Molecular Identification of Photobacterium damselae in Wild Marine Fish from the Eastern Mediterranean Sea
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fish Collection
2.2. Sample Collection
2.3. DNA Extraction
2.4. PCR
Primer Name | Sequence | Gene Target | Bacterium | Size of Amplicon | Reference |
---|---|---|---|---|---|
P1 | TAGTGTAGTTAACACCTGCAC | 16S rRNA | P. damselae | 570 | [28] |
P2 | ACACTCGAATCTCTTCAAGT | ||||
CAR1 | GCTTGAAGAGATTCGAGT | 16S rRNA | 267 | [41] | |
CAR2 | CACCTCGCGGTCTTGCTG | ||||
URE-5 | TCCGGAATAGGTAAAGCGGG | ureC | 448 | [30] | |
URE-3 | CTTGAATATCCATCTCATCTGC | ||||
ToxR-5 | GGGATTTTATGGTACACAAA | toxR | 985 | [30] | |
ToxR-3 | ATCATAACCAGAGAGATGCT | ||||
PS2S | CTAGGAGATGAGCCCGCTTG | 16S rRNA | RLOs | 469 | [37,40] |
PS2AS | GCTACACCTGCGAAACCACTT |
2.5. Statistical Methods
2.5.1. Sample Size
2.5.2. Data Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Crane, M.; Hyatt, A. Viruses of Fish: An Overview of Significant Pathogens. Viruses 2011, 3, 2025–2046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pujalte, M.J.; Sitjà-Bobadilla, A.; Álvarez-Pellitero, P.; Garay, E. Carriage of Potentially Fish-Pathogenic Bacteria in Sparus aurata Cultured in Mediterranean Fish Farms. Dis. Aquat. Organ. 2003, 54, 119–126. [Google Scholar] [CrossRef] [PubMed]
- Kassem, H.H.; Bowashi, S.M. Prevalence Of Anisakid Nematode Larvae Infecting Some Marine Fishes From The Libyan Coast. J. Egypt. Soc. Parasitol. 2015, 45, 609–616. [Google Scholar] [PubMed] [Green Version]
- Abdel-Ghaffar, F.; Bashtar, A.R.; Mehlhorn, H.; Al-Rasheid, K.; Al-Olayan, E.; Koura, E.; Morsy, K. Ultrastructure, Development, and Host-Parasite Relationship of a New Species of the Genus Pleistophora—A Microsporidian Parasite of the Marine Fish Epinephelus chlorostignei. Parasitol. Res. 2009, 106, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Chai, J.Y.; Murrell, K.D.; Lymbery, A.J. Fish-Borne Parasitic Zoonoses: Status and Issues. Int. J. Parasitol. 2005, 35, 1233–1254. [Google Scholar] [CrossRef]
- Gauthier, D.T. Bacterial Zoonoses of Fishes: A Review and Appraisal of Evidence for Linkages between Fish and Human Infections. Vet. J. 2015, 203, 27–35. [Google Scholar] [CrossRef]
- Palomera, I.; Olivar, M.P.; Salat, J.; Sabatés, A.; Coll, M.; García, A.; Morales-Nin, B. Small Pelagic Fish in the NW Mediterranean Sea: An Ecological Review. Prog. Oceanogr. 2007, 74, 377–396. [Google Scholar] [CrossRef]
- Türkmen, A.; Türkmen, M.; Tepe, Y.; Akyurt, I. Heavy Metals in Three Commercially Valuable Fish Species from İskenderun Bay, Northern East Mediterranean Sea, Turkey. Food Chem. 2005, 91, 167–172. [Google Scholar] [CrossRef]
- Berzak, R.; Scheinin, A.; Davidovich, N.; Regev, Y.; Diga, R.; Tchernov, D.; Morick, D. Prevalence of Nervous Necrosis Virus (NNV) and Streptococcus Species in Wild Marine Fish and Crustaceans from the Levantine Basin, Mediterranean Sea. Dis. Aquat. Organ. 2019, 133, 7–17. [Google Scholar] [CrossRef] [Green Version]
- Regev, Y.; Davidovich, N.; Berzak, R.; Lau, S.C.K.; Scheinin, A.P.; Tchernov, D.; Morick, D. Molecular Identification and Characterization of Vibrio Species and Mycobacterium Species in Wild and Cultured Marine Fish from the Eastern Mediterranean Sea. Microorganisms 2020, 8, 863. [Google Scholar] [CrossRef]
