Protection against Oxidative Stress by Coenzyme Q10 in a Porcine Retinal Degeneration Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Porcine Retinal Explants and Oxidative Stress Induction
2.2. (Immuno-) Histological Staining of Retinal Cross-Sections
2.3. RNA Isolation and cDNA Synthesis
2.4. Quantitative Real-Time PCR (RT-qPCR)
2.5. Statistical Analyses
3. Results
3.1. HE Staining Revealed No Significant Changes in Retinal Thickness
3.2. CoQ10 Minimized RGC Loss
3.3. Reduced Microglia Accumulation by CoQ10 after Eight Days
3.4. Inflammatory Activity Was Not Affected by CoQ10
3.5. CoQ10 Stimulates Intracellular Protection Cascades against Oxidative Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bear, M.F.; Connors, B.W.; Paradiso, M.A. Neurowissenschaften: Ein Grundlegendes Lehrbuch Für Biologie, Medizin und Psychologie; Engel, A.K., Ed.; Springer Spektrum: Berlin/Heidelberg, Germany, 2018; Volume 4, p. 316. [Google Scholar]
- Duh, E.J.; Sun, J.K.; Stitt, A.W. Diabetic retinopathy: Current understanding, mechanisms, and treatment strategies. JCI Insight 2017, 2, e93751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fleckenstein, M.; Keenan, T.D.L.; Guymer, R.H.; Chakravarthy, U.; Schmitz-Valckenberg, S.; Klaver, C.C.; Wong, W.T.; Chew, E.Y. Age-related macular degeneration. Nat. Rev. Dis. Primers 2021, 7, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Glaucoma Society Terminology and Guidelines for Glaucoma, 5th Edition. Br. J. Ophthalmol. 2021, 105, 1–169. [CrossRef] [Scilit] [PubMed]
- Rein, D.B. Vision problems are a leading source of modifiable health expenditures. Investig. Ophthalmol. Vis. Sci. 2013, 54, ORSF18–ORSF22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tham, Y.C.; Li, X.; Wong, T.Y.; Quigley, H.A.; Aung, T.; Cheng, C.Y. Global prevalence of glaucoma and projections of glaucoma burden through 2040: A systematic review and meta-analysis. Ophthalmology 2014, 121, 2081–2090. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- IQWiG. Glaucoma: Overview; Institute for Quality and Efficiency in Health Care: Cologne, Germany, 2022. Available online: https://www.ncbi.nlm.nih.gov/books/NBK367579/ (accessed on 1 August 2019).
- Jassim, A.H.; Fan, Y.; Pappenhagen, N.; Nsiah, N.Y.; Inman, D.M. Oxidative Stress and Hypoxia Modify Mitochondrial Homeostasis During Glaucoma. Antioxid. Redox Signal. 2021, 35, 1341–1357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quigley, H.A.; Broman, A.T. The number of people with glaucoma worldwide in 2010 and 2020. Br. J. Ophthalmol. 2006, 90, 262–267. [Google Scholar] [CrossRef] [Scilit]
- Tezel, G. Oxidative stress in glaucomatous neurodegeneration: Mechanisms and consequences. Prog. Retin. Eye Res. 2006, 25, 490–513. [Google Scholar] [CrossRef] [Scilit]
- Esporcatte, B.L.; Tavares, I.M. Normal-tension glaucoma: An update. Arq. Bras. De Oftalmol. 2016, 79, 270–276. [Google Scholar] [CrossRef] [Scilit]
- Killer, H.E.; Pircher, A. Normal tension glaucoma: Review of current understanding and mechanisms of the pathogenesis. Eye 2018, 32, 924–930. [Google Scholar] [CrossRef] [Scilit]
