. [Google Scholar] [CrossRef] [PubMed]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef]
- Rybak-Wolf, A.; Stottmeister, C.; Glažar, P.; Jens, M.; Pino, N.; Giusti, S.; Hanan, M.; Behm, M.; Bartok, O.; Ashwal-Fluss, R.; et al. Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. Mol. Cell 2015, 58, 870–885. [Google Scholar] [CrossRef] [PubMed]
- Legnini, I.; Di Timoteo, G.; Rossi, F.; Morlando, M.; Briganti, F.; Sthandier, O.; Fatica, A.; Santini, T.; Andronache, A.; Wade, M.; et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Mole. Cell 2017, 66, 22–37. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.-L. The biogenesis and emerging roles of circular RNAs. Nat. Rev. Mol. Cell Biol. 2016, 17, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Dong, R.; Zhang, X.-O.; Zhang, Y.; Ma, X.-K.; Chen, L.-L.; Yang, L. CircRNA-derived pseudogenes. Cell Res. 2016, 26, 747–750. [Google Scholar] [CrossRef] [Green Version]
- Abdelmohsen, K.; Panda, A.C.; De, S.; Grammatikakis, I.; Kim, J.; Ding, J.; Noh, J.H.; Kim, K.M.; Mattison, J.A.; de Cabo, R.; et al. Circular RNAs in monkey muscle: Age-dependent changes. Aging 2015, 7, 903–910. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, H.; Chen, X.; Wang, Z.; Yu, J.; Jia, X.; Li, Z.; Luo, W.; Abdalla, B.A.; Jebessa, E.; Nie, Q.; et al. Circular RNAs are abundant and dynamically expressed during embryonic muscle development in chickens. DNA Res. 2017, 3. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, H.; Chen, X.; Li, W.; Li, Z.; Nie, Q.; Zhang, X. Circular RNA circSVIL Promotes Myoblast Proliferation and Differentiation by Sponging miR-203 in Chicken. Front. Genet. 2018, 9. [Google Scholar] [CrossRef]
- Guo, L.; Huang, W.; Chen, B.; Jebessa Bekele, E.; Chen, X.; Cai, B.; Nie, Q. gga-mir-133a-3p Regulates Myoblasts Proliferation and Differentiation by Targeting PRRX1. Front. Genet. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Li, X.; Ma, Q.; Zhang, X.; Cao, Y.; Yao, Y.; You, S.; Wang, D.; Quan, R.; Hou, X.; et al. Genome-wide analysis of circular RNAs in prenatal and postnatal pituitary glands of sheep. Sci. Rep. 2017, 7, 97165–97177. [Google Scholar] [CrossRef] [PubMed]
- Liang, G.; Yang, Y.; Niu, G.; Tang, Z.; Li, K. Genome-wide profiling of Sus scrofa circular RNAs across nine organs and three developmental stages. DNA Res. 2017, 24, 523–535. [Google Scholar] [CrossRef] [PubMed]
- Piwecka, M.; Glažar, P.; Hernandez-Miranda, L.R.; Memczak, S.; Wolf, S.A.; Rybak-Wolf, A.; Filipchyk, A.; Klironomos, F.; Cerda Jara, C.A.; Fenske, P.; et al. Loss of a mammalian circular RNA locus causes miRNA deregulation and affects brain function. Science 2017, 22, eaam8526. [Google Scholar] [CrossRef] [PubMed]
- Salzman, J.; Chen, R.E.; Olsen, M.N.; Wang, P.L.; Brown, P.O. Cell-Type Specific Features of Circular RNA Expression. PLoS Genet. 2013, 9. [Google Scholar] [CrossRef]
- Guo, J.U.; Agarwal, V.; Guo, H.; Bartel, D.P. Expanded identification and characterization of mammalian circular RNAs. Genome Biol. 2014, 15. [Google Scholar] [CrossRef] [PubMed]
