Custom G4 Microarrays Reveal Selective G-Quadruplex Recognition of Small Molecule BMVC: A Large-Scale Assessment of Ligand Binding Selectivity
Abstract
1. Introduction
2. Results
2.1. BMVC Binds G4 Sequences Differently from PDS
2.2. BMVC Shows Different Binding Selectivity to Various G4 Structures as Compared to PDS
2.3. BMVC Preferentially Binds to MYC_14/23T among the Known G4 Structures
2.4. BMVC Selectively Recognizes the Flanking Sequences of Parallel G4s, Especially the 3′-Flanking T
2.5. NMR Binding Experiments Confirm the Binding Selectivity of BMVC to G4 Structures and Flanking Sequences
3. Conclusions
4. Materials and Methods
4.1. Custom G4 DNA Microarray Design
4.2. DNA Microarray Binding Experiments
4.3. Data Processing and Analysis
4.4. NMR Spectroscopy Experiments
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Notes
References
- Yang, D. G-Quadruplex DNA and RNA. Methods Mol. Biol. 2019, 2035, 1–24. [Google Scholar] [CrossRef] [PubMed]
- Gellert, M.; Lipsett, M.N.; Davies, D.R. Helix formation by guanylic acid. Proc. Natl. Acad. Sci. USA 1962, 48, 2013–2018. [Google Scholar] [CrossRef] [PubMed]
- Williamson, J.R.; Raghuraman, M.K.; Cech, T.R. Monovalent cation-induced structure of telomeric DNA: The G-quartet model. Cell 1989, 59, 871–880. [Google Scholar] [CrossRef]
- Sen, D.; Gilbert, W. A sodium-potassium switch in the formation of four-stranded G4-DNA. Nature 1990, 344, 410–414. [Google Scholar] [CrossRef] [PubMed]
- Hud, N.V.; Smith, F.W.; Anet, F.A.L.; Feigon, J. The selectivity for K+ versus Na+ in DNA quadruplexes is dominated by relative free energies of hydration: A thermodynamic analysis by 1H NMR. Biochemistry 1996, 35, 15383–15390. [Google Scholar] [CrossRef]
- Neidle, S. Quadruplex nucleic acids as novel therapeutic targets. J. Med. Chem. 2016, 59, 5987–6011. [Google Scholar] [CrossRef]
- Yang, D.; Okamoto, K. Structural insights into G-quadruplexes: Towards new anticancer drugs. Future Med. Chem. 2010, 2, 619–646. [Google Scholar] [CrossRef]
- Chen, Y.; Yang, D. Sequence, stability, and structure of G-quadruplexes and their interactions with drugs. Curr. Protoc. Nucleic Acid Chem. 2012, 50, 17.5.1–17.5.17. [Google Scholar] [CrossRef]
- Siddiqui-Jain, A.; Grand, C.L.; Bearss, D.J.; Hurley, L.H. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598. [Google Scholar] [CrossRef]
- Gray, L.T.; Vallur, A.C.; Eddy, J.; Maizels, N. G quadruplexes are genomewide targets of transcriptional helicases XPB and XPD. Nat. Chem. Biol. 2014, 10, 313–318. [Google Scholar] [CrossRef]
- Bochman, M.L.; Paeschke, K.; Zakian, V.A. DNA secondary structures: Stability and function of G-quadruplex structures. Nat. Rev. Genet. 2012, 13, 770–780. [Google Scholar] [CrossRef] [PubMed]
- Piazza, A.; Boule, J.B.; Lopes, J.; Mingo, K.; Largy, E.; Teulade-Fichou, M.P.; Nicolas, A. Genetic instability triggered by G-quadruplex interacting Phen-DC compounds in Saccharomyces cerevisiae. Nucleic Acids Res. 2010, 38, 4337–4348. [Google Scholar] [CrossRef]
- Ribeyre, C.; Lopes, J.; Boule, J.B.; Piazza, A.; Guedin, A.; Zakian, V.A.; Mergny, J.L.; Nicolas, A. The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo. PLoS Genet 2009, 5, e1000475. [Google Scholar] [CrossRef]
