Next Article in Journal
Unleashed Treasures of Solanaceae: Mechanistic Insights into Phytochemicals with Therapeutic Potential for Combatting Human Diseases
Next Article in Special Issue
Differentially Expressed Genes Identification of Kohlrabi Seedlings (Brassica oleracea var. caulorapa L.) under Polyethylene Glycol Osmotic Stress and AP2/ERF Transcription Factor Family Analysis
Previous Article in Journal
Analysis of the UDP-Glucosyltransferase (UGT) Gene Family and Its Functional Involvement in Drought and Salt Stress Tolerance in Phoebe bournei
Previous Article in Special Issue
Rapid Identification of High-Temperature Responsive Genes Using Large-Scale Yeast Functional Screening System in Potato
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato

1
State Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou 730070, China
2
College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, China
3
College of Agronomy, Gansu Agricultural University, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
Plants 2024, 13(5), 723; https://doi.org/10.3390/plants13050723
Submission received: 21 January 2024 / Revised: 23 February 2024 / Accepted: 27 February 2024 / Published: 4 March 2024

Abstract

:
MicroRNAs (miRNAs) are a class of endogenous, non-coding small-molecule RNAs that usually regulate the expression of target genes at the post-transcriptional level. miR156 is one of a class of evolutionarily highly conserved miRNA families. SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor is one of the target genes that is regulated by miR156. SPL transcription factors are involved in regulating plant growth and development, hormone response, stress response, and photosynthesis. In the present study, transgenic potato plants with overexpressed miR156 were obtained via the Agrobacterium-mediated transformation method. The results showed that the expression levels of the target gene, StSPL9, were all downregulated in the transgenic plants with overexpressed Stu-miR156. Compared with those of the control plants, the plant height and root length of the transgenic plants were significantly decreased, while the number of lateral roots was significantly increased. These results revealed that the miR156/SPLs module was involved in regulating potato plant height and root growth.

