Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato
Abstract
:1. Introduction
2. Results
2.1. Analysis of Stu-miR156 Secondary Structure and Target Gene
2.2. Construction of Stu-miR156 Overexpression Vector
2.3. Assay of the Putative Potato Transgenic Plants
2.4. Analysis of miR156 and StSPL9 Expression via qRT-PCR
2.5. Effect of Stu-miR156 Overexpression on Potato Morphological Characters
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Bioinformatics and Software
4.3. Amplification of miR156 Precursor Fragment and Construction of Cloning Vector
4.4. Construction of Plant Expression Vector
4.5. Potato Transformation and Identification of the Transgenic Plants
4.6. Analysis of the Transgenic Potato Plants via qRT-PCR
4.7. Morphological Assay of the Transgenic Potato Plants
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [PubMed]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef]
- Reinhart, B.J.; Weinstein, E.G.; Rhoades, M.W.; Bartel, B.; Bartel, D.P. MicroRNAs in plants. Gene Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [PubMed]
- Sunkar, R.; Zhu, J.K. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 2004, 16, 2001–2019. [Google Scholar] [CrossRef]
- Li, Y.F.; Zheng, Y.; Addo-Quaye, C.; Zhang, L.; Saini, A.; Jagadeeswaran, G.; Axtell, M.J.; Zhang, W.; Sunkar, R. Transcriptome-wide identification of microRNA targets in rice. Plant J. 2010, 62, 742–759. [Google Scholar] [CrossRef]
- Jiao, Y.; Wang, Y.; Xue, D.; Wang, J.; Yan, M.; Liu, G.; Dong, G.; Zeng, D.; Lu, Z.; Zhu, X.; et al. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 2010, 42, 541–544. [Google Scholar] [CrossRef]
- Xu, Z.; Zhong, S.; Li, X.; Li, W.; Rothstein, S.J.; Zhang, S.; Bi, Y.; Xie, C. Genome-wide identification of microRNAs in response to low nitrate availability in maize leaves and roots. PLoS ONE 2011, 6, e28009. [Google Scholar] [CrossRef]
- Yao, Y.; Guo, G.; Ni, Z.; Sunkar, R.; Du, J.; Zhu, J.K.; Sun, Q. Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biol. 2007, 8, R96. [Google Scholar] [CrossRef]
- Zhang, W.; Luo, Y.; Gong, X.; Zeng, W.; Li, S. Computational identification of 48 potato microRNAs and their targets. Comput. Biol. Chem. 2009, 33, 84–93. [Google Scholar] [CrossRef]
- Zhang, L.; Yao, L.; Zhang, N.; Yang, J.; Zhu, X.; Tang, X.; Calderón-Urrea, A.; Si, H. Lateral root development in potato is mediated by stu-mi164 regulation of NAC transcription factor. Front. Plant Sci. 2018, 9, 383. [Google Scholar] [CrossRef] [PubMed]
- Palatnik, J.F.; Allen, E.; Wu, X.; Schommer, C.; Schwab, R.; Carrington, J.C.; Weigel, D. Control of leaf morphogenesis by microRNAs. Nature 2003, 425, 257–263. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Park, M.Y.; Conway, S.R.; Wang, J.W.; Weigel, D.; Poethig, R.S. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 2009, 138, 750–759. [Google Scholar] [CrossRef]
- Reyes, J.L.; Chua, N.H. ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. Plant J. 2007, 49, 592–606. [Google Scholar] [CrossRef]
- Liu, P.P.; Montgomery, T.A.; Fahlgren, N.; Kasschau, K.D.; Nonogaki, H.; Carrington, J.C. Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. Plant J. 2007, 52, 133–146. [Google Scholar] [CrossRef]
- Mathieu, J.; Yant, L.J.; Mürdter, F.; Küttner, F.; Schmid, M. Repression of flowering by the miR172 target SMZ. PLoS Biol. 2009, 7, e1000148. [Google Scholar] [CrossRef]