- Huppert, J.L.; Balasubramanian, S. G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res. 2007, 35, 406–413. [Google Scholar] [CrossRef]
- Hansel-Hertsch, R.; Beraldi, D.; Lensing, S.V.; Marsico, G.; Zyner, K.; Parry, A.; Di Antonio, M.; Pike, J.; Kimura, H.; Narita, M.; et al. G-quadruplex structures mark human regulatory chromatin. Nat. Genet. 2016, 48, 1267–1272. [Google Scholar] [CrossRef]
- Brooks, T.A.; Hurley, L.H. The role of supercoiling in transcriptional control of MYC and its importance in molecular therapeutics. Nat. Rev. Cancer 2009, 9, 849–861. [Google Scholar] [CrossRef] [PubMed]
- Simonsson, T.; Pecinka, P.; Kubista, M. DNA tetraplex formation in the control region of c-myc. Nucleic Acids Res. 1998, 26, 1167–1172. [Google Scholar] [CrossRef] [PubMed]
- DesJardins, E.; Hay, N. Repeated CT elements bound by zinc finger proteins control the absolute and relative activities of the two principal human c-myc promoters. Mol. Cell. Biol. 1993, 13, 5710–5724. [Google Scholar] [CrossRef] [PubMed]
- Michelotti, E.F.; Tomonaga, T.; Krutzsch, H.; Levens, D. Cellular nucleic acid binding protein regulates the CT element of the human c-myc protooncogene. J. Biol. Chem. 1995, 270, 9494–9499. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Xing, Z.; Tran, E.J.; Yang, D. DDX5 helicase resolves G-quadruplex and is involved in MYC gene transcriptional activation. Proc. Natl. Acad. Sci. USA 2019, 116, 20453–20461. [Google Scholar] [CrossRef] [PubMed]
- Kouzine, F.; Wojtowicz, D.; Baranello, L.; Yamane, A.; Nelson, S.; Resch, W.; Kieffer-Kwon, K.R.; Benham, C.J.; Casellas, R.; Przytycka, T.M.; et al. Permanganate/S1 nuclease footprinting reveals non-B DNA structures with regulatory potential across a mammalian genome. Cell Syst. 2017, 4, 344–356. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Wu, J.Y.; Chien, C.W.; Wu, W.S.; Liu, H.; Kang, C.C.; Yu, L.J.; Chang, T.C. A fluorescent carbazole derivative: High sensitivity for quadruplex DNA. Anal. Chem. 2003, 75, 6177–6183. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Kuo, I.C.; Ling, I.F.; Chen, C.T.; Chen, H.C.; Lou, P.J.; Lin, J.J.; Chang, T.C. Detection of quadruplex DNA structures in human telomeres by a fluorescent carbazole derivative. Anal. Chem. 2004, 76, 4490–4494. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Chu, J.F.; Kao, F.J.; Chiu, Y.C.; Lou, P.J.; Chen, H.C.; Chang, T.C. Verification of antiparallel G-quadruplex structure in human telomeres by using two-photon excitation fluorescence lifetime imaging microscopy of the 3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide molecule. Anal. Chem. 2006, 78, 2810–2815. [Google Scholar] [CrossRef] [PubMed]
- Kang, C.C.; Chang, C.C.; Cheng, J.Y.; Chang, T.C. Simple method in diagnosing cancer cells by a novel fluorescence probe BMVC. J. Chin. Chem. Soc. 2005, 52, 1069–1072. [Google Scholar] [CrossRef]
- Chang, C.C.; Kuo, I.C.; Lin, J.J.; Lu, Y.C.; Chen, C.T.; Back, H.T.; Lou, P.J.; Chang, T.C. A novel carbazole derivative, BMVC: A potential antitumor agent and fluorescence marker of cancer cells. Chem. Biodivers. 2004, 1, 1377–1384. [Google Scholar] [CrossRef]
- Liu, W.; Lin, C.; Wu, G.; Dai, J.; Chang, T.C.; Yang, D. Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition. Nucleic Acids Res. 2019, 47, 11931–11942. [Google Scholar] [CrossRef]