1. Introduction

MicroRNA is a type of endogenous non-coding single-stranded RNA, generally 20–24 nucleotides in length, which regulates gene expression at the post-transcriptional level through complementary pairing with the target gene mRNA [1]. miRNA was first discovered in Caenorhabditis elegans [2]. miRNAs in plants were first obtained from Arabidopsis small-molecule libraries [3]. A large number of plant miRNAs have been isolated in Arabidopsis [4], rice [5,6], maize [7], wheat [8], and potato [9], and more and more miRNAs have been identified in plants. In total, 38,589 miRNA precursor sequences and 48,885 mature sequences of 217 species were recorded in the miRNA database miRBase (http://mirbase.org/) (Release 22.1: October 2018).
The expression of miRNA is necessary for normal plant growth and development. miRNA is widely involved in plant growth and development, signal transduction, and stress response through negatively regulated transcription factors. Therefore, studying the target genes regulated by miRNA can better reveal the mechanism of miRNA in plant growth and development, and the plant response to stress. At present, the function of miRNAs is studied by increasing or decreasing the expression level of miRNAs in plants. The discovered miRNAs play an important role in the biosynthesis of many plants, and are involved in root [10], stem and leaf [11], and flower development [12], signal transduction, and stress response in different environments. For example, the expression of miR159 is regulated by gibberellin, the target gene of which has GAMYB-like transcription factors the activate the LEAYF gene in meristems of flower organs, thereby regulating flowering time and anther development in short-day plants [13]. miR160 negatively regulates ARF10, ARF16, and ARF17, which are involved in seed germination and post-embryonic development [14]. miR172 controls plant flowering time and floral organ development by regulating the tagged transcription factor targets of early activation (TOE1 and TOE2) [15]. miR164 regulates plant lateral organ development and nutrient organ growth by modulating the NAC family of transcription factors [16]. Overexpression of miR165 downregulates the target gene homeodomain–leucine zipper (HD-ZIP III), leading to leaf curling, infertility, and the inhibition of apical meristem growth in plants. The regulation of the HD-ZIP III gene by miR165/166 is mediated by tissue-specific expression and different cleavages of target mRNA [17]. In addition, the normal growth and development of plants cannot be separated from hormonal responses, and many signal transduction-related genes are regulated by miRNA. Therefore, miRNA plays important functions in responding to plant hormone response and signal transduction.
miR156 is one of the most abundant and evolutionarily conserved miRNA families in plants, and has 12 family members including miR156a, miR156b, miR156c, and others. Its main target gene is the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) gene [18]. Members of the SPL gene family have a conserved 76-amino-acid squamous promoter binding protein (SBP) domain, which is composed of a novel zinc finger with two zinc ion binding sites and can recognize GTAC as the core sequence DNA cis-element [19]. As a plant-specific family of transcription factors, SPL is involved in metabolic processes such as plant growth and development, hormone response, stress response, and photosynthesis. Research on a model plant found that the expression of plant SPL genes is regulated by miR156. For example, there are 19 SPL genes in rice, of which 11 are targeted by miR156. Studies on Arabidopsis have found that miR156 targets 11 of the 17 SPL genes [20]. According to their functions, they are divided into three categories: the first category has the members SPL2, SPL9, SPL10, SPL11, SPL13, and SPL15, which mainly regulate the transition from the seedling stage to the mature stage. Among them, SPL9 and SPL10 are involved in plant lateral root development, and they also directly bind the miR172b promoter to regulate miR172 expression. The second category of members, SPL3, SPL4, and SPL5, participate in the promotion of the flower meristem identification transition. The third-category member SPL6 may participate in regulating some physiological processes, but its exact function has not been fully elucidated [21]. Numerous studies have shown that miR156 is widely involved in the regulation of leaf shape, lateral root development, flowering time, and the response to drought and other stresses in different species such as Arabidopsis, rice, and tomato. Sneha Bhogale et al. (2014) found that overexpression of miR156 in potato not only regulated plants to produce more branches, leaves, and trichomes, but also delayed flowering or even led to non-flowering by regulating some members of the SPL family [22].
Lateral roots are the main components of plant roots, which have the function of absorbing and transporting nutrients and water, as well as the function of stabilizing plants. Recent studies have found that lateral root development is affected by phosphorus stress [23,24], ethylene [25,26], auxin [27], and strigolactone [28]. miR156 regulates the SPL gene to inhibit adventitious root development, and the number of adventitious roots declines as plants grow [22]. In Arabidopsis, it was found that SPL10 is involved in the inhibition of lateral root growth and development through the regulation of the AGAMOUS-like MADS-box protein 79 (AGL79) transcription factor, that the SPL10 gene and the AGL79 transcription factor were significantly downregulated in miR156-overexpressing plants, and that the transgenic plants produced more lateral roots [19]. Niu et al. [18] found that Arabidopsis miR156 is differentially expressed in specific cells and tissues of lateral roots, and regulates SPL3, SPL9, and SPL10 genes to inhibit lateral root growth by responding to the growth hormone signaling pathway.
Potato (Solanum tuberosum L.) is an important agricultural resource and material for many industrial processes worldwide. Drought and saline stress have severe effects on potato growth, yield, and quality. During long-term evolution, plants usually defend themselves against changes in the external environment by enhancing or reducing the expression of relevant genes. Since potato is an autotetraploid crop and reproduces asexually, genetic segregation is complex and highly susceptible to genetic homogeneity. Therefore, it is particularly important to genetically improve potato varieties and study the molecular mechanisms of growth, development, and stress resistance. Currently, it has been reported that miR156 and its target genes are indispensable throughout the plant life cycle. Numerous studies have shown that miR156 is most highly expressed in the seedling stage of plants, and is involved in regulating the transition from the seedling stage to the maturity, with a gradual decrease in expression. In addition, miR156 mainly regulates the target gene SPL, which is involved in the growth and development of plant leaves and lateral roots, flowering time and flower development, fruit development, and response to stress. Therefore, it is of great significance to study the functions of miR156 and the target gene SPL in the growth and development of potato to cultivate new potato varieties.
In the present research, based on the conserved miR156/SPL regulation module, artificial miRNA technology was used to construct the Stu-miR156 overexpression vector, and transgenic potato plants were obtained. The expression level of the Stu-miR156 target gene, StSPL9, was analyzed in different tissues of the transgenic and wild-type test tube seedlings, and the number of lateral roots and the length of the lateral roots in the transgenic plants were statistically analyzed to further elucidate the function of the Stu-miR156/StSPL9 module in regulating plant growth and development in the pot.

2. Results

2.1. Analysis of Stu-miR156 Secondary Structure and Target Gene

Using miRBase (http://www.mirbase.org/) (Release 22.1: October 2018) to predict the secondary structure of Stu-miR156, the mature sequence of miR156 was marked in red (Figure 1). The target gene online prediction software psRNATarget (http://www.zhaolab.org/psRNATarget/) (2017 Update) was used to analyze the binding site of Stu-miR156 to the target gene SPL9. The results showed that it was targeted to bind the SPL9 gene at 1296–1316 bp (Figure 1). We investigated whether or not the predicted target gene StSPL9 is degraded by miR159, and further validated this through transgenic methods.

2.2. Construction of Stu-miR156 Overexpression Vector

The plasmid pRS300 was used as a template to amplify the 5′ arm (fragment a), the central loop (fragment b), and the 3′ arm (fragment c), the lengths of which were 272, 171, and 298 bp, respectively, using overlapping PCR. The recovered products were used as templates. Primers A and B amplified fragment d, which was 701 bp in length (Figure 2).

2.3. Assay of the Putative Potato Transgenic Plants

The putative potato transgenic plants initially selected were tested via PCR to amplify the NPT II gene (Figure 3). The results showed that three transgenic lines amplified the target fragment (676 bp) measuring the expected size, and non-transgenic plants did not. The results preliminarily showed that the overexpression cassata of Stu-miR156 had been transformed into potato.