- Williamson, A.; Singh, S.; Fernekorn, U.; Schober, A. The future of the patient-specific Body-on-a-chip. Lab A Chip 2013, 13, 3471–3480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schaeffer, W.I. Terminology associated with cell, tissue, and organ culture, molecular biology, and molecular genetics. Tissue Culture Association Terminology Committee. Vitr. Cell. Dev. Biol. J. Tissue Cult. Assoc. 1990, 26, 97–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hendrickson, A.; Hicks, D. Distribution and density of medium- and short-wavelength selective cones in the domestic pig retina. Exp. Eye Res. 2002, 74, 435–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leinonen, H.; Tanila, H. Vision in laboratory rodents-Tools to measure it and implications for behavioral research. Behav. Brain Res. 2018, 352, 172–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hurst, J.; Kuehn, S.; Jashari, A.; Tsai, T.; Bartz-Schmidt, K.U.; Schnichels, S.; Joachim, S.C. A novel porcine ex vivo retina culture model for oxidative stress induced by H2O2. Altern. Lab. Anim. ATLA 2017, 45, 11–25. [Google Scholar] [CrossRef] [Scilit]
- Hurst, J.; Mueller-Buehl, A.M.; Hofmann, L.; Kuehn, S.; Herms, F.; Schnichels, S.; Joachim, S.C. iNOS-inhibitor driven neuroprotection in a porcine retina organ culture model. J. Cell. Mol. Med. 2020, 24, 4312–4323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuehn, S.; Hurst, J.; Jashari, A.; Ahrens, K.; Tsai, T.; Wunderlich, I.M.; Dick, H.B.; Joachim, S.C.; Schnichels, S. The novel induction of retinal ganglion cell apoptosis in porcine organ culture by NMDA—An opportunity for the replacement of animals in experiments. Altern. Lab. Anim. ATLA 2016, 44, 557–568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mueller-Buehl, A.M.; Doepper, H.; Grauthoff, S.; Kiebler, T.; Peters, L.; Hurst, J.; Kuehn, S.; Bartz-Schmidt, K.U.; Dick, H.B.; Joachim, S.C.; et al. Oxidative stress-induced retinal damage is prevented by mild hypothermia in an ex vivo model of cultivated porcine retinas. Clin. Exp. Ophthalmol. 2020, 48, 666–681. [Google Scholar] [CrossRef] [Scilit]
- Ransy, C.; Vaz, C.; Lombes, A.; Bouillaud, F. Use of H2O2 to Cause Oxidative Stress, the Catalase Issue. Int. J. Mol. Sci. 2020, 21, 9149. [Google Scholar] [CrossRef] [Scilit]
- Tsai, T.; Mueller-Buehl, A.M.; Satgunarajah, Y.; Kuehn, S.; Dick, H.B.; Joachim, S.C. Protective effect of the extremolytes ectoine and hydroxyectoine in a porcine organ culture. Graefe’s Arch. Clin. Exp. Ophthalmol. = Albrecht Von Graefes Arch. Fur Klin. Und Exp. Ophthalmol. 2020, 258, 2185–2203. [Google Scholar] [CrossRef] [Scilit]
- Caruana, N.J.; Stroud, D.A. The road to the structure of the mitochondrial respiratory chain supercomplex. Biochem. Soc. Trans. 2020, 48, 621–629. [Google Scholar] [CrossRef] [Scilit]
- Passi, S.; De Pita, O.; Grandinetti, M.; Simotti, C.; Littarru, G.P. The combined use of oral and topical lipophilic antioxidants increases their levels both in sebum and stratum corneum. BioFactors 2003, 18, 289–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ernster, L.; Dallner, G. Biochemical, physiological and medical aspects of ubiquinone function. Biochim. Biophys. Acta 1995, 1271, 195–204. [Google Scholar] [CrossRef] [Scilit]