- Berger, M.F.; Bulyk, M.L. Universal protein-binding microarrays for the comprehensive characterization of the DNA-binding specificities of transcription factors. Nat. Protoc. 2009, 4, 393–411. [Google Scholar] [CrossRef]
- Badis, G.; Berger, M.F.; Philippakis, A.A.; Talukder, S.; Gehrke, A.R.; Jaeger, S.A.; Chan, E.T.; Metzler, G.; Vedenko, A.; Chen, X.; et al. Diversity and complexity in DNA recognition by transcription factors. Science 2009, 324, 1720–1723. [Google Scholar] [CrossRef]
- Iida, K.; Nakamura, T.; Yoshida, W.; Tera, M.; Nakabayashi, K.; Hata, K.; Ikebukuro, K.; Nagasawa, K. Fluorescent-ligand-mediated screening of G-quadruplex structures using a DNA microarray. Angew. Chem. Int. Ed. 2013, 52, 12052–12055. [Google Scholar] [CrossRef] [PubMed]
- Ray, S.; Tillo, D.; Boer, R.E.; Assad, N.; Barshai, M.; Wu, G.; Orenstein, Y.; Yang, D.; Schneekloth, J.S., Jr.; Vinson, C. Custom DNA microarrays reveal diverse binding preferences of proteins and small molecules to thousands of G-quadruplexes. ACS Chem. Biol. 2020, 15, 925–935. [Google Scholar] [CrossRef] [PubMed]
- Muller, S.; Kumari, S.; Rodriguez, R.; Balasubramanian, S. Small-molecule-mediated G-quadruplex isolation from human cells. Nat. Chem. 2010, 2, 1095–1098. [Google Scholar] [CrossRef] [PubMed]
- Phan, A.T.; Modi, Y.S.; Patel, D.J. Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter. J. Am. Chem. Soc. 2004, 126, 8710–8716. [Google Scholar] [CrossRef] [PubMed]
- Dickerhoff, J.; Onel, B.; Chen, L.; Chen, Y.; Yang, D. Solution structure of a MYC promoter G-quadruplex with 1:6:1 loop length. ACS Omega 2019, 4, 2533–2539. [Google Scholar] [CrossRef]
- Ambrus, A.; Chen, D.; Dai, J.; Jones, R.A.; Yang, D. Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization. Biochemistry 2005, 44, 2048–2058. [Google Scholar] [CrossRef]
- Dai, J.; Carver, M.; Hurley, L.H.; Yang, D. Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: Insights into G-quadruplex-interactive small molecule drug design. J. Am. Chem. Soc. 2011, 133, 17673–17680. [Google Scholar] [CrossRef]
- Seenisamy, J.; Rezler, E.M.; Powell, T.J.; Tye, D.; Gokhale, V.; Joshi, C.S.; Siddiqui-Jain, A.; Hurley, L.H. The dynamic character of the G-quadruplex element in the c-MYC promoter and modification by TMPyP4. J. Am. Chem. Soc. 2004, 126, 8702–8709. [Google Scholar] [CrossRef]
- Qin, Y.; Fortin, J.S.; Tye, D.; Gleason-Guzman, M.; Brooks, T.A.; Hurley, L.H. Molecular cloning of the human platelet-derived growth factor receptor beta (PDGFR-beta) promoter and drug targeting of the G-quadruplex-forming region to repress PDGFR-beta expression. Biochemistry 2010, 49, 4208–4219. [Google Scholar] [CrossRef]
- Wang, K.B.; Dickerhoff, J.; Wu, G.; Yang, D. PDGFR-beta Promoter Forms a Vacancy G-Quadruplex that Can Be Filled in by dGMP: Solution Structure and Molecular Recognition of Guanine Metabolites and Drugs. J. Am. Chem. Soc. 2020, 142, 5204–5211. [Google Scholar] [CrossRef]
- Chen, Y.; Agrawal, P.; Brown, R.V.; Hatzakis, E.; Hurley, L.H.; Yang, D. The major G-quadruplex formed in the human platelet-derived growth factor receptor beta promoter adopts a novel broken-strand structure in K+ solution. J. Am. Chem. Soc. 2012, 134, 13220–13223. [Google Scholar] [CrossRef]