- Mallory, A.C.; Dugas, D.V.; Bartel, D.P.; Bartel, B. MicroRNA regulation of NAC-domain targets is required for proper formation and separation of adjacent embryonic, vegetative, and floral organs. Curr. Biol. 2004, 14, 1035–1046. [Google Scholar] [CrossRef] [PubMed]
- Zhong, R.; Ye, Z.H. Regulation of HD-ZIP III genes by microRNA 165. Plant Signal. Behav. 2007, 2, 351–353. [Google Scholar] [CrossRef]
- Yu, N.; Niu, Q.W.; Ng, K.H.; Chua, N.H. The role of miR156/SPLs modules in Arabidopsis lateral root development. Plant J. 2015, 83, 673–685. [Google Scholar] [CrossRef] [PubMed]
- Gao, R.; Wang, Y.; Gruber, M.Y.; Hannoufa, A. miR156/SPL10 modulates lateral root development, branching and leaf morphology in Arabidopsis by silencing AGAMOUS-LIKE 79. Front. Plant Sci. 2018, 8, 2226. [Google Scholar] [CrossRef] [PubMed]
- Gandikota, M.; Birkenbihl, R.P.; Höhmann, S.; Cardon, G.H.; Saedler, H.; Huijser, P. The miRNA156/157 recognition element in the 3′ UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J. 2007, 49, 683–693. [Google Scholar] [CrossRef]
- Xu, M.; Hu, T.; Zhao, J.; Park, M.Y.; Earley, K.W.; Wu, G.; Yang, L.; Poethig, R.S. Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thaliana. PLoS Genet. 2016, 12, e1006263. [Google Scholar] [CrossRef]
- Bhogale, S.; Mahajan, A.S.; Natarajan, B.; Rajabhoj, M.; Thulasiram, H.V.; Banerjee, A.K. MicroRNA156: A potential graft-transmissible microRNA that modulates plant architecture and tuberization in Solanum tuberosum ssp. andigena. Plant Physiol. 2014, 164, 1011–1027. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Xu, C.; Li, K.; Yan, S.; Qu, X.; Zhang, J. Phosphate starvation of maize inhibits lateral root formation and alters gene expression in the lateral root primordium zone. BMC Plant Biol. 2012, 12, 89. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.F.; Chai, R.S.; Jin, G.L.; Wang, H.; Tang, C.X.; Zhang, Y.S. Responses of root architecture development to low phosphorus availability: A review. Ann. Bot. 2013, 112, 391–408. [Google Scholar] [CrossRef] [PubMed]
- Lewis, D.R.; Negi, S.; Sukumar, P.; Muday, G.K. Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 2011, 138, 3485–3495. [Google Scholar] [CrossRef]
- Negi, S.; Ivanchenko, M.G.; Muday, G.K. Ethylene regulates lateral root formation and auxin transport in Arabidopsis thaliana. Plant J. 2008, 55, 175–187. [Google Scholar] [CrossRef]
- Fukaki, H.; Tameda, S.; Masuda, H.; Tasaka, M. Lateral root formation is blocked by a gain-of-function mutation in the solitary-root/IAA 14 gene of Arabidopsis. Plant J. 2002, 29, 153–168. [Google Scholar] [CrossRef]
- Jiang, L.; Matthys, C.; Marquez-Garcia, B.; De Cuyper, C.; Smet, L.; De Keyser, A.; Boyer, F.D.; Beeckman, T.; Depuydt, S.; Goormachtig, S. Strigolactones spatially influence lateral root development through the cytokinin signaling network. J. Exp. Bot. 2016, 67, 379–389. [Google Scholar] [CrossRef]
- Barrera-Rojas, C.H.; Rocha, G.H.B.; Polverari, L.; Pinheiro Brito, D.A.; Batista, D.S.; Notini, M.M.; Cruz, A.C.F.D.; Morea, E.G.O.; Sabatini, S.; Otoni, W.C.; et al. miR156-targeted SPL10 controls Arabidopsis root meristem activity and root-derived de novo shoot regeneration via cytokinin responses. J. Exp. Bot. 2020, 71, 934–950. [Google Scholar] [CrossRef]
- Bartel, B.; Bartel, D.P. MicroRNAs: At the root of plant development? Plant Physiol. 2003, 132, 709–717. [Google Scholar] [CrossRef]