- Choi, H.; Park, H.H.; Lee, K.Y.; Choi, N.Y.; Yu, H.J.; Lee, Y.J.; Park, J.; Huh, Y.M.; Lee, S.H.; Koh, S.H. Coenzyme Q10 restores amyloid beta-inhibited proliferation of neural stem cells by activating the PI3K pathway. Stem Cells Dev. 2013, 22, 2112–2120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, R.; Ren, T.; Zeng, J. Mitochondrial Coenzyme Q Protects Sepsis-Induced Acute Lung Injury by Activating PI3K/Akt/GSK-3beta/mTOR Pathway in Rats. BioMed Res. Int. 2019, 2019, 5240898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Zhan, J.; Hou, Y.; Hou, Y.; Chen, S.; Luo, D.; Luan, J.; Wang, L.; Lin, D. Coenzyme Q10 Regulation of Apoptosis and Oxidative Stress in H2O2 Induced BMSC Death by Modulating the Nrf-2/NQO-1 Signaling Pathway and Its Application in a Model of Spinal Cord Injury. Oxidative Med. Cell. Longev. 2019, 2019, 6493081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edwards, G.; Lee, Y.; Kim, M.; Bhanvadia, S.; Kim, K.Y.; Ju, W.K. Effect of Ubiquinol on Glaucomatous Neurodegeneration and Oxidative Stress: Studies for Retinal Ganglion Cell Survival and/or Visual Function. Antioxidants 2020, 9, 952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ju, W.K.; Shim, M.S.; Kim, K.Y.; Bu, J.H.; Park, T.L.; Ahn, S.; Weinreb, R.N. Ubiquinol promotes retinal ganglion cell survival and blocks the apoptotic pathway in ischemic retinal degeneration. Biochem. Biophys. Res. Commun. 2018, 503, 2639–2645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mueller-Buehl, A.M.; Buehner, T.; Pfarrer, C.; Deppe, L.; Peters, L.; Dick, B.H.; Joachim, S.C. Hypoxic Processes Induce Complement Activation via Classical Pathway in Porcine Neuroretinas. Cells 2021, 10, 3575. [Google Scholar] [CrossRef] [Scilit]
- Ito, D.; Imai, Y.; Ohsawa, K.; Nakajima, K.; Fukuuchi, Y.; Kohsaka, S. Microglia-specific localisation of a novel calcium binding protein, Iba1. Brain Res. Mol. Brain Res. 1998, 57, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Pereiro, X.; Ruzafa, N.; Urcola, J.H.; Sharma, S.C.; Vecino, E. Differential Distribution of RBPMS in Pig, Rat, and Human Retina after Damage. Int. J. Mol. Sci. 2020, 21, 9330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez, A.R.; de Sevilla Muller, L.P.; Brecha, N.C. The RNA binding protein RBPMS is a selective marker of ganglion cells in the mammalian retina. J. Comp. Neurol. 2014, 522, 1411–1443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, A.F. Superoxide dismutases: Ancient enzymes and new insights. FEBS Lett. 2012, 586, 585–595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nojima, Y.; Ito, K.; Ono, H.; Nakazato, T.; Bono, H.; Yokoyama, T.; Sato, R.; Suetsugu, Y.; Nakamura, Y.; Yamamoto, K.; et al. Superoxide dismutases, SOD1 and SOD2, play a distinct role in the fat body during pupation in silkworm Bombyx mori. PLoS ONE 2015, 10, e0116007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zelko, I.N.; Mariani, T.J.; Folz, R.J. Superoxide dismutase multigene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic. Biol. Med. 2002, 33, 337–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandes, K.A.; Harder, J.M.; Williams, P.A.; Rausch, R.L.; Kiernan, A.E.; Nair, K.S.; Anderson, M.G.; John, S.W.; Howell, G.R.; Libby, R.T. Using genetic mouse models to gain insight into glaucoma: Past results and future possibilities. Exp. Eye Res. 2015, 141, 42–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harada, C.; Kimura, A.; Guo, X.; Namekata, K.; Harada, T. Recent advances in genetically modified animal models of glaucoma and their roles in drug repositioning. Br. J. Ophthalmol. 2019, 103, 161–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maliha, A.M.; Kuehn, S.; Hurst, J.; Herms, F.; Fehr, M.; Bartz-Schmidt, K.U.; Dick, H.B.; Joachim, S.C.; Schnichels, S. Diminished apoptosis in hypoxic porcine retina explant cultures through hypothermia. Sci. Rep. 2019, 9, 4898. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Prokosch, V. Energy Metabolism in the Inner Retina in Health and Glaucoma. Int. J. Mol. Sci. 2021, 22, 3689. [Google Scholar] [CrossRef] [Scilit]
