Detection of Parvalbumin Fish Allergen in Canned Tuna by Real-Time PCR Driven by Tuna Species and Can-Filling Medium
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. pH Measurements of Tuna and Filling Mediums
2.3. Calcium Content of Canned Tuna
2.4. DNA Extraction and Assessment of DNA Quality
2.5. Species Identification within DNA Barcoding and DNA Mini Barcoding
2.6. Parvalbumin Detection by Real-Time PCR
2.7. Gel Electrophoresis Analysis
2.8. Statistical Analysis
3. Results
3.1. pH and Calcium Content Differences among Canned Tuna Groups
3.2. Yield and Quality of DNA
3.3. Species Authentication of Canned Tuna
3.4. Parvalbumin Gene Detection as a Marker for Fish Allergens in Canned Tuna
4. Conclusions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Lasekan, A. Attenuating the Antibody Reactivity of the Shrimp Major Allergen (Tropomyosin) using Food Processing Methods. Ph.D. Thesis, The University of Maine, Orono, ME, USA, 2017. [Google Scholar]
- McClements, D.J. The Future of Foods? In Future Foods: How Modern Science Is Transforming the Way We Eat; McClements, D.J., Ed.; Springer International Publishing: Cham, Switzerland, 2019; pp. 363–366. [Google Scholar]
- Pérez-Lloréns, J.L. Bluefin tuna and Cádiz: A pinch of history and gastronomy. Int. J. Gastron. Food Sci. 2019, 17, 100170. [Google Scholar] [CrossRef]
- Ruethers, T.; Taki, A.C.; Khangurha, J.; Roberts, J.; Buddhadasa, S.; Clarke, D.; Hedges, C.E.; Campbell, D.E.; Kamath, S.D.; Lopata, A.L.; et al. Commercial fish ELISA kits have a limited capacity to detect different fish species and their products. J. Sci. Food Agric. 2020, 100, 4353–4363. [Google Scholar] [CrossRef] [PubMed]
- Saptarshi, S.R.; Sharp, M.F.; Kamath, S.; Lopata, A.L. Antibody reactivity to the major fish allergen parvalbumin is determined by isoforms and impact of thermal processing. Food Chem. 2014, 148, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Griesmeier, U.; Bublin, M.; Radauer, C.; Vázquez-Cortés, S.; Ma, Y.; Fernández-Rivas, M.; Breiteneder, H. Physicochemical properties and thermal stability of Lep w 1, the major allergen of whiff. Mol. Nutr. Food Res. 2009, 54, 861–869. [Google Scholar] [CrossRef] [PubMed]
- Liang, J.; Taylor, S.L.; Baumert, J.; Lopata, A.L.; Lee, N.A. Effects of thermal treatment on the immunoreactivity and quantification of parvalbumin from Southern hemisphere fish species with two anti-parvalbumin antibodies. Food Control 2020, 121, 107675. [Google Scholar] [CrossRef]
- Kuehn, A.; Swoboda, I.; Arumugam, K.; Hilger, C.; Hentges, F. Fish Allergens at a Glance: Variable Allergenicity of Parvalbumins, the Major Fish Allergens. Front. Immunol. 2014, 5, 179. [Google Scholar] [CrossRef]
- Mourad, A.A.; Bahna, S.L. Fish-allergic patients may be able to eat fish. Expert Rev. Clin. Immunol. 2015, 11, 419–430. [Google Scholar] [CrossRef]
- Abdullah, A.; Rehbein, H. The differentiation of tuna (family: Scombridae) products through the PCR-based analysis of the cytochrome b gene and parvalbumin introns. J. Sci. Food Agric. 2016, 96, 456–464. [Google Scholar] [CrossRef]
- Davis, C.M.; Gupta, R.S.; Aktas, O.N.; Diaz, V.; Kamath, S.D.; Lopata, A.L. Clinical Management of Seafood Allergy. J. Allergy Clin. Immunol. Pract. 2020, 8, 37–44. [Google Scholar] [CrossRef]
- Pérez-Tavarez, R.; Moreno, H.M.; Borderias, J.; Loli-Ausejo, D.; Pedrosa, M.; Hurtado, J.L.; Rodriguez-Pérez, R.; Gasset, M. Fish muscle processing into seafood products reduces β-parvalbumin allergenicity. Food Chem. 2021, 364, 130308. [Google Scholar] [CrossRef]
- Hildebrandt, S. Multiplexed identification of different fish species by detection of parvalbumin, a common fish allergen gene: A DNA application of multi-analyte profiling (xMAP™) technology. Anal. Bioanal. Chem. 2010, 397, 1787–1796. [Google Scholar] [CrossRef]