- Meron, D.; Davidovich, N.; Ofek-Lalzar, M.; Berzak, R.; Scheinin, A.; Regev, Y.; Diga, R.; Tchernov, D.; Morick, D. Specific Pathogens and Microbial Abundance within Liver and Kidney Tissues of Wild Marine Fish from the Eastern Mediterranean Sea. Microb. Biotechnol. 2020, 13, 770–780. [Google Scholar] [CrossRef] [Green Version]
- Rivas, A.J.; Lemos, M.L.; Osorio, C.R. Photobacterium damselae subsp. damselae, a Bacterium Pathogenic for Marine Animals and Humans. Front. Microbiol. 2013, 4, 283. [Google Scholar] [CrossRef] [Green Version]
- Mauel, M.J.; Miller, D.L. Piscirickettsiosis and Piscirickettsiosis-like Infections in Fish: A Review. Vet. Microbiol. 2002, 87, 279–289. [Google Scholar] [CrossRef]
- Serracca, L.; Ercolini, C.; Rossini, I.; Battistini, R.; Giorgi, I.; Prearo, M. Occurrence of Both Subspecies of Photobacterium damselae in Mullets Collected in the River Magra (Italy). Can. J. Microbiol. 2011, 57, 437–440. [Google Scholar] [CrossRef]
- Osorio, C.R.; Vences, A.; Matanza, X.M.; Terceti, M.S. Photobacterium damselae subsp. damselae, a Generalist Pathogen with Unique Virulence Factors and High Genetic Diversity. J. Bacteriol. 2018, 200, e00002-18. [Google Scholar] [CrossRef] [Green Version]
- Yamane, K.; Asato, J.; Kawade, N.; Takahashi, H.; Kimura, B.; Arakawa, Y. Two Cases of Fatal Necrotizing Fasciitis Caused by Photobacterium damsela in Japan. J. Clin. Microbiol. 2004, 42, 1370–1372. [Google Scholar] [CrossRef] [Green Version]
- Chiu, T.H.; Kao, L.Y.; Chen, M.L. Antibiotic Resistance and Molecular Typing of Photobacterium damselae subsp. damselae, Isolated from Seafood. J. Appl. Microbiol. 2013, 114, 1184–1192. [Google Scholar] [CrossRef]
- Fouz, B.; Toranzo, A.E.; Milan, M.; Amaro, C. Evidence That Water Transmits the Disease Caused by the Fish Pathogen Photobacterium damselae subsp. damselae. J. Appl. Microbiol. 2000, 88, 531–535. [Google Scholar] [CrossRef]
- Fouz, B.; Novoa, B.; Toranzo, A.E.; Figueras, A. Histopathological Lesions Caused by Vibrio damsela in Cultured Turbot, Scophthalmus maximus (L.): Inoculations with Live Cells and Extracellular Products. J. Fish Dis. 1995, 18, 357–364. [Google Scholar] [CrossRef]
- Barber, G.R.; Swygert, J.S. Necrotizing Fasciitis Due to Photobacterium damsela in a Man Lashed by a Stingray. N. Engl. J. Med. 2000, 342, 824. [Google Scholar] [CrossRef]
- Kim, H.R.; Kim, J.W.; Lee, M.K.; Kim, J.G. Septicemia Progressing to Fatal Hepatic Dysfunction in an Cirrhotic Patient after Oral Ingestion of Photobacterium damsela: A Case Report. Infection 2009, 37, 555–556. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, J.R.; Lamba, S.; Dyer, K.Y.; Apuzzio, J.J. An Unusual Case of Urinary Tract Infection in a Pregnant Woman with Photobacterium damsela. Infect. Dis. Obstet. Gynecol. 2006, 2006, 1–3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Romalde, J.L. Photobacterium damselae subsp. piscicida: An Integrated View of a Bacterial Fish Pathogen. Int. Microbiol. 2002, 5, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Roberts, R.J. The Bacteriology of Teleosts. In Fish Pathology; Blackwell Publishing Ltd.: Oxford, UK, 2001; pp. 297–331. [Google Scholar]