2.4. Analysis of miR156 and StSPL9 Expression via qRT-PCR

The transgenic and non-transgenic potato plants were cultured on MS media containing 2% sucrose for 3 weeks. qRT-PCR was performed to determine the relative expression levels of miR156 and its target gene StSPL9, and the correlation between the generation of lateral roots and their expression was further analyzed. The qRT-PCR results showed that miR156 expression in roots, stems, and leaves of the transgenic lines L1, L2, and L3 was upregulated by 2 to 4.4 times compared with that in the non-transgenic plants. Otherwise, the target gene StSPL9 was downregulated in roots, stems, and leaves of the transgenic lines L1, L2, and L3 by 2.9 to 1.6 times compared with that in the non-transgenic plants. Furthermore, the expression in roots was higher than that in stems and leaves (Figure 4). The results showed that the expression trend of Stu-miR156 and its target gene were opposite to each other, indicating that the StSPL9 gene was degraded by Stu-miR156, decreasing its expression level.

2.5. Effect of Stu-miR156 Overexpression on Potato Morphological Characters

To study the role of Stu-miR156 in regulating potato morphology, we analyzed the differences in plant height, lateral roots, fresh weight, and root:shoot ratio between the transgenic and non-transgenic plants. The results showed that the number of lateral roots of the transgenic lines with miR156 overexpression increased significantly by 2.8 to 3.6 times compared with that in the non-transgenic plant control, while the mean values of root length, plant height, fresh weight, and root:shoot ratio were all decreased, being 0.29, 0.62, 0.20, and 0.46 times those of WT plants, respectively (Table 1, Figure 5). It is indicated that after the overexpression of the miR156 gene, the growth of the plant is inhibited. It is speculated that the miR156/StSPL9 module plays an important regulatory role in potato development and growth.

3. Discussion

The root system is the basic organ of the plant and consists of the lateral roots and root hairs of the plant. Its growth is affected by plant hormones, transcription factors, and miRNAs [29]. MicroRNA is an important type of gene expression regulator, and plays a very important role in regulating plant morphogenesis and responding to biotic and abiotic stress [4]. Many miRNA target genes encode transcription factors. Therefore, miRNA target genes play an important role in regulating plant morphogenesis through protein–DNA and protein–protein interactions [30,31]. miR160, miR164, and miR165/miR166 all regulate the development of lateral roots through the auxin signaling pathway, nutritional homeostasis, and response to environmental stress [32,33,34]. miR156 is one of the most abundant and evolutionarily highly conserved miRNAs in plants. It is mainly expressed in plant seedlings. It is characterized by increased branching, accelerated leaf budding, and delayed flowering, and its expression level decreases with increasing seedling age [18]. The involvement of miR156 in plant root development has been reported, but there is no specific report on whether or not miRNA156 is involved in potato root development. Therefore, in this study, the precursor of the miR156 gene in potato was cloned from potato ‘Desiree’ as the experimental material (Figure 2), and bioinformatic analysis was carried out to conduct an in-depth study on its function. Many studies have shown that most SPL family genes in plants are the target genes of miR156, and the miR156/SPL regulatory mode has become the hub of regulating plant growth and development [35]. Most members of the SPL family in Arabidopsis [20], rice [36], and other plants have been confirmed to be the target genes of miR156. This study also predicted that the target gene of miR156 is SPL (Figure 1), indicating that miR156-mediated post-transcriptional regulation is conserved in plants. These results also indicate that miR156 is important in regulating the SPL family.
In recent years, with the in-depth study of miRNA, the enhancement and inhibition of target miRNA expression through synthetic mimics of mature miRNA and their inhibitors are gradually being applied; these mimics can effectively enhance and inhibit the expression of target genes, and thus play a role in regulating the level of related genes. This study identified miR156 and its target gene SPL9’s transcription factor in potato. Artificial microRNA technology was used to construct the Stu-miR156 overexpression vector, and transgenic plants with Stu-miR156 overexpression were obtained. The results showed that Stu-miR156 was expressed differently in different tissues (Figure 4), indicating that miR156 played different functions in different tissues of potato. The expression levels of the Stu-miR156 vector and StSPL9 target gene were analyzed in different tissues of the transgenic and wild-type test tube seedlings (Figure 4). The results showed that the expression trends of Stu-miR156 and its target gene were opposite to each other, indicating that the StSPL9 gene was degraded by Stu-miR156, decreasing its expression level. The expression of the Stu-miR156 target gene StSPL9 was downregulated in transgenic potato roots, stems, and leaves, indicating that Stu-miR156 and its target genes are widely involved in regulating plant morphology (Figure 5), which is consistent with the previous study [18]. miR156 is necessary and sufficient for juvenile expression, and it is suggested that it works by inhibiting the expression of SPL genes with different developmental functions [20,37]. In Arabidopsis, it was found that SPL9 is specifically expressed in the lateral root meristematic tissue region, whereas SPL10 is expressed at the lateral root initiation site and regulates the AGAMOUS-like MADS-box protein 79 (AGL79) transcription factor involved in the inhibition of lateral root growth and development. The SPL10 gene and AGL79 transcription factor were significantly downregulated in overexpressed miR156 plants, and transgenic plants produced more lateral roots [19]. The analysis of the number of lateral roots showed that the number of lateral roots of the transgenic plants with miR156 overexpression significantly increased, which indicated that the regulation mode of miR156/SPL is involved in regulating the development of lateral roots in potato. Studies have shown that over-expression of miR156a can lead to increased primary root growth and promote the development of lateral roots. SPL3, SPL9, and SPL10 positively regulate miR156 expression in plant lateral root development. The expression of transgenes SPL3, SPL9, and SPL10 against miR156 can affect leaf development in different ways [12]. SPL10 is highly expressed at the starting site of the lateral roots, while SPL9 is specifically expressed in the meristem region [18]. Gou et al. [38] revealed that miR156-targeted regulation of SPL9 prevents the expression of anthocyanin biosynthesis genes in Arabidopsis thaliana, thereby negatively regulating anthocyanin accumulation, revealing that SPL9 regulates the transition from the seedling to flowering stage in plants. In the experiment, the analysis of the root length and plant height of the transgenic plants showed that growth of the transgenic plants with miR156 overexpression was significantly inhibited, and root length and plant height were significantly decreased. Therefore, the regulation mode of Stu-miR156 targeting SPL transcription factors plays an important regulatory role in potato development and growth. This study lays the foundation for the further in-depth elucidation of the involvement of Stu-miR156 in the regulation of potato growth and development. Since one miRNA can degrade multiple target genes, and a target gene can also be degraded by multiple miRNAs, it is not a one-to-one relationship but involves complex network regulation. This study can only conclude that Stu-miR156 can degrade the StSPL9 gene and participate in plant growth and development. Further research is needed to determine whether or not and which other genes co-regulate this phenotype.