- Jones-Rhoades, M.W.; Bartel, D.P.; Bartel, B. MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 2006, 57, 19–53. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.S.; Xie, Q.; Fei, J.F.; Chua, N.H. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell 2005, 17, 1376–1386. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, N.; Wang, H.; Kasahara, H.; Liu, J.; MacPherson, C.; Machida, Y.; Kamiya, Y.; Hannah, M.A.; Chua, N.H. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress. Plant Cell 2012, 24, 3590–3602. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.W.; Wang, L.J.; Mao, Y.B.; Cai, W.J.; Xue, H.W.; Chen, X.Y. Control of root cap formation by microRNA-targeted auxin response factors in Arabidopsis. Plant Cell. 2005, 17, 2204–2216. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
- Xie, K.; Wu, C.; Xiong, L. Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiol. 2006, 142, 280–293. [Google Scholar] [CrossRef]
- Usami, T.; Horiguchi, G.; Yano, S.; Tsukaya, H. The more and smaller cells mutants of Arabidopsis thaliana identify novel roles for SQUAMOSA PROMOTER BINDING PROTEIN-LIKE genes in the control of heteroblasty. Development 2009, 136, 955–964. [Google Scholar] [CrossRef]
- Gou, J.Y.; Felippes, F.F.; Liu, C.J.; Weigel, D.; Wang, J.W. Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell 2011, 23, 1512–1522. [Google Scholar] [CrossRef]
Plant Lines | Plant Height (mm) | Root Number | Root Length (mm) | Fresh Weight (g) | Root-Shoot Ratio (%) |
---|---|---|---|---|---|
CK | 82.74 ± 2.88 a | 10.67 ± 1.70 b | 59.38 ± 5.55 a | 0.48 ± 0.05 a | 72.09 ± 0.09 a |
L1 | 53.00 ± 2.17 b | 31.33 ± 5.73 a | 18.33 ± 1.32 b | 0.10 ± 0.02 b | 34.73 ± 0.04 b |
L2 | 45.33 ± 7.95 b | 29.67 ± 2.87 a | 13.99 ± 3.14 b | 0.07 ± 0.03 b | 30.75 ± 0.03 b |
L3 | 55.51 ± 10.11 b | 38.33 ± 6.94 a | 19.16 ± 6.52 b | 0.11 ± 0.03 b | 34.51 ± 0.05 b |
PCR Reaction | Forward Primer | Reverse Primer | Template | Product Length (bp) |
---|---|---|---|---|
a | A | IV | pRS300 | 272 |
b | III | II | pRS300 | 171 |
c | I | B | pRS300 | 298 |
d | A | B | a + b + c | 701 |
Primer Name | Primer Sequences (5′→3′) |
---|---|
A | CTGCAAGGCGATTAAGTTGGGTAAC |
B | GCGGATAACAATTTCACACAGGAAACAG |
I | GATTGACAGAAGATAGAGAGCACTCTCTCTTTTGTATTCC |
II | GAGTGCTCTCTATCTTCTGTCAATCAAAGAGAATCAATGA |
III | GAGTACTCTCTATCTACTGTCATTCACAGGTCGTGATATG |
IV | GAATGACAGTAGATAGAGAGTACTCTACATATATATTCCT |
NPT II-F | GCTATGACTGGGCACAACAG |
NPT II-R | ATACCGTAAAGCACGAGGAA |
SPL9-F | CCTACTGTTGTTGTTGCTGG |
SPL9-R | CCTACGACGCTCATTATGG |
Stu-miR156 | TTGACAGAAGATAGAGAGCAC |
St18S RNA | TTAGAGGAAGGAGAAGTCGTAACAA |
ef1a-F | CAAGGATGACCCAGCCAAG |
ef1a-R | TTCCTTACCTGAACGCCTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, H.; Yang, J.; Liu, S.; Li, S.; Si, H.; Zhang, N. Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato. Plants 2024, 13, 723. https://doi.org/10.3390/plants13050723
Luo H, Yang J, Liu S, Li S, Si H, Zhang N. Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato. Plants. 2024; 13(5):723. https://doi.org/10.3390/plants13050723
Chicago/Turabian StyleLuo, Hongyu, Jiangwei Yang, Shengyan Liu, Shigui Li, Huaijun Si, and Ning Zhang. 2024. "Control of Plant Height and Lateral Root Development via Stu-miR156 Regulation of SPL9 Transcription Factor in Potato" Plants 13, no. 5: 723. https://doi.org/10.3390/plants13050723