- Magariños, B.; Toranzo, A.E.; Romalde, J.L. Phenotypic and Pathobiological Characteristics of Pasteurella piscicida. Annu. Rev. Fish Dis. 1996, 6, 41–64. [Google Scholar] [CrossRef]
- Hawke, J.P.; Plakas, S.M.; Minton, R.V.; McPhearson, R.M.; Snider, T.G.; Guarino, A.M. Fish Pasteurellosis of Cultured Striped Bass (Morone saxatilis) in Coastal Alabama. Aquaculture 1987, 65, 193–204. [Google Scholar] [CrossRef]
- Magarinos, B.; Romalde, J.L.; Barja, J.L.; Toranzo, A.E. Evidence of a Dormant but Infective State of the Fish Pathogen Pasteurella piscicida in Seawater and Sediment. Appl. Environ. Microbiol. 1994, 60, 180–186. [Google Scholar] [CrossRef] [Green Version]
- Kvitt, H.; Ucko, M.; Colorni, A.; Batargias, C.; Zlotkin, A.; Knibb, W. Photobacterium damselae ssp. piscicida: Detection by Direct Amplification of 16S rRNA Gene Sequences and Genotypic Variation as Determined by Amplified Fragment Length Polymorphism (AFLP). Dis. Aquat. Organ. 2002, 48, 187–195. [Google Scholar] [CrossRef] [Green Version]
- Osorio, C.R.; Toranzo, A.E.; Romalde, J.L.; Barja, J.L. Multiplex PCR Assay for ureC and 16S rRNA Genes Clearly Discriminates between Both Subspecies of Photobacterium damselae. Dis. Aquat. Organ. 2000, 40, 177–183. [Google Scholar] [CrossRef] [Green Version]
- Pham, T.H.; Cheng, P.T.; Wang, P.; Chen, S. Genotypic Diversity, and Molecular and Pathogenic Characterization of Photobacterium damselae subsp. piscicida Isolated from Different Fish Species in Taiwan. J. Fish Dis. 2020, 43, 757–774. [Google Scholar] [CrossRef]
- Thyssen, A.; Grisez, L.; Van Houdt, R.; Ollevier, F. Phenotypic Characterization of the Marine Pathogen Photobacterium damselae subsp. piscicida. Int. J. Syst. Bacteriol. 1998, 48, 1145–1151. [Google Scholar] [CrossRef]
- Fryer, J.L.; Lannan, C.N.; Giovannoni, S.J.; Wood, N.D. Piscirickettsia salmonis Gen. Nov., Sp. Nov., the Causative Agent of an Epizootic Disease in Salmonid Fishes. Int. J. Syst. Bacteriol. 1992, 42, 120–126. [Google Scholar] [CrossRef] [Green Version]
- Rozas, M.; Enríquez, R. Piscirickettsiosis and Piscirickettsia salmonis in Fish: A Review. J. Fish Dis. 2014, 37, 163–188. [Google Scholar] [CrossRef]
- Branson, E.J.; Diaz-Munoz, D.N. Description of a New Disease Condition Occurring in Farmed Coho Salmon, Oncorhynchus kisutch (Walbaum), in South America. J. Fish Dis. 1991, 14, 147–156. [Google Scholar] [CrossRef]
- Cvitanich, J.D.; Garate, N.O.; Smith, C.E. The Isolation of a Rickettsia-like Organism Causing Disease and Mortality in Chilean Salmonids and Its Confirmation by Koch’s Postulate. J. Fish Dis. 1991, 14, 121–145. [Google Scholar] [CrossRef]
- Lannan, C.N.; Fryer, J.L. Extracellular Survival of Piscirickettsia salmonis. J. Fish Dis. 1994, 17, 545–548. [Google Scholar] [CrossRef]
- Corbeil, S.; Crane, M. Piscirickettsia Salmonis. Scahls Anzsdp (2009). Available online: http://www.aait.org.cn/web/images/upload/2013/04/30/201304301110495937.pdf (accessed on 1 October 2022).