4. Materials and Methods

4.1. Plant Materials

Potato (Solanum tuberosum L.) cultivar ‘Desiree’ was used as an experimental material. The potato plantlets were propagated on MS media containing 2% sucrose and 0.45% agar, and cultured under a 16/8 h light/dark cycle at a temperature of 25 ± 2 °C.

4.2. Bioinformatics and Software

The Stu-miR156 mature sequence and its secondary structure were obtained from the miRNA miRbase (http://www.mirbase.org/) (Release 22.1: October 2018). Using the WMD3 website (http://wmd3.weigelworld.org/) and inputting the mature sequence of Stu-miR156 on the Oligo page, primers I, II, III, IV, A, and B were designed for its cloning. The target gene of Stu-miR156 was predicted using online prediction software (http://www.zhaolab.org/psRNATarget/ (2017 Update), and the mature body sequence of Stu-miR156 was input in the ‘Submit small RNAs’ page for prediction.

4.3. Amplification of miR156 Precursor Fragment and Construction of Cloning Vector

Plasmid pRS300 was used as a template, and 20 nucleotides of endogenous miRNA319a in plasmid pRS300 were replaced with Stu-miR156 mature sequences using overlapping PCR. The 5′ arm (fragment a), the central loop (fragment b), and the 3′ arm (fragment c) were amplified. Products a, b, and c were purified and recovered via 2% agarose gel electrophoresis. Fragments a, b, and c were used as templates, and fragment d was amplified using A and B primers (Table 2, Figure 6). Fragment d was ligated into the pMD18-T vector, sequenced, and named pMD-amiR156.

4.4. Construction of Plant Expression Vector

The cloning plasmid pMD-amiR156 and expression vector pCPB121 were digested using double-restriction endonucleases Sac I and Kpn I, respectively. The abovementioned digested products were electrophoresed on 2% agarose gel to recover the target fragments, which were ligated with T4 DNA ligase at 16 °C for 30 min, and then transformed into Escherichia coli competent cells. The positive clones were selected for the extraction of the plasmid, and Sac I and Kpn I were used for double-enzyme digestion verification. The constructed expression vector was named pCPB121-miR156 and then transferred into Agrobacterium tumefaciens LBA4404 competent cells for the genetic transformation of potato.

4.5. Potato Transformation and Identification of the Transgenic Plants

The following method was used for Agrobacterium-mediated potato transformation [34]. Three-week-old potato in vitro plantlets were cut into 1 cm stem segments, which were infected with Agrobacterium (OD600 = 0.5) for 7 min, and the excess bacterial solution was blotted dry with sterile filter paper and then put into 1/2 MS solid media to be cultivated at 25 °C for 48 h in the dark. After co-cultivation, we transferred the stems into callus media (1/2 MS + 5 mg/L NAA + 0.1 mg/L 6-BA+ 0.05 mg/mL kanamycin) and cultured them at 23 °C under a 2000 lx light intensity for 7 days, then transferred them into differentiation media (1/2 MS + 20 μg/L GA3 + 20 μg/L NAA + 2 mg/L zeatin + 0.05 mg/mL kanamycin), replacing them with new media every 10 days until new shoots grew from the stem segment; then, they were put into the rooting media (MS + 75 mg/L kanamycin + 200 mg/L carbenicillin) for screening. After about 2 weeks, the rooted shoots were identified as putative transgenic plantlets for further identification. The hexadecyl trimethyl ammonium bromide (CTAB) method was used to extract the genomic DNA of the putative transgenic plants and of the non-transgenic plants as a negative control. The identification of the transgenic plants was performed using the neomycin phosphate transferase (NPT II) gene of a pair of primers (Table 3), and the expected fragment size was 676 bp. The PCR reaction conditions were as follows: incubation at 94 °C for 3 min, followed by 35 cycles of 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 60 s, anfinally extended to 72 °C for 10 min. The PCR products were separated via 1% agarose gel electrophoresis.