- Hildebrandt, S.; Garber, E.A.E. Effects of processing on detection and quantification of the parvalbumin gene in Atlantic salmon (Salmo salar). Food Chem. 2010, 119, 75–80. [Google Scholar] [CrossRef]
- Blickem, E.R.; Bell, J.W.; Baumgartel, D.M.; DeBEER, J. Review and Analysis of Tuna Recalls in the United States, 2002 through 2020. J. Food Prot. 2021, 85, 60–72. [Google Scholar] [CrossRef] [PubMed]
- Klueber, J.; Schrama, D.; Rodrigues, P.; Dickel, H.; Kuehn, A. Fish Allergy Management: From Component-Resolved Diagnosis to Unmet Diagnostic Needs. Curr. Treat. Options Allergy 2019, 6, 322–337. [Google Scholar] [CrossRef]
- Khan, M.U.; Ahmed, I.; Lin, H.; Li, Z.; Costa, J.; Mafra, I.; Chen, Y.; Wu, Y.-N. Potential efficacy of processing technologies for mitigating crustacean allergenicity. Crit. Rev. Food Sci. Nutr. 2018, 59, 2807–2830. [Google Scholar] [CrossRef]
- Vanga, S.K.; Singh, A.; Raghavan, V. Review of conventional and novel food processing methods on food allergens. Crit. Rev. Food Sci. Nutr. 2017, 57, 2077–2094. [Google Scholar] [CrossRef]
- Wang, Z.; Abdulla, R.; Parker, B.; Samanipour, R.; Ghosh, S.; Kim, K. A simple and high-resolution stereolithography-based 3D bioprinting system using visible light crosslinkable bioinks. Biofabrication 2015, 7, 045009. [Google Scholar] [CrossRef]
- Vissers, Y.M.; Wichers, H.J.; Savelkoul, H.F.J. Influence of Food Processing, Digestion and the Food Matrix on Allergenicity & Cellular Measures of Allergenicity. In Multidisciplinary Approaches to Allergies; Springer: Berlin/Heidelberg, Germany, 2012; pp. 203–227. [Google Scholar]
- Pekar, J.; Ret, D.; Untersmayr, E. Stability of allergens. Mol. Immunol. 2018, 100, 14–20. [Google Scholar] [CrossRef]
- Jiang, X.; Rao, Q. Effect of Processing on Fish Protein Antigenicity and Allergenicity. Foods 2021, 10, 969. [Google Scholar] [CrossRef]
- Shokralla, S.; Hellberg, R.S.; Handy, S.M.; King, I.; Hajibabaei, M. A DNA Mini-Barcoding System for Authentication of Processed Fish Products. Sci. Rep. 2015, 5, 15894. [Google Scholar] [CrossRef] [Green Version]
- Kumar, G. Mercury Concentrations in Fresh and Canned Tuna: A Review. Rev. Fish. Sci. Aquac. 2017, 26, 111–120. [Google Scholar] [CrossRef]
- Mohan, C.O.; Remya, S.; Ravishankar, C.N.; Vijayan, P.K.; Gopal, T.K.S. Effect of filling ingredient on the quality of canned yellowfin tuna (Thunnus albacares). Int. J. Food Sci. Technol. 2013, 49, 1557–1564. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Ward, R.D.; Zemlak, T.S.; Innes, B.H.; Last, P.R.; Hebert, P.D.N. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc. B Biol. Sci. 2005, 360, 1847–1857. [Google Scholar] [CrossRef]
- Valentini, A.; Taberlet, P.; Miaud, C.; Civade, R.; Herder, J.; Thomsen, P.F.; Bellemain, E.; Besnard, A.; Coissac, E.; Boyer, F.; et al. Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Mol. Ecol. 2016, 25, 929–942. [Google Scholar] [CrossRef]
- Guo, F.-F.; Kubota, H.; Shiomi, K. Purification, immunological properties and molecular cloning of two allergenic parvalbumins from the crimson sea bream, Evynnis japonica. Food Chem. 2012, 132, 835–840. [Google Scholar] [CrossRef]
- Alam, S. Potential Use of Chitosan as a Cell Scaffold Material for Cartilage Tissue Engineering. Tissue Eng. 2002, 8, 1009–1016. [Google Scholar]
- Swoboda, I.; Bugajska-Schretter, A.; Verdino, P.; Keller, W.; Sperr, W.R.; Valent, P.; Valenta, R.; Spitzauer, S. Recombinant Carp Parvalbumin, the Major Cross-Reactive Fish Allergen: A Tool for Diagnosis and Therapy of Fish Allergy. J. Immunol. 2002, 168, 4576–4584. [Google Scholar] [CrossRef]