- Onel, B.; Carver, M.; Agrawal, P.; Hurley, L.H.; Yang, D. The 3’-end region of the human PDGFR-beta core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes. Biochim. Biophys. Acta Gen. Subj. 2018, 1862, 846–854. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Patel, D.J. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure 1993, 1, 263–282. [Google Scholar] [CrossRef]
- Ambrus, A.; Chen, D.; Dai, J.; Bialis, T.; Jones, R.A.; Yang, D. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 2006, 34, 2723–2735. [Google Scholar] [CrossRef] [PubMed]
- Luu, K.N.; Phan, A.T.; Kuryavyi, V.; Lacroix, L.; Patel, D.J. Structure of the human telomere in K+ solution: An intramolecular (3 + 1) G-quadruplex scaffold. J. Am. Chem. Soc. 2006, 128, 9963–9970. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Punchihewa, C.; Ambrus, A.; Chen, D.; Jones, R.A.; Yang, D. Structure of the intramolecular human telomeric G-quadruplex in potassium solution: A novel adenine triple formation. Nucleic Acids Res. 2007, 35, 2440–2450. [Google Scholar] [CrossRef]
- Phan, A.T.; Luu, K.N.; Patel, D.J. Different loop arrangements of intramolecular human telomeric (3+1) G-quadruplexes in K+ solution. Nucleic Acids Res. 2006, 34, 5715–5719. [Google Scholar] [CrossRef]
- Agrawal, P.; Lin, C.; Mathad, R.I.; Carver, M.; Yang, D. The major G-quadruplex formed in the human BCL-2 proximal promoter adopts a parallel structure with a 13-nt loop in K+ solution. J. Am. Chem. Soc. 2014, 136, 1750–1753. [Google Scholar] [CrossRef]
- Onel, B.; Carver, M.; Wu, G.; Timonina, D.; Kalarn, S.; Larriva, M.; Yang, D. A New G-quadruplex with hairpin loop immediately upstream of the human BCL2 P1 promoter modulates transcription. J. Am. Chem. Soc. 2016, 138, 2563–2570. [Google Scholar] [CrossRef]
- Qin, Y.; Rezler, E.M.; Gokhale, V.; Sun, D.; Hurley, L.H. Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activity by TMPyP4. Nucleic Acids Res. 2007, 35, 7698–7713. [Google Scholar] [CrossRef]
- Morgan, R.K.; Batra, H.; Gaerig, V.C.; Hockings, J.; Brooks, T.A. Identification and characterization of a new G-quadruplex forming region within the kRAS promoter as a transcriptional regulator. Biochim. Biophys. Acta 2016, 1859, 235–245. [Google Scholar] [CrossRef]
- Kerkour, A.; Marquevielle, J.; Ivashchenko, S.; Yatsunyk, L.A.; Mergny, J.L.; Salgado, G.F. High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation. J. Biol. Chem. 2017, 292, 8082–8091. [Google Scholar] [CrossRef]
- Agrawal, P.; Hatzakis, E.; Guo, K.; Carver, M.; Yang, D. Solution structure of the major G-quadruplex formed in the human VEGF promoter in K+: Insights into loop interactions of the parallel G-quadruplexes. Nucleic Acids Res. 2013, 41, 10584–10592. [Google Scholar] [CrossRef] [PubMed]
- Tong, X.; Lan, W.; Zhang, X.; Wu, H.; Liu, M.; Cao, C. Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence. Nucleic Acids Res. 2011, 39, 6753–6763. [Google Scholar] [CrossRef] [PubMed]
- Palumbo, S.L.; Memmott, R.M.; Uribe, D.J.; Krotova-Khan, Y.; Hurley, L.H.; Ebbinghaus, S.W. A novel G-quadruplex-forming GGA repeat region in the c-myb promoter is a critical regulator of promoter activity. Nucleic Acids Res. 2008, 36, 1755–1769. [Google Scholar] [CrossRef] [PubMed]