4.6. Analysis of the Transgenic Potato Plants via qRT-PCR

Roots, leaves, and stems of the 3-week-old non-transgenic plants and transgenic plants were collected and placed in liquid nitrogen for quick freezing. Plant total RNA was extracted using the AG RNAex Pro RNA extraction kit (AG21101). The cDNA used for the expression analysis of miR156 was synthesized via reverse transcription using the One Step PrimeScript1 miRNA cDNA synthesis kit (TaKaRa), and the 18S rRNA of potato was used as a reference gene. The Evo M-MLV reverse transcription kit (AG11705-S) was used for the quantification of target genes, and the ef1a gene was the internal reference gene (Table 3). The expression of the target gene was assayed using SYBR®Premix Ex TaqTMII (TaKaRa). The PCR reaction conditions were as follows: 95 °C for 10 min; 95 °C for 15 s; 60 °C for 1 min; and 72 °C for 30 s for 40 cycles. The calculation formula was as follows: RQ (relative expression) = 2−∆∆Ct, ∆∆Ct = (∆Ct transgenic − ∆Ct ef1a) − (∆Ct non-transgenic − ∆Ct ef1a). All samples were analyzed in three biological replicates and three technical replicates. Statistical software SPSS 13.0 was used to analyze the differences in the expressions of the transgenic plants. Data were statistically analyzed via one-way ANOVA and Dunnett’s post hoc test.

4.7. Morphological Assay of the Transgenic Potato Plants

The transgenic and non-transgenic potato plants were propagated by sub-culturing them on MS media containing 2% sucrose and culturing them under a 16/8 h light/dark cycle at a temperature of 25 ± 2 °C for two weeks. The following indicators were measured using a spiral micrometer: plant height, root length, and root to shoot ratio. The fresh weight of the plants was weighed using an electronic balance. The experiments were conducted in three biological replicates. Significant differences were assayed using Duncan’s multiple-range test at the 5% probability level.

5. Conclusions

The SPL transcription factor is one of the target genes that is regulated by miR156. In this study, the expression levels of the target gene StSPL9 were downregulated in the transgenic plants with overexpressed Stu-miR156. The plant height and root length of the transgenic plants were significantly decreased compared with those of the control plants, while the number of lateral roots were significantly increased. In conclusion, the miR156/SPLs module was involved in regulating the plant height and root growth of potato.