- Smith, P.A.; Rojas, M.E.; Guajardo, A.; Contreras, J.; Morales, M.A.; Larenas, J. Experimental Infection of Coho Salmon Oncorhynchus kisutch by Exposure of Skin, Gills and Intestine with Piscirickettsia salmonis. Dis. Aquat. Organ. 2004, 61, 53–57. [Google Scholar] [CrossRef]
- Yanong, R.P.E. Necropsy Techniques for Fish. Semin. Avian Exot. Pet Med. 2003, 12, 89–105. [Google Scholar] [CrossRef]
- Mauel, M.J.; Giovannoni, S.J.; Fryer, J.L. Development of Polymerase Chain Reaction Assays for Detection, Identification, and Differentiation of Piscirickettsia salmonis. Dis. Aquat. Org. 1996, 26, 189–195. [Google Scholar] [CrossRef] [Green Version]
- Osorio, C.R.; Collins, M.D.; Toranzo, A.E.; Barja, J.L.; Romalde, J.L. 16S rRNA Gene Sequence Analysis of Photobacterium damselae and Nested PCR Method for Rapid Detection of the Causative Agent of Fish Pasteurellosis. Appl. Environ. Microbiol. 1999, 65, 2942–2946. [Google Scholar] [CrossRef] [Green Version]
- Bravo, F.; Sidhu, J.; Bernal, P.; Bustamante, R.; Condie, S.; Gorton, B.; Herzfeld, M.; Jimenez, D.; Mardones, F.; Rizwi, F.; et al. Hydrodynamic Connectivity, Water Temperature, and Salinity Are Major Drivers of Piscirickettsiosis Prevalence and Transmission among Salmonid Farms in Chile. Aquac. Environ. Interact. 2020, 12, 263–279. [Google Scholar] [CrossRef]
- Brosnahan, C.L.; Munday, J.S.; Ha, H.J.; Preece, M.; Jones, J.B. New Zealand Rickettsia-like Organism (NZ-RLO) and Tenacibaculum maritimum: Distribution and Phylogeny in Farmed Chinook Salmon (Oncorhynchus tshawytscha). J. Fish Dis. 2019, 42, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, S.A.; El-Bouhy, Z.M.; Hassanin, M.E.; Fadel, A.H. Vibrio alginolyticus and Photobacterium damselae subsp. damselae: Prevalence, Histopathology and Treatment in Sea Bass Dicentrarchus labrax. J. Pharm. Chem. Biol. Sci. 2017, 5, 354–364. [Google Scholar]
- Petchimuthu, M.; Rosalind George, M.; Rijijohn, K.; Santhanakumar, V. Isolation, Molecular Characterization and Virulence Study (Pathogenesis) of Photobacterium damselae subsp. damselae Isolated from Sea-Cage and Wild Fishes. Indian J. Anim. Res. 2021, 55, 679–688. [Google Scholar] [CrossRef]
- Terentjeva, M.; Eizenberga, I.; Valciņa, O.; Novoslavskij, A.; Strazdiņa, V.; Berziņš, A. Prevalence of Foodborne Pathogens in Freshwater Fish in Latvia. J. Food Prot. 2015, 78, 2093–2098. [Google Scholar] [CrossRef] [PubMed]
- Banchi, E.; Manna, V.; Fonti, V.; Fabbro, C.; Celussi, M. Improving Environmental Monitoring of Vibrionaceae in Coastal Ecosystems through 16S rRNA Gene Amplicon Sequencing. Environ. Sci. Pollut. Res. 2022, 29, 67466–67482. [Google Scholar] [CrossRef]
- Itay, P.; Shemesh, E.; Ofek-Lalzar, M.; Davidovich, N.; Kroin, Y.; Zrihan, S.; Stern, N.; Diamant, A.; Wosnick, N.; Meron, D.; et al. An Insight into Gill Microbiome of Eastern Mediterranean Wild Fish by Applying next Generation Sequencing. Front. Mar. Sci. 2022, 9, 1008103. [Google Scholar] [CrossRef]
- Eissa, I.A.M.; Derwa, H.I.; Ismail, M.; El-lamie, M.; Dessouki, A.A.; Elsheshtawy, H.; Bayoumy, E.M. Molecular and Phenotypic Characterization of Photobacterium damselae among Some Marine Fishes in Lake Temsah. Microb. Pathog. 2018, 114, 315–322. [Google Scholar] [CrossRef]
- Essam, H.M.; Abdellrazeq, G.S.; Tayel, S.I.; Torky, H.A.; Fadel, A.H. Pathogenesis of Photobacterium damselae Subspecies Infections in Sea Bass and Sea Bream. Microb. Pathog. 2016, 99, 41–50. [Google Scholar] [CrossRef]