- Permyakov, S.E.; Bakunts, A.G.; Denesyuk, A.I.; Knyazeva, E.L.; Uversky, V.N.; Permyakov, E.A. Apo-parvalbumin as an intrinsically disordered protein. Proteins Struct. Funct. Bioinform. 2008, 72, 822–836. [Google Scholar] [CrossRef]
- De Magalhães, C.R.; Schrama, D.; Fonseca, F.; Kuehn, A.; Morisset, M.; Ferreira, S.R.; Gonçalves, A.; Rodrigues, P.M. Effect of EDTA enriched diets on farmed fish allergenicity and muscle quality; a proteomics approach. Food Chem. 2020, 305, 125508. [Google Scholar] [CrossRef]
- Sanchiz, A.; Sánchez-Enciso, P.; Cuadrado, C.; Linacero, R. Detection of Peanut Allergen by Real-Time PCR: Looking for a Suitable Detection Marker as Affected by Processing. Foods 2021, 10, 1421. [Google Scholar] [CrossRef] [PubMed]
- Torricelli, M.; Pierboni, E.; Rondini, C.; Altissimi, S.; Haouet, N. Sesame, Pistachio, and Macadamia Nut: Development and Validation of New Allergenic Systems for Fast Real-Time PCR Application. Foods 2020, 9, 1085. [Google Scholar] [CrossRef] [PubMed]
- Kenk, M.; Panter, S.; Engler-Blum, G.; Bergemann, J. Sensitive DNA-based allergen detection depends on food matrix and DNA isolation method. Eur. Food Res. Technol. 2011, 234, 351–359. [Google Scholar] [CrossRef]
- Villa, C.; Costa, J.; Gondar, C.; Oliveira, M.B.P.P.; Mafra, I. Effect of food matrix and thermal processing on the performance of a normalised quantitative real-time PCR approach for lupine (Lupinus albus) detection as a potential allergenic food. Food Chem. 2018, 262, 251–259. [Google Scholar] [CrossRef]
- Costa, J.; Villa, C.; Grazina, L.; Mafra, I. Single-tube nested real-time PCR versus normalised real-time PCR for the quantification of allergenic cashew nut in foods: Impact of thermal processing and matrix. Food Chem. 2022, 397, 133778. [Google Scholar] [CrossRef]
- Li, H.; Feng, J.; Wang, Y.; Liu, G.; Chen, X.; Fu, L. Instant and Multiple DNA Extraction Method by Microneedle Patch for Rapid and on-Site Detection of Food Allergen-Encoding Genes. J. Agric. Food Chem. 2021, 69, 6879–6887. [Google Scholar] [CrossRef]
Sample ID | Commercial Product Type | Canning Filing Medium | Brand | Exp. Date |
---|---|---|---|---|
1 | Canned tuna | Sunflower oil/vegetable seasoning | Brand 1 | 21 December 2024 |
2 | Tomato sauced tuna | Sunflower oil/tomato sauce | Brand 1 | 19 April 2025 |
3 | Mustard sauced tuna | Sunflower oil/mustard sauce | Brand 1 | 15 June 2025 |
4 | Canned tuna | Olive oil | Brand 1 | 20 October 2024 |
5 | Canned tuna | Sunflower oil | Brand 1 | 19 October 2025 |
6 | Canned tuna | Olive oil | Brand 2 | 19 September 2025 |
7 | Canned tuna | Sunflower oil | Brand 2 | 11 April 2024 |
8 | Canned tuna | Sunflower oil/canola oil | Brand 2 | 11 January 2025 |
9 | Tuna salad | Sunflower oil/olive oil/corn | Brand 2 | 05 November 2024 |
10 | Tuna salad | Sunflower oil/olive oil/beans | Brand 2 | 05 September 2024 |
11 | Canned tuna | Sunflower oil | Brand 2 | 14 February 2025 |
12 | Canned tuna | Sunflower oil | Brand 3 | 15 November 2024 |
13 | Spiced canned tuna | Sunflower oil/Spiced | Brand 3 | 22 March 2025 |
14 | Canned tuna | Brine solution | Brand 4 | 12 February 2025 |
15 | Canned tuna | Sunflower oil | Brand 5 | 18 April 2025 |
16 | Canned tuna | Brine solution | Brand 6 | 20 July 2025 |
17 | Canned tuna | Sunflower oil | Brand 7 | 19 December 2024 |
18 | Canned tuna | Sunflower oil | Brand 8 | 28 April 2025 |
19 | Canned tuna | Sunflower oil | Brand 9 | 04 March 2025 |
20 | Tomato sauced canned tuna | Sunflower oil/tomato sauce | Brand 10 | 29 December 2024 |
21 | Olive oiled canned tuna | Olive oil | Brand 5 | 26 December 2024 |
22 | Spiced canned tuna | Sunflower oil/Spiced | Brand 2 | 15 September 2024 |
23 | Canned tuna | Sunflower oil | Brand 6 | 24 December 2024 |
24 | Canned tuna | Olive oil | Brand 9 | 14 February 2025 |
25 | Canned tuna | