A Simple Structure-Switch Aptasensor Using Label-Free Aptamer for Fluorescence Detection of Aflatoxin B1
Abstract
:1. Introduction
2. Results and Discussions
2.1. Working Principle of Fluorescent Switch Aptasensor for AFB1 Detection
2.2. Feasibility of Fluorescent Structure-Switch Aptasensor
2.3. Optimization of Experimental Conditions
2.4. Detection of AFB1
2.5. Selectivity Test and Detection in Complex Sample Matrix
3. Materials and Methods
3.1. Chemicals and Reagents
3.2. Detection of AFB1
3.3. Selectivity Test
3.4. Detection of AFB1 in Complex Sample Matrix
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Nesbitt, B.F.; O’Kelly, J.; Sargeant, K.; Sheridan, A. Aspergillus flavus and turkey X disease: Toxic metabolites of aspergillus flavus. Nature 1962, 195, 1062–1063. [Google Scholar] [CrossRef]
- Marroquin-Cardona, A.G.; Johnson, N.M.; Phillips, T.D.; Hayes, A.W. Mycotoxins in a changing global environment—A review. Food Chem. Toxicol. 2014, 69, 220–230. [Google Scholar] [CrossRef] [PubMed]
- Da Rocha, M.E.B.; Freire, F.d.C.O.; Maia, F.E.F.; Guedes, M.I.F.; Rondina, D. Mycotoxins and their effects on human and animal health. Food Control 2014, 36, 159–165. [Google Scholar] [CrossRef]
- Carnaghan, R.B.; Hartley, R.D.; O’Kelly, J. Toxicity and fluorescence properties of the aflatoxins. Nature 1963, 200, 1101. [Google Scholar] [CrossRef] [PubMed]
- Llovet, J.M.; Zucman-Rossi, J.; Pikarsky, E.; Sangro, B.; Schwartz, M.; Sherman, M.; Gores, G. Hepatocellular carcinoma. Nat. Rev. Dis. Primers 2016, 2, 16018. [Google Scholar] [CrossRef]
- Ostry, V.; Malir, F.; Toman, J.; Grosse, Y. Mycotoxins as human carcinogens-the IARC monographs classification. Mycotoxin Res. 2017, 33, 65–73. [Google Scholar] [CrossRef]
- Koppen, R.; Koch, M.; Siegel, D.; Merkel, S.; Maul, R.; Nehls, I. Determination of mycotoxins in foods: Current state of analytical methods and limitations. Appl. Microbiol. Biotechnol. 2010, 86, 1595–1612. [Google Scholar]
- Li, P.; Zhang, Q.; Zhang, W. Immunoassays for aflatoxins. TrAC Trends Anal. Chem. 2009, 28, 1115–1126. [Google Scholar] [CrossRef]
- Chauhan, R.; Singh, J.; Sachdev, T.; Basu, T.; Malhotra, B.D. Recent advances in mycotoxins detection. Biosens. Bioelectron. 2016, 81, 532–545. [Google Scholar] [CrossRef]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef]
- Toh, S.Y.; Citartan, M.; Gopinath, S.C.; Tang, T.H. Aptamers as a replacement for antibodies in enzyme-linked immunosorbent assay. Biosens. Bioelectron. 2015, 64, 392–403. [Google Scholar] [CrossRef]
- Citartan, M.; Gopinath, S.C.B.; Tominaga, J.; Tan, S.C.; Tang, T.H. Assays for aptamer-based platforms. Biosens. Bioelectron. 2012, 34, 1–11. [Google Scholar] [CrossRef]
- Chen, L.; Wen, F.; Li, M.; Guo, X.; Li, S.; Zheng, N.; Wang, J. A simple aptamer-based fluorescent assay for the detection of aflatoxin B1 in infant rice cereal. Food Chem. 2017, 215, 377–382. [Google Scholar] [CrossRef]
- Seok, Y.; Byun, J.Y.; Shim, W.B.; Kim, M.G. A structure-switchable aptasensor for aflatoxin B1 detection based on assembly of an aptamer/split DNAzyme. Anal. Chim. Acta 2015, 886, 182–187. [Google Scholar] [CrossRef]
- Wang, C.; Liu, L.; Zhao, Q. Low temperature greatly enhancing responses of aptamer electrochemical sensor for aflatoxin B1 using aptamer with short stem. ACS Sens. 2020, 5, 3246–3253. [Google Scholar] [CrossRef]
- Sun, L.; Wu, L.; Zhao, Q. Aptamer based surface plasmon resonance sensor for aflatoxin B1. Microchim. Acta 2017, 184, 2605–2610. [Google Scholar] [CrossRef]
- Sun, L.; Zhao, Q. Direct fluorescence anisotropy approach for aflatoxin B1 detection and affinity binding study by using single tetramethylrhodamine labeled aptamer. Talanta 2018, 189, 442–450. [Google Scholar] [CrossRef]
- Danesh, N.M.; Bostan, H.B.; Abnous, K.; Ramezani, M.; Youssefi, K.; Taghdisi, S.M.; Karimi, G. Ultrasensitive detection of aflatoxin B1 and its major metabolite aflatoxin M1 using aptasensors: A review. TrAC Trends Anal. Chem. 2018, 99, 117–128. [Google Scholar] [CrossRef]
- Nutiu, R.; Li, Y. Structure-switching signaling aptamers: Transducing molecular recognition into fluorescence signaling. Chem. A Eur. J. 2004, 10, 1868–1876. [Google Scholar] [CrossRef]
- Feng, C.; Dai, S.; Wang, L. Optical aptasensors for quantitative detection of small biomolecules: A review. Biosens. Bioelectron. 2014, 59, 64–74. [Google Scholar] [CrossRef]