- Tsikliras, A.C. Climate-Related Geographic Shift and Sudden Population Increase of a Small Pelagic Fish (Sardinella aurita) in the Eastern Mediterranean Sea. Mar. Biol. Res. 2008, 4, 477–481. [Google Scholar] [CrossRef]
- Madkour, F.F. Feeding Ecology of the Round Sardinella, Sardinella aurita. Int. J. Environ. Sci. Eng. 2012, 2, 83–92. [Google Scholar]
- Munroe, T.; Brown, J.; Aiken, K.A.; Bendeck Grijalba, L. Sardinella aurita. IUCN Red List Threat. Species 2015, e.T198581A115340607. Available online: https://www.iucnredlist.org/species/198581/115340607 (accessed on 1 October 2022). [CrossRef]
- Whitfield, A.K.; Elliott, M. Fishes as Indicators of Environmental and Ecological Changes within Estuaries: A Review of Progress and Some Suggestions for the Future. J. Fish Biol. 2002, 61 (Suppl. A), 229–250. [Google Scholar] [CrossRef]
- Soto-Galera, E.; Díaz-Pardo, E.; López-López, E.; Lyons, J. Fish as Indicators of Environmental Quality in the Río Lerma Basin, México. Aquat. Ecosyst. Heal. Manag. 1998, 1, 267–276. [Google Scholar] [CrossRef]
- Arkoosh, M.R.; Casillas, E.; Clemons, E.; Kagley, A.N.; Olson, R.; Reno, P.; Stein, J.E. Effect of Pollution on Fish Diseases: Potential Impacts on Salmonid Populations. J. Aquat. Anim. Health 1998, 10, 182–190. [Google Scholar] [CrossRef]
- Rajan, P.R.; Lin, J.H.Y.; Ho, M.S.; Yang, H.L. Simple and Rapid Detection of Photobacterium damselae ssp. piscicida by a PCR Technique and Plating Method. J. Appl. Microbiol. 2003, 95, 1375–1380. [Google Scholar] [CrossRef] [Green Version]
- Comps, M.; Raymond, J.C.; Plassiart, G.N. Rickettsia-like Organism Infecting Juvenile Sea-Bass Dicentrarchus labrax. Bull. Eur. Assoc. Fish Pathol. 1996, 16, 30–33. [Google Scholar]
- Athanassopoulou, F.; Groman, D.; Prapas, T.; Sabatakou, O. Pathological and Epidemiological Observations on Rickettsiosis in Cultured Sea Bass (Dicentrarchus labrax L.) from Greece. J. Appl. Ichthyol. 2004, 20, 525–529. [Google Scholar] [CrossRef]
- Metselaar, M.; Thompson, K.D.; Gratacap, R.M.L.; Kik, M.J.L.; LaPatra, S.E.; Lloyd, S.J.; Call, D.R.; Smith, P.D.; Adams, A. Association of Red-Mark Syndrome with a Rickettsia-like Organism and Its Connection with Strawberry Disease in the USA. J. Fish Dis. 2010, 33, 849–858. [Google Scholar] [CrossRef]
- Burge, C.A.; Mark Eakin, C.; Friedman, C.S.; Froelich, B.; Hershberger, P.K.; Hofmann, E.E.; Petes, L.E.; Prager, K.C.; Weil, E.; Willis, B.L.; et al. Climate Change Influences on Marine Infectious Diseases: Implications for Management and Society. Ann. Rev. Mar. Sci. 2014, 6, 249–277. [Google Scholar] [CrossRef] [Green Version]
- Wu, Q.; Xia, X.; Mou, X.; Zhu, B.; Zhao, P.; Dong, H. Effects of Seasonal Climatic Variability on Several Toxic Contaminants in Urban Lakes: Implications for the Impacts of Climate Change. J. Environ. Sci. 2014, 26, 2369–2378. [Google Scholar] [CrossRef]
- Herut, B.; Segal, Y. The National Monitoring Program of Israel’s Mediterranean Waters–Scientific Report for 2016; IOLR Report H48c/2017; Israel Oceanographic and Limnological Research (IOLR): Haifa, Israel, 2017. (In Hebrew) [Google Scholar]
- Salah, S.K.; Melaster, I. Pollutant Loads in the Sea-2016 (In Hebrew); Ministry of Environmental Protection: Jerusalem, Israel, 2017. Available online: https://www.gov.il/he/Departments/publications/reports/pollutant_loads_sea_annual_reports (accessed on 1 October 2022).
- Salah, S.K.; Melaster, I. Pollutant Loads in the Sea-2017 (In Hebrew); Ministry of Environmental Protection: Jerusalem, Israel, 2019. Available online: https://www.gov.il/he/Departments/publications/reports/pollutant_loads_sea_annual_reports (accessed on 1 October 2022).
Fish sp. | Organ | North | Central-South | Total |
---|---|---|---|---|
striped red mullet | Kidney | 22 | 18 | 40 |
Liver | 23 | 18 | 41 | |
round sardinella | Kidney | 26 | 13 | 39 |
Liver | 28 | 13 | 41 | |
brushtooth lizardfish | Kidney | 21 | 24 | 45 |
Liver | 23 | 24 | 47 | |
goldband goatfish | Kidney | 18 | 24 | 42 |
Liver | 18 | 21 | 39 | |
Total | 179 | 155 | 334 |
Accession No. | Species | Isolate | Host | Organ | Fishing Source |
---|---|---|---|---|---|
OP493090 | Photobacterium damselae subsp. piscicida | SaK1_191017.11 | round sardinella | Kidney | Kishon estuary |
OP493091 | Photobacterium damselae subsp. piscicida | SaK2_191017.15 | round sardinella | Kidney | Kishon estuary |
OP493092 | Photobacterium damselae subsp. piscicida | SaK3_191017.18 | round sardinella | Kidney | Kishon estuary |
OP493093 | Photobacterium damselae subsp. piscicida | SaK4_191017.5 | round sardinella | Kidney | Kishon estuary |
OP493094 | Photobacterium damselae subsp. piscicida | SaK5_211117.21 | round sardinella | Kidney | Tel Aviv |
OP493095 | Photobacterium damselae | SaL1_281117.2 | round sardinella | Liver | Acre |
OP493103 | Photobacterium damselae subsp. piscicida | SaL10_281117.4 | round sardinella | Liver | Acre |
OP493104 | Photobacterium damselae subsp. piscicida | SaL11_281117.6 | round sardinella | Liver | Kishon estuary |
OP493096 | Photobacterium damselae subsp. Damselae | SaL2_191017.1 | round sardinella | Liver | Kishon estuary |
OP493097 | Photobacterium damselae subsp. Damselae | SaL3_191017.21 | round sardinella | Liver | Kishon estuary |
OP493098 | Photobacterium damselae subsp. piscicida | SaL4_191017.12 | round sardinella | Liver | Kishon estuary |
OP493099 | Photobacterium damselae subsp. piscicida | SaL6_191017.17 | round sardinella | Liver | Kishon estuary |
OP493100 | Photobacterium damselae subsp. piscicida | SaL7_191017.4 | round sardinella | Liver | Kishon estuary |
OP493101 | Photobacterium damselae subsp. piscicida | SaL8_191017.6 | round sardinella | Liver | Kishon estuary |
OP493102 | Photobacterium damselae subsp. piscicida | SaL9_211117.22 | round sardinella | Liver | Acre |
OP493179 | Photobacterium damselae subsp. piscicida | SuK2_140917B9 | brushtooth lizardfish | Kidney | Kishon estuary |
OP493178 | Photobacterium damselae | SuL1_140917A3 | brushtooth lizardfish | Liver | Kishon estuary |
OP493149 | Photobacterium damselae | UmK1_281117.15 | goldband goatfish | Kidney | Kishon estuary |
OP493147 | Photobacterium damselae | UmL1_281117.22 | goldband goatfish | Liver | Kishon estuary |
OP493148 | Photobacterium damselae | UmL2_281117.20 | goldband goatfish | Liver | Kishon estuary |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morick, D.; Maron, Y.; Davidovich, N.; Zemah-Shamir, Z.; Nachum-Biala, Y.; Itay, P.; Wosnick, N.; Tchernov, D.; Harrus, S. Molecular Identification of Photobacterium damselae in Wild Marine Fish from the Eastern Mediterranean Sea. Fishes 2023, 8, 60. https://doi.org/10.3390/fishes8020060
Morick D, Maron Y, Davidovich N, Zemah-Shamir Z, Nachum-Biala Y, Itay P, Wosnick N, Tchernov D, Harrus S. Molecular Identification of Photobacterium damselae in Wild Marine Fish from the Eastern Mediterranean Sea. Fishes. 2023; 8(2):60. https://doi.org/10.3390/fishes8020060
Chicago/Turabian StyleMorick, Danny, Yuval Maron, Nadav Davidovich, Ziv Zemah-Shamir, Yaarit Nachum-Biala, Peleg Itay, Natascha Wosnick, Dan Tchernov, and Shimon Harrus. 2023. "Molecular Identification of Photobacterium damselae in Wild Marine Fish from the Eastern Mediterranean Sea" Fishes 8, no. 2: 60. https://doi.org/10.3390/fishes8020060