- Yu, D.Y.; Cringle, S.J.; Balaratnasingam, C.; Morgan, W.H.; Yu, P.K.; Su, E.N. Retinal ganglion cells: Energetics, compartmentation, axonal transport, cytoskeletons and vulnerability. Prog. Retin. Eye Res. 2013, 36, 217–246. [Google Scholar] [CrossRef] [Scilit]
- Abraha, A.M.; Ketema, E.B. Apoptotic pathways as a therapeutic target for colorectal cancer treatment. World J. Gastrointest. Oncol. 2016, 8, 583–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mueller-Buehl, A.M.; Tsai, T.; Hurst, J.; Theiss, C.; Peters, L.; Hofmann, L.; Herms, F.; Kuehn, S.; Schnichels, S.; Joachim, S.C. Reduced Retinal Degeneration in an Oxidative Stress Organ Culture Model through an iNOS-Inhibitor. Biology 2021, 10, 383. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; ShiYang, X.; Zhang, Y.; Miao, Y.; Chen, Y.; Cui, Z.; Xiong, B. Coenzyme Q10 ameliorates the quality of postovulatory aged oocytes by suppressing DNA damage and apoptosis. Free Radic. Biol. Med. 2019, 143, 84–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, Y.; Lee, K.H.; Park, J.H.; Geum, D.; Kim, K. Mitochondrial membrane depolarization and the selective death of dopaminergic neurons by rotenone: Protective effect of coenzyme Q10. J. Neurochem. 2005, 93, 1199–1208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, R.; Shen, Q.; Xu, P.; Luo, J.J.; Tang, Y. Phagocytosis of microglia in the central nervous system diseases. Mol. Neurobiol. 2014, 49, 1422–1434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grigsby, J.G.; Cardona, S.M.; Pouw, C.E.; Muniz, A.; Mendiola, A.S.; Tsin, A.T.; Allen, D.M.; Cardona, A.E. The role of microglia in diabetic retinopathy. J. Ophthalmol. 2014, 2014, 705783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguzzi, A.; Barres, B.A.; Bennett, M.L. Microglia: Scapegoat, saboteur, or something else? Science 2013, 339, 156–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; He, X.; Kawaguchi, R.; Zhang, Y.; Wang, Q.; Monavarfeshani, A.; Yang, Z.; Chen, B.; Shi, Z.; Meng, H.; et al. Microglia-organized scar-free spinal cord repair in neonatal mice. Nature 2020, 587, 613–618. [Google Scholar] [CrossRef] [Scilit]
- Todd, L.; Palazzo, I.; Suarez, L.; Liu, X.; Volkov, L.; Hoang, T.V.; Campbell, W.A.; Blackshaw, S.; Quan, N.; Fischer, A.J. Reactive microglia and IL1beta/IL-1R1-signaling mediate neuroprotection in excitotoxin-damaged mouse retina. J. Neuroinflamm. 2019, 16, 118. [Google Scholar] [CrossRef] [Scilit]
- Ozawa, Y. Oxidative stress in the light-exposed retina and its implication in age-related macular degeneration. Redox Biol. 2020, 37, 101779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saada, J.; McAuley, R.J.; Marcatti, M.; Tang, T.Z.; Motamedi, M.; Szczesny, B. Oxidative stress induces Z-DNA-binding protein 1-dependent activation of microglia via mtDNA released from retinal pigment epithelial cells. J. Biol. Chem. 2022, 298, 101523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, X.; Cho, K.S.; Thee, E.F.; Jager, M.J.; Chen, D.F. Neuroinflammation and microglia in glaucoma: Time for a paradigm shift. J. Neurosci. Res. 2019, 97, 70–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hopperton, K.E.; Mohammad, D.; Trepanier, M.O.; Giuliano, V.; Bazinet, R.P. Markers of microglia in post-mortem brain samples from patients with Alzheimer’s disease: A systematic review. Mol. Psychiatry 2018, 23, 177–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagner, N.; Reinehr, S.; Palmhof, M.; Schuschel, D.; Tsai, T.; Sommer, E.; Frank, V.; Stute, G.; Dick, H.B.; Joachim, S.C. Microglia Activation in Retinal Ischemia Triggers Cytokine and Toll-Like Receptor Response. J. Mol. Neurosci. MN 2021, 71, 527–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tezel, G.; Yang, X.; Luo, C.; Kain, A.D.; Powell, D.W.; Kuehn, M.H.; Kaplan, H.J. Oxidative stress and the regulation of complement activation in human glaucoma. Investig. Ophthalmol. Vis. Sci. 2010, 51, 5071–5082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, T.; Reinehr, S.; Maliha, A.M.; Joachim, S.C. Immune Mediated Degeneration and Possible Protection in Glaucoma. Front. Neurosci. 2019, 13, 931. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karlstetter, M.; Scholz, R.; Rutar, M.; Wong, W.T.; Provis, J.M.; Langmann, T. Retinal microglia: Just bystander or target for therapy? Prog. Retin. Eye Res. 2015, 45, 30–57. [Google Scholar] [CrossRef] [Scilit]
- Kinuthia, U.M.; Wolf, A.; Langmann, T. Microglia and Inflammatory Responses in Diabetic Retinopathy. Front. Immunol. 2020, 11, 564077. [Google Scholar] [CrossRef] [Scilit]
- Yin, Y.J.; Zeng, S.L.; Li, Y.W.; Wu, Z.; Huang, D.J.; Tang, H.Z. The effect of coenzyme Q10 plus trimetazidine on acute viral myocarditis treatment. Am. J. Transl. Res. 2021, 13, 13854–13861. [Google Scholar]
- Ghasemi, H.; Ghazanfari, T.; Yaraee, R.; Faghihzadeh, S.; Hassan, Z.M. Roles of IL-8 in ocular inflammations: A review. Ocul. Immunol. Inflamm. 2011, 19, 401–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomes, C.; VanderWall, K.B.; Pan, Y.; Lu, X.; Lavekar, S.S.; Huang, K.C.; Fligor, C.M.; Harkin, J.; Zhang, C.; Cummins, T.R.; et al. Astrocytes modulate neurodegenerative phenotypes associated with glaucoma in OPTN(E50K) human stem cell-derived retinal ganglion cells. Stem Cell Rep. 2022, 17, 1636–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ulbrich, F.; Lerach, T.; Biermann, J.; Kaufmann, K.B.; Lagreze, W.A.; Buerkle, H.; Loop, T.; Goebel, U. Argon mediates protection by interleukin-8 suppression via a TLR2/TLR4/STAT3/NF-kappaB pathway in a model of apoptosis in neuroblastoma cells in vitro and following ischemia-reperfusion injury in rat retina in vivo. J. Neurochem. 2016, 138, 859–873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alcaraz, M.J.; Ferrandiz, M.L. Relevance of Nrf2 and heme oxygenase-1 in articular diseases. Free Radic. Biol. Med. 2020, 157, 83–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunn, L.L.; Midwinter, R.G.; Ni, J.; Hamid, H.A.; Parish, C.R.; Stocker, R. New insights into intracellular locations and functions of heme oxygenase-1. Antioxid. Redox Signal. 2014, 20, 1723–1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. Et Biophys. Acta. Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Himori, N.; Yamamoto, K.; Maruyama, K.; Ryu, M.; Taguchi, K.; Yamamoto, M.; Nakazawa, T. Critical role of Nrf2 in oxidative stress-induced retinal ganglion cell death. J. Neurochem. 2013, 127, 669–680. [Google Scholar] [CrossRef] [Scilit]