- De Armond, R.; Wood, S.; Sun, D.; Hurley, L.H.; Ebbinghaus, S.W. Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1alpha promoter. Biochemistry 2005, 44, 16341–16350. [Google Scholar] [CrossRef]
- Wei, D.; Husby, J.; Neidle, S. Flexibility and structural conservation in a c-KIT G-quadruplex. Nucleic Acids Res. 2015, 43, 629–644. [Google Scholar] [CrossRef]
- Bedrat, A.; Lacroix, L.; Mergny, J.L. Re-evaluation of G-quadruplex propensity with G4Hunter. Nucleic Acids Res. 2016, 44, 1746–1759. [Google Scholar] [CrossRef]
- Wagih, O. ggseqlogo: A versatile R package for drawing sequence logos. Bioinformatics 2017, 33, 3645–3647. [Google Scholar] [CrossRef]
Sample Availability: Samples of BMVC and Cy5-PDS are available from the authors upon request. |
Name | G4 Sequence (5′→3′) |
---|---|
MYC_Pu40 [9] | TTATGGGGAGGGTGGGGAGGGTGGGGAAGGTGGGGAGGAG |
MYC_Pu29 [9] | TTGGGGAGGGTGGGGAGGGTGGGGAAGGT |
MYC_Pu27 [9] | TGGGGAGGGTGGGGAGGGTGGGGAAGG |
MYC_Pu26 [33,34] | TTGGGGAGGGTGGGGAGGGTGGGGAA |
MYC_Pu22 [35,36] | TGAGGGTGGGGAGGGTGGGGAA |
MYC_14/23T [35,36] | TGAGGGTGGGTAGGGTGGGTAA |
MYC_Pu18 [37] | AGGGTGGGGAGGGTGGGG |
PDGFRβ_Pu41 [38] | GCTGGGAGAAGGGGGGGCGGCGGGGCAGGGAGGGTGGACGC |
PDGFRβ-5′end [38] | TTGGGAGAAGGGGGGGCGGCGGGGCA |
PDGFRβ-5′mid-vac [39] | AAGGGAGGGCGGCGGGGCA |
PDGFRβ-3′mid [40] | AAGGGGGGGCGGCGGGGCAGGGAGGGT |
PDGFRβ-3′end [41] | CGGCGGGGCAGGGAGGGTGGACG |
wtTel22 [42] | AGGGTTAGGGTTAGGGTTAGGG |
Tel26 [43,44,45] | TTAGGGTTAGGGTTAGGGTTAGGGAAA |
wtTel26 [45,46] | TTAGGGTTAGGGTTAGGGTTAGGGTTA |
Bcl-2_55G [47] | AGGGGCGGGCGCGGGAGGAAGGGGGCGGGA |
Bcl-2_P1G4 [48] | CGGGCGGGAGCGCGGCGGGCGGGCGGGC |
PDGF-A_Pu48 [49] | GGAGGCGGGGGGGGGGGGGCGGGGGCGGGGGCGGGGGAGGGGCGCGGC |
KRAS [50] | AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGGCAG |
KRAS_NMR [51] | AGGGCGGTGTGGGAATAGGGAA |
VEGF [52] | CGGGGCGGGCCGGGGGCGGGGT |
RET [53] | GGGTAGGGGCGGGGCGGGGCGGGGGC |
MYB [54] | GGAGGAGGAGGTCACGGAGGAGGAGGAGAAGGAGGAGGAGGA |
HIF1a [55] | GGGAGGGAGAGGGGGCGGG |
c-KIT [56] | AGGGAGGGCGCTGGGAGGAGGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, G.; Tillo, D.; Ray, S.; Chang, T.-C.; Schneekloth, J.S., Jr.; Vinson, C.; Yang, D. Custom G4 Microarrays Reveal Selective G-Quadruplex Recognition of Small Molecule BMVC: A Large-Scale Assessment of Ligand Binding Selectivity. Molecules 2020, 25, 3465. https://doi.org/10.3390/molecules25153465
Wu G, Tillo D, Ray S, Chang T-C, Schneekloth JS Jr., Vinson C, Yang D. Custom G4 Microarrays Reveal Selective G-Quadruplex Recognition of Small Molecule BMVC: A Large-Scale Assessment of Ligand Binding Selectivity. Molecules. 2020; 25(15):3465. https://doi.org/10.3390/molecules25153465
Chicago/Turabian StyleWu, Guanhui, Desiree Tillo, Sreejana Ray, Ta-Chau Chang, John S. Schneekloth, Jr., Charles Vinson, and Danzhou Yang. 2020. "Custom G4 Microarrays Reveal Selective G-Quadruplex Recognition of Small Molecule BMVC: A Large-Scale Assessment of Ligand Binding Selectivity" Molecules 25, no. 15: 3465. https://doi.org/10.3390/molecules25153465
APA StyleWu, G., Tillo, D., Ray, S., Chang, T.-C., Schneekloth, J. S., Jr., Vinson, C., & Yang, D. (2020). Custom G4 Microarrays Reveal Selective G-Quadruplex Recognition of Small Molecule BMVC: A Large-Scale Assessment of Ligand Binding Selectivity. Molecules, 25(15), 3465. https://doi.org/10.3390/molecules25153465