- Conn, S.J.; Pillman, K.A.; Toubia, J.; Conn, V.M.; Salmanidis, M.; Phillips, C.A.; Roslan, S.; Schreiber, A.W.; Gregory, P.A.; Goodall, G.J. The RNA Binding Protein Quaking Regulates Formation of circRNAs. Cell 2015, 160, 1125–1134. [Google Scholar] [CrossRef] [Green Version]
- Greco, S.; Cardinali, B.; Falcone, G.; Martelli, F. Circular RNAs in Muscle Function and Disease. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef]
- Wei, X.; Li, H.; Yang, J.; Hao, D.; Dong, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Lin, F.; et al. Circular RNA profiling reveals an abundant circLMO7 that regulates myoblasts differentiation and survival by sponging miR-378a-3p. Cell Death Dis. 2017, 8, e3153. [Google Scholar] [CrossRef]
- Chen, J.; Zou, Q.; Lv, D.; Wei, Y.; Raza, M.A.; Chen, Y.; Li, P.; Xi, X.; Xu, H.; Wen, A.; et al. Comprehensive transcriptional landscape of porcine cardiac and skeletal muscles reveals differences of aging. Oncotarget 2017, 9, 1524–1541. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Yang, J.; Wei, X.; Song, C.; Dong, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Ma, Y.; et al. CircFUT10 reduces proliferation and facilitates differentiation of myoblasts by sponging miR-133a. J. Cell. Physiol. 2018, 233, 4643–4651. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wei, X.; Yang, J.; Dong, D.; Hao, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Ma, Y.; et al. circFGFR4 Promotes Differentiation of Myoblasts via Binding miR-107 to Relieve Its Inhibition of Wnt3a. Mol. Ther. Nucleic Acids 2018, 11, 272–283. [Google Scholar] [CrossRef] [PubMed]
- Rogg, E.M.; Abplanalp, W.T.; Bischof, C.; John, D.; Schulz, M.H.; Krishnan, J.; Fischer, A.; Poluzzi, C.; Schaefer, L.; Bonauer, A.; et al. Analysis of Cell Type-Specific Effects of MicroRNA-92a Provides Novel Insights Into Target Regulation and Mechanism of Action. Circulation 2018, 138, 2545–2558. [Google Scholar] [CrossRef]
- Yasmeen, S.; Kaur, S.; Mirza, A.H.; Brodin, B.; Pociot, F.; Kruuse, C. miRNA-27a-3p and miRNA-222-3p as Novel Modulators of Phosphodiesterase 3a (PDE3A) in Cerebral Microvascular Endothelial Cells. Mol. Neurobiol. 2019, 2. [Google Scholar] [CrossRef] [PubMed]
- Treiber, T.; Treiber, N.; Meister, G. Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat. Rev. Mol. Cell Biol. 2019, 20, 5–20. [Google Scholar] [CrossRef]
- Wei, W.; He, H.-B.; Zhang, W.-Y.; Zhang, H.-X.; Bai, J.-B.; Liu, H.-Z.; Cao, J.-H.; Chang, K.-C.; Li, X.-Y.; Zhao, S.-H. miR-29 targets Akt3 to reduce proliferation and facilitate differentiation of myoblasts in skeletal muscle development. Cell Death Dis. 2013, 4, e668. [Google Scholar] [CrossRef]
- Li, G.; Luo, W.; Abdalla, B.A.; Ouyang, H.; Yu, J.; Hu, F.; Nie, Q.; Zhang, X. miRNA-223 upregulated by MYOD inhibits myoblast proliferation by repressing IGF2 and facilitates myoblast differentiation by inhibiting ZEB1. Cell Death Dis. 2017, 8, e3094. [Google Scholar] [CrossRef]
- Jebessa, E.; Ouyang, H.; Abdalla, B.A.; Li, Z.; Abdullahi, A.Y.; Liu, Q.; Nie, Q.; Zhang, X. Characterization of miRNA and their target gene during chicken embryo skeletal muscle development. Oncotarget 2018, 9. [Google Scholar] [CrossRef]
- Hansen, T.B.; Jensen, T.I.; Clausen, B.H.; Bramsen, J.B.; Finsen, B.; Damgaard, C.K.; Kjems, J. Natural RNA circles function as efficient microRNA sponges. Nature 2013, 495, 384–388. [Google Scholar] [CrossRef]
- Shan, K.; Liu, C.; Liu, B.H.; Chen, X.; Dong, R.; Liu, X.; Zhang, Y.Y.; Liu, B.; Zhang, S.J.; Wang, J.J.; et al. Circular Noncoding RNA HIPK3 Mediates Retinal Vascular Dysfunction in Diabetes Mellitus. Circulation 2017, 136, 1629–1642. [Google Scholar]
- Zheng, Q.; Bao, C.; Guo, W.; Li, S.; Chen, J.; Chen, B.; Luo, Y.; Lyu, D.; Li, Y.; Shi, G.; et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat. Commun. 2016, 7, 11215. [Google Scholar] [CrossRef] [Green Version]
- Cheng, C.-W.; Wang, H.-W.; Chang, C.-W.; Chu, H.-W.; Chen, C.-Y.; Yu, J.-C.; Chao, J.-I.; Liu, H.-F.; Ding, S.; Shen, C.-Y. MicroRNA-30a inhibits cell migration and invasion by downregulating vimentin expression and is a potential prognostic marker in breast cancer. Breast Cancer Res. Treat. 2012, 134, 1081–1093. [Google Scholar] [CrossRef] [PubMed]
- Peng, R.; Zhou, L.; Zhou, Y.; Zhao, Y.; Li, Q.; Ni, D.; Hu, Y.; Long, Y.; Liu, J.; Lyu, Z.; et al. MiR-30a Inhibits the Epithelial—Mesenchymal Transition of Podocytes through Downregulation of NFATc3. Int. J. Mol. Sci. 2015, 16, 24032–24047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Nucleotide Sequences (5′→3′) | Tm. (°C) | Product Size (bp) | Application |
---|---|---|---|---|
QcircHIPK3 | F: GTTTAATCCACGCTGACCTCA | 61.3 | 130 | qPCR for circHIPK3 |
R: GACTTGTGAGGCCATACCTATA | ||||
QHIPK3 | F: GGGGTATGTCCCGGAG | 61.3 | 261 | qPCR for HIPK3 |
R: CTTCGCTAATGGAACAACAC | ||||
QMEF2C | F: AGGGTGTATGTGCAGGAACG | 60 | 288 | qPCR for MEF2C |
R: AGCAATCTCGCAGTCACACA | ||||
Convergent primers | F: TGGTACAAGCGGAGATGG R: TTGAGGTCAGCGTGGATTA | 55 | 450 | Amplification of partial sequence of exon 3 of HIPK3 |
Divergent primers | F: GCACGCCAAGGACAAATA | 58 | 782 | |
R: TACGCTTCAATCCACATCG | Amplification of partial sequence of circHIPK3 which contain the joint site | |||
β-actin | F: CTCCCCCATGCCATCCTCCGTCTG | 52–65 | 179 | qPCR forβ-actin |
R: GCTGTGGCCATCTCCTGCTC | ||||
si-circHIPK3-001 | CCCGGTATTATAGGTATGG | - | - | - |
si-circHIPK3-002 | GGTATTATAGGTATGGCCT | - | - | - |
si-circHIPK3-003 | ATTATAGGTATGGCCTCAC | - | - | - |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, B.; Yu, J.; Guo, L.; Byers, M.S.; Wang, Z.; Chen, X.; Xu, H.; Nie, Q. Circular RNA circHIPK3 Promotes the Proliferation and Differentiation of Chicken Myoblast Cells by Sponging miR-30a-3p. Cells 2019, 8, 177. https://doi.org/10.3390/cells8020177
Chen B, Yu J, Guo L, Byers MS, Wang Z, Chen X, Xu H, Nie Q. Circular RNA circHIPK3 Promotes the Proliferation and Differentiation of Chicken Myoblast Cells by Sponging miR-30a-3p. Cells. 2019; 8(2):177. https://doi.org/10.3390/cells8020177
Chicago/Turabian StyleChen, Biao, Jiao Yu, Lijin Guo, Mary Shannon Byers, Zhijun Wang, Xiaolan Chen, Haiping Xu, and Qinghua Nie. 2019. "Circular RNA circHIPK3 Promotes the Proliferation and Differentiation of Chicken Myoblast Cells by Sponging miR-30a-3p" Cells 8, no. 2: 177. https://doi.org/10.3390/cells8020177