Author Contributions

H.L., N.Z. and H.S. designed the experiments; H.L., J.Y., S.L. (Shengyan Liu) and S.L. (Shigui Li) performed the experiments; H.L. was responsible for writing—original draft preparation; N.Z. and H.S. took part in writing—review and editing; N.Z. supervised the study; N.Z. and H.S acquired funding. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (No. 2022YFD1602103), the Gansu Science and Technology Major Project (No. 23ZDNA006), and the Key Program of Natural Science Foundation of Gansu Province (No. 22JR5RA832).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [PubMed]
  2. Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef]
  3. Reinhart, B.J.; Weinstein, E.G.; Rhoades, M.W.; Bartel, B.; Bartel, D.P. MicroRNAs in plants. Gene Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [PubMed]
  4. Sunkar, R.; Zhu, J.K. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 2004, 16, 2001–2019. [Google Scholar] [CrossRef]
  5. Li, Y.F.; Zheng, Y.; Addo-Quaye, C.; Zhang, L.; Saini, A.; Jagadeeswaran, G.; Axtell, M.J.; Zhang, W.; Sunkar, R. Transcriptome-wide identification of microRNA targets in rice. Plant J. 2010, 62, 742–759. [Google Scholar] [CrossRef]
  6. Jiao, Y.; Wang, Y.; Xue, D.; Wang, J.; Yan, M.; Liu, G.; Dong, G.; Zeng, D.; Lu, Z.; Zhu, X.; et al. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 2010, 42, 541–544. [Google Scholar] [CrossRef]
  7. Xu, Z.; Zhong, S.; Li, X.; Li, W.; Rothstein, S.J.; Zhang, S.; Bi, Y.; Xie, C. Genome-wide identification of microRNAs in response to low nitrate availability in maize leaves and roots. PLoS ONE 2011, 6, e28009. [Google Scholar] [CrossRef]
  8. Yao, Y.; Guo, G.; Ni, Z.; Sunkar, R.; Du, J.; Zhu, J.K.; Sun, Q. Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 2007, 8, R96. [Google Scholar] [CrossRef]
  9. Zhang, W.; Luo, Y.; Gong, X.; Zeng, W.; Li, S. Computational identification of 48 potato microRNAs and their targets. Comput. Biol. Chem. 2009, 33, 84–93. [Google Scholar] [CrossRef]
  10. Zhang, L.; Yao, L.; Zhang, N.; Yang, J.; Zhu, X.; Tang, X.; Calderón-Urrea, A.; Si, H. Lateral root development in potato is mediated by stu-mi164 regulation of NAC transcription factor. Front. Plant Sci. 2018, 9, 383. [Google Scholar] [CrossRef] [PubMed]
  11. Palatnik, J.F.; Allen, E.; Wu, X.; Schommer, C.; Schwab, R.; Carrington, J.C.; Weigel, D. Control of leaf morphogenesis by microRNAs. Nature 2003, 425, 257–263. [Google Scholar] [CrossRef] [PubMed]
  12. Wu, G.; Park, M.Y.; Conway, S.R.; Wang, J.W.; Weigel, D.; Poethig, R.S. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 2009, 138, 750–759. [Google Scholar] [CrossRef]
  13. Reyes, J.L.; Chua, N.H. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 2007, 49, 592–606. [Google Scholar] [CrossRef]
  14. Liu, P.P.; Montgomery, T.A.; Fahlgren, N.; Kasschau, K.D.; Nonogaki, H.; Carrington, J.C. Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. Plant J. 2007, 52, 133–146. [Google Scholar] [CrossRef]
  15. Mathieu, J.; Yant, L.J.; Mürdter, F.; Küttner, F.; Schmid, M. Repression of flowering by the miR172 target SMZ. PLoS Biol. 2009, 7, e1000148. [Google Scholar] [CrossRef]
  16. Mallory, A.C.; Dugas, D.V.; Bartel, D.P.; Bartel, B. MicroRNA regulation of NAC-domain targets is required for proper formation and separation of adjacent embryonic, vegetative, and floral organs. Curr. Biol. 2004, 14, 1035–1046. [Google Scholar] [CrossRef] [PubMed]
  17. Zhong, R.; Ye, Z.H. Regulation of HD-ZIP III genes by microRNA 165. Plant Signal. Behav. 2007, 2, 351–353. [Google Scholar] [CrossRef]
  18. Yu, N.; Niu, Q.W.; Ng, K.H.; Chua, N.H. The role of miR156/SPLs modules in Arabidopsis lateral root development. Plant J. 2015, 83, 673–685. [Google Scholar] [CrossRef] [PubMed]
  19. Gao, R.; Wang, Y.; Gruber, M.Y.; Hannoufa, A. miR156/SPL10 modulates lateral root development, branching and leaf morphology in Arabidopsis by silencing AGAMOUS-LIKE 79. Front. Plant Sci. 2018, 8, 2226. [Google Scholar] [CrossRef] [PubMed]
  20. Gandikota, M.; Birkenbihl, R.P.; Höhmann, S.; Cardon, G.H.; Saedler, H.; Huijser, P. The miRNA156/157 recognition element in the 3′ UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J. 2007, 49, 683–693. [Google Scholar] [CrossRef]
  21. Xu, M.; Hu, T.; Zhao, J.; Park, M.Y.; Earley, K.W.; Wu, G.; Yang, L.; Poethig, R.S. Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thaliana. PLoS Genet. 2016, 12, e1006263. [Google Scholar] [CrossRef]
  22. Bhogale, S.; Mahajan, A.S.; Natarajan, B.; Rajabhoj, M.; Thulasiram, H.V.; Banerjee, A.K. MicroRNA156: A potential graft-transmissible microRNA that modulates plant architecture and tuberization in Solanum tuberosum ssp. andigena. Plant Physiol. 2014, 164, 1011–1027. [Google Scholar] [CrossRef] [PubMed]
  23. Li, Z.; Xu, C.; Li, K.; Yan, S.; Qu, X.; Zhang, J. Phosphate starvation of maize inhibits lateral root formation and alters gene expression in the lateral root primordium zone. BMC Plant Biol. 2012, 12, 89. [Google Scholar] [CrossRef] [PubMed]