- Jia, Y.; Wu, F.; Liu, P.; Zhou, G.; Yu, B.; Lou, X.; Xia, F. A label-free fluorescent aptasensor for the detection of Aflatoxin B1 in food samples using AIEgens and graphene oxide. Talanta 2019, 198, 71–77. [Google Scholar] [CrossRef]
- Nutiu, R.; Li, Y.F. Structure-switching signaling aptamers. J. Am. Chem. Soc. 2003, 125, 4771–4778. [Google Scholar] [CrossRef]
- Ma, X.; Li, H.; Qiao, S.; Huang, C.; Liu, Q.; Shen, X.; Geng, Y.; Xu, W.; Sun, C. A simple and rapid sensing strategy based on structure-switching signaling aptamers for the sensitive detection of chloramphenicol. Food Chem. 2020, 302, 125359. [Google Scholar] [CrossRef]
- Wang, C.; Sun, L.; Zhao, Q. A simple aptamer molecular beacon assay for rapid detection of aflatoxin B1. Chin. Chem. Lett. 2019, 30, 1017–1020. [Google Scholar] [CrossRef]
- Sabet, F.S.; Hosseini, M.; Khabbaz, H.; Dadmehr, M.; Ganjali, M.R. FRET-based aptamer biosensor for selective and sensitive detection of aflatoxin B1 in peanut and rice. Food Chem. 2017, 220, 527–532. [Google Scholar] [CrossRef]
- Xia, X.; Wang, Y.; Yang, H.; Dong, Y.; Zhang, K.; Lu, Y.; Deng, R.; He, Q. Enzyme-free amplified and ultrafast detection of aflatoxin B1 using dual-terminal proximity aptamer probes. Food Chem. 2019, 283, 32–38. [Google Scholar] [CrossRef]
- Lu, Z.; Chen, X.; Wang, Y.; Zheng, X.; Li, C.M. Aptamer based fluorescence recovery assay for aflatoxin B1 using a quencher system composed of quantum dots and graphene oxide. Microchim. Acta 2014, 182, 571–578. [Google Scholar] [CrossRef]
- Zhao, Z.; Yang, H.; Deng, S.; Dong, Y.; Yan, B.; Zhang, K.; Deng, R.; He, Q. Intrinsic conformation response-leveraged aptamer probe based on aggregation-induced emission dyes for aflatoxin B1 detection. Dye. Pigment. 2019, 171, 107767. [Google Scholar] [CrossRef]
- Goud, K.Y.; Sharma, A.; Hayat, A.; Catanante, G.; Gobi, K.V.; Gurban, A.M.; Marty, J.L. Tetramethyl-6-carboxyrhodamine quenching-based aptasensing platform for aflatoxin B1: Analytical performance comparison of two aptamers. Anal. Biochem. 2016, 508, 19–24. [Google Scholar] [CrossRef]
- Li, Y.; Wang, J.; Zhang, B.; He, Y.; Wang, J.; Wang, S. A rapid fluorometric method for determination of aflatoxin B1 in plant-derived food by using a thioflavin T-based aptasensor. Microchim. Acta 2019, 186, 214. [Google Scholar] [CrossRef]
- Li, Y.P.; Sun, L.L.; Zhao, Q. Development of aptamer fluorescent switch assay for aflatoxin B1 by using fluorescein-labeled aptamer and black hole quencher 1-labeled complementary DNA. Anal. Bioanal. Chem. 2018, 410, 6269–6277. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhu, F.; Chen, M.; Zhu, Y.; Xiao, J.; Yang, H.; Chen, X. Rapid and visual detection of aflatoxin B1 in foodstuffs using aptamer/G-quadruplex DNAzyme probe with low background noise. Food Chem. 2019, 271, 581–587. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Zheng, J.; Ding, A.; Xu, L.; Chen, J.; Li, C.M. Highly sensitive aflatoxin B1 sensor based on DNA-guided assembly of fluorescent probe and TdT-assisted DNA polymerization. Food Chem. 2019, 294, 19–26. [Google Scholar] [CrossRef] [PubMed]
Name | Function | Sequence (5’ to 3’) |
---|---|---|
FDNA | FDNA | FAM-TCACAGATGAGT |
Af27 | aptamer | ACTCATCTGTGATCACGTGTTGTCTCTCTGTGTCTCGTG |
Af29 | aptamer | ACTCATCTGTGATGCACGTGTTGTCTCTCTGTGTCTCGTGC |
Af27-C12Q | QDNA | GACAACACGTGA-BHQ1 |
Af27-C13Q | QDNA | AGACAACACGTGA-BHQ1 |
Af27-C14Q | QDNA | GAGACAACACGTGA-BHQ1 |
Af29-C13Q | QDNA | GACAACACGTGCA-BHQ1 |
Af29-C14Q | QDNA | AGACAACACGTGCA-BHQ1 |
Af29-C15Q | QDNA | GAGACAACACGTGCA-BHQ1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, C.; Yu, H.; Zhao, Q. A Simple Structure-Switch Aptasensor Using Label-Free Aptamer for Fluorescence Detection of Aflatoxin B1. Molecules 2022, 27, 4257. https://doi.org/10.3390/molecules27134257
Wang C, Yu H, Zhao Q. A Simple Structure-Switch Aptasensor Using Label-Free Aptamer for Fluorescence Detection of Aflatoxin B1. Molecules. 2022; 27(13):4257. https://doi.org/10.3390/molecules27134257
Chicago/Turabian StyleWang, Chao, Hao Yu, and Qiang Zhao. 2022. "A Simple Structure-Switch Aptasensor Using Label-Free Aptamer for Fluorescence Detection of Aflatoxin B1" Molecules 27, no. 13: 4257. https://doi.org/10.3390/molecules27134257