- Bruscolini, A.; Lambiase, A.; Segatto, M.; La Cava, M.; Nebbioso, M.; Sacchetti, M. Evaluation of IL8 pathway on the ocular surface: New insights in patients with ocular mucous membrane pemphigoid. Acta Ophthalmol. 2020, 98, e173–e177. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: A Key Modulator in Neurodegenerative Diseases. Molecules 2019, 24, 1583. [Google Scholar] [CrossRef] [Scilit]
- Somayajulu, M.; McCarthy, S.; Hung, M.; Sikorska, M.; Borowy-Borowski, H.; Pandey, S. Role of mitochondria in neuronal cell death induced by oxidative stress; neuroprotection by Coenzyme Q10. Neurobiol. Dis. 2005, 18, 618–627. [Google Scholar] [CrossRef] [Scilit]







| Primary Antibodies | Secondary Antibodies | |||||
|---|---|---|---|---|---|---|
| Antibody | Source | Company | Dilution | Antibody | Company | Dilution |
| Anti-Iba1 | Chicken | Synaptic Systems | 1:500 | Donkey anti-chicken Alexa Fluor 488 | Jackson Immuno Research | 1:500 |
| Anti-RBPMS | Rabbit | Millipore | 1:200 | Donkey anti-rabbit Alexa Fluor 555 | Invitrogen | 1:500 |
| Gene | Primer Fwd (5′-3′) Primer Rev (5′-3′) | GenBank Acc. No. | Amplicon Size |
|---|---|---|---|
| H3 | ACTGGCTACAAAAGCCGCTC | NM_213930.1 | 232 |
| ACTTGCCTCCTGCAAAGCAC | |||
| HMOX1 | GGCTGAGAATGCCGAGTTCA | NM_001004027.1 | 88 |
| GTGGTACAAGGACGCCATCA | |||
| IL6 | GCAGTCACAGAACGAGTGGA | NM_214399.1 | 84 |
| CTCAGGCTGAACTGCAGGAA | |||
| IL8 | TTCCAAACTGGCTGTTGCCT | M86923.1 | 178 |
| ACAGTGGGGTCCACTCTCAA | |||
| ITGAM | AGAAGGAGACACCCAGAGCA | XM_021086380.1 | 169 |
| GTAGGACAATGGGCGTCACT | |||
| NRF2 | GCCGACTATTCCCAGGTAGC | XM_003133500.6 | 713 |
| GTTGTGCTTTCACGGTGGTC | |||
| RBPMS | CGAGAAGGAGAACACCCCGAAC | XM_003133393.4 | 549 |
| CAAAAGACAGGTGTGTTGGGC | |||
| SOD1 | AAAACATGGTGGGCCAAAGG | NM_001190422.1 | 72 |
| CCATCTTTGCCAGCAGTCAC | |||
| SOD2 | CAGCTCGAGCAGGAATCTGG | NM_214127.2 | 87 |
| CCATAGTCGTACGGCAGGTC | |||
| TNF | GCCCTTCCACCAACGTTTTC | NM_214022.1 | 97 |
| CAAGGGCTCTTGATGGCAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deppe, L.; Mueller-Buehl, A.M.; Tsai, T.; Erb, C.; Dick, H.B.; Joachim, S.C. Protection against Oxidative Stress by Coenzyme Q10 in a Porcine Retinal Degeneration Model. J. Pers. Med. 2024, 14, 437. https://doi.org/10.3390/jpm14040437
Deppe L, Mueller-Buehl AM, Tsai T, Erb C, Dick HB, Joachim SC. Protection against Oxidative Stress by Coenzyme Q10 in a Porcine Retinal Degeneration Model. Journal of Personalized Medicine. 2024; 14(4):437. https://doi.org/10.3390/jpm14040437
Chicago/Turabian StyleDeppe, Leonie, Ana M. Mueller-Buehl, Teresa Tsai, Carl Erb, H. Burkhard Dick, and Stephanie C. Joachim. 2024. "Protection against Oxidative Stress by Coenzyme Q10 in a Porcine Retinal Degeneration Model" Journal of Personalized Medicine 14, no. 4: 437. https://doi.org/10.3390/jpm14040437
APA StyleDeppe, L., Mueller-Buehl, A. M., Tsai, T., Erb, C., Dick, H. B., & Joachim, S. C. (2024). Protection against Oxidative Stress by Coenzyme Q10 in a Porcine Retinal Degeneration Model. Journal of Personalized Medicine, 14(4), 437. https://doi.org/10.3390/jpm14040437