  24. Niu, Y.F.; Chai, R.S.; Jin, G.L.; Wang, H.; Tang, C.X.; Zhang, Y.S. Responses of root architecture development to low phosphorus availability: A review. Ann. Bot. 2013, 112, 391–408. [Google Scholar] [CrossRef] [PubMed]
  25. Lewis, D.R.; Negi, S.; Sukumar, P.; Muday, G.K. Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 2011, 138, 3485–3495. [Google Scholar] [CrossRef]
  26. Negi, S.; Ivanchenko, M.G.; Muday, G.K. Ethylene regulates lateral root formation and auxin transport in Arabidopsis thaliana. Plant J. 2008, 55, 175–187. [Google Scholar] [CrossRef]
  27. Fukaki, H.; Tameda, S.; Masuda, H.; Tasaka, M. Lateral root formation is blocked by a gain-of-function mutation in the solitary-root/IAA 14 gene of Arabidopsis. Plant J. 2002, 29, 153–168. [Google Scholar] [CrossRef]
  28. Jiang, L.; Matthys, C.; Marquez-Garcia, B.; De Cuyper, C.; Smet, L.; De Keyser, A.; Boyer, F.D.; Beeckman, T.; Depuydt, S.; Goormachtig, S. Strigolactones spatially influence lateral root development through the cytokinin signaling network. J. Exp. Bot. 2016, 67, 379–389. [Google Scholar] [CrossRef]
  29. Barrera-Rojas, C.H.; Rocha, G.H.B.; Polverari, L.; Pinheiro Brito, D.A.; Batista, D.S.; Notini, M.M.; Cruz, A.C.F.D.; Morea, E.G.O.; Sabatini, S.; Otoni, W.C.; et al. miR156-targeted SPL10 controls Arabidopsis root meristem activity and root-derived de novo shoot regeneration via cytokinin responses. J. Exp. Bot. 2020, 71, 934–950. [Google Scholar] [CrossRef]
  30. Bartel, B.; Bartel, D.P. MicroRNAs: At the root of plant development? Plant Physiol. 2003, 132, 709–717. [Google Scholar] [CrossRef]
  31. Jones-Rhoades, M.W.; Bartel, D.P.; Bartel, B. MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 2006, 57, 19–53. [Google Scholar] [CrossRef] [PubMed]
  32. Guo, H.S.; Xie, Q.; Fei, J.F.; Chua, N.H. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell 2005, 17, 1376–1386. [Google Scholar] [CrossRef] [PubMed]
  33. Kinoshita, N.; Wang, H.; Kasahara, H.; Liu, J.; MacPherson, C.; Machida, Y.; Kamiya, Y.; Hannah, M.A.; Chua, N.H. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress. Plant Cell 2012, 24, 3590–3602. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, J.W.; Wang, L.J.; Mao, Y.B.; Cai, W.J.; Xue, H.W.; Chen, X.Y. Control of root cap formation by microRNA-targeted auxin response factors in Arabidopsis. Plant Cell. 2005, 17, 2204–2216. [Google Scholar] [CrossRef]
  35. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
  36. Xie, K.; Wu, C.; Xiong, L. Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiol. 2006, 142, 280–293. [Google Scholar] [CrossRef]
  37. Usami, T.; Horiguchi, G.; Yano, S.; Tsukaya, H. The more and smaller cells mutants of Arabidopsis thaliana identify novel roles for SQUAMOSA PROMOTER BINDING PROTEIN-LIKE genes in the control of heteroblasty. Development 2009, 136, 955–964. [Google Scholar] [CrossRef]
  38. Gou, J.Y.; Felippes, F.F.; Liu, C.J.; Weigel, D.; Wang, J.W. Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell 2011, 23, 1512–1522. [Google Scholar] [CrossRef]
Figure 1. Predicted hairpin secondary structure of Stu-miR156 and its binding site for the target gene SPL9. (a) Hairpin secondary structures of Stu-miR156 in potato. Mature miRNA sequences are in red. (b) Analysis of the binding site of Stu-miR156 for the target gene SPL9. Target gene binding site from 1296 to 1316 nucleotides.
Figure 1. Predicted hairpin secondary structure of Stu-miR156 and its binding site for the target gene SPL9. (a) Hairpin secondary structures of Stu-miR156 in potato. Mature miRNA sequences are in red. (b) Analysis of the binding site of Stu-miR156 for the target gene SPL9. Target gene binding site from 1296 to 1316 nucleotides.
Plants 13 00723 g001
Figure 2. PCR product of amiRNA156 precursor fragment. (a) Amplification of a, b, and c fragments; (b) amplification of d fragment. M: DL2000 marker (Tiangen Biotech, Beijing, China).
Figure 2. PCR product of amiRNA156 precursor fragment. (a) Amplification of a, b, and c fragments; (b) amplification of d fragment. M: DL2000 marker (Tiangen Biotech, Beijing, China).
Plants 13 00723 g002
Figure 3. PCR detection of NPT II gene in the transgenic plants. M: DL2000 marker (Tiangen Biotech, Beijing, China). 1. Vector plasmid. 2. Non-transgenic plants. 3–5. Transgenic plant lines.
Figure 3. PCR detection of NPT II gene in the transgenic plants. M: DL2000 marker (Tiangen Biotech, Beijing, China). 1. Vector plasmid. 2. Non-transgenic plants. 3–5. Transgenic plant lines.
Plants 13 00723 g003
Figure 4. Expressional levels of Stu-miR156 and its target gene StSPL9 in the transgenic and non-transgenic potato plants. (a) qRT-PCR analysis of Stu-miR156. (b) qRT-PCR analysis of StSPL9. CK. The non-transgenic potato as a negative control. L1–L3. The transgenic potato plant lines transformed with the vector pCPB121-miR156. Data are presented as a mean ± SD (three biological replicates). The asterisks represent significant differences compared with the control (** p < 0.01).
Figure 4. Expressional levels of Stu-miR156 and its target gene StSPL9 in the transgenic and non-transgenic potato plants. (a) qRT-PCR analysis of Stu-miR156. (b) qRT-PCR analysis of StSPL9. CK. The non-transgenic potato as a negative control. L1–L3. The transgenic potato plant lines transformed with the vector pCPB121-miR156. Data are presented as a mean ± SD (three biological replicates). The asterisks represent significant differences compared with the control (** p < 0.01).
Plants 13 00723 g004
Figure 5. The phenotypic characteristics of the transgenic potato plants. CK. The non-transgenic potato plant as a negative control. L1–L3. The transgenic potato plant lines. The scale bars represent 2 cm.
Figure 5. The phenotypic characteristics of the transgenic potato plants. CK. The non-transgenic potato plant as a negative control. L1–L3. The transgenic potato plant lines. The scale bars represent 2 cm.
Plants 13 00723 g005
Figure 6. Amplification of miR156 precursor fragment and construction of cloning vector. (a) Schematic diagram of plasmid pRS300, which contains the endogenous Arabidopsis miR319a precursor in a pBluescript SK backbone and does not contain any promoter. This only serves as a template for PCR directed mutagenesis using oligonucleotides that can be obtained from the WMD webpage (http://wmd2.weigelworld.org) and accessed on 18 August 2019. (b) Amplification diagram of precursor sequences of amiRNAs using overlapping PCR. I. miRNA forward primer; II. miRNA reverse primer; III. miRNA* forward primer; IV. miRNA* reverse primer. Oligos I, II, III and IV were replaced with the corresponding amiRNA by the miR319a sequence. “miR*” represents the known miRNA, and “amiR*” represents the corresponding artificially designed miRNA.
Figure 6. Amplification of miR156 precursor fragment and construction of cloning vector. (a) Schematic diagram of plasmid pRS300, which contains the endogenous Arabidopsis miR319a precursor in a pBluescript SK backbone and does not contain any promoter. This only serves as a template for PCR directed mutagenesis using oligonucleotides that can be obtained from the WMD webpage (http://wmd2.weigelworld.org) and accessed on 18 August 2019. (b) Amplification diagram of precursor sequences of amiRNAs using overlapping PCR. I. miRNA forward primer; II. miRNA reverse primer; III. miRNA* forward primer; IV. miRNA* reverse primer. Oligos I, II, III and IV were replaced with the corresponding amiRNA by the miR319a sequence. “miR*” represents the known miRNA, and “amiR*” represents the corresponding artificially designed miRNA.
Plants 13 00723 g006
Table 1. Phenotypic assay of the transgenic plants.
Table 1. Phenotypic assay of the transgenic plants.
Plant LinesPlant Height (mm)Root NumberRoot Length (mm)Fresh Weight (g)Root-Shoot Ratio (%)
CK82.74 ± 2.88 a10.67 ± 1.70 b59.38 ± 5.55 a0.48 ± 0.05 a72.09 ± 0.09 a
L153.00 ± 2.17 b31.33 ± 5.73 a18.33 ± 1.32 b0.10 ± 0.02 b34.73 ± 0.04 b
L245.33 ± 7.95 b29.67 ± 2.87 a13.99 ± 3.14 b0.07 ± 0.03 b30.75 ± 0.03 b
L355.51 ± 10.11 b38.33 ± 6.94 a19.16 ± 6.52 b0.11 ± 0.03 b34.51 ± 0.05 b
Note: Different letters represent significant differences (p < 0.05).
Table 2. Overlapping PCR to construct a PCR amplification system for amiRNA156.
Table 2. Overlapping PCR to construct a PCR amplification system for amiRNA156.
PCR ReactionForward PrimerReverse PrimerTemplateProduct Length (bp)
aAIVpRS300272
bIIIIIpRS300171
cIBpRS300298
dABa + b + c701
Note: Reaction b is most likely to be difficult, since less than half of the nucleotides in the oligos are complementary to the template plasmid. The reaction can be improved by increasing the cycle number (we used up to 40 cycles without a dramatic rise in PCR-induced mutations).
Table 3. Primer sequences.
Table 3. Primer sequences.
Primer NamePrimer Sequences (5′→3′)
ACTGCAAGGCGATTAAGTTGGGTAAC
BGCGGATAACAATTTCACACAGGAAACAG
IGATTGACAGAAGATAGAGAGCACTCTCTCTTTTGTATTCC
IIGAGTGCTCTCTATCTTCTGTCAATCAAAGAGAATCAATGA
IIIGAGTACTCTCTATCTACTGTCATTCACAGGTCGTGATATG
IVGAATGACAGTAGATAGAGAGTACTCTACATATATATTCCT
NPT II-FGCTATGACTGGGCACAACAG
NPT II-RATACCGTAAAGCACGAGGAA
SPL9-FCCTACTGTTGTTGTTGCTGG
SPL9-RCCTACGACGCTCATTATGG
Stu-miR156TTGACAGAAGATAGAGAGCAC
St18S RNATTAGAGGAAGGAGAAGTCGTAACAA
ef1a-FCAAGGATGACCCAGCCAAG
ef1a-RTTCCTTACCTGAACGCCTGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Luo, H.; Yang, J.; Liu, S.; Li, S.; Si, H.; Zhang, N. Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato. Plants 2024, 13, 723. https://doi.org/10.3390/plants13050723

AMA Style

Luo H, Yang J, Liu S, Li S, Si H, Zhang N. Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato. Plants. 2024; 13(5):723. https://doi.org/10.3390/plants13050723

Chicago/Turabian Style

Luo, Hongyu, Jiangwei Yang, Shengyan Liu, Shigui Li, Huaijun Si, and Ning Zhang. 2024. "Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato" Plants 13, no. 5: 723. https://doi.org/10.3390/plants13050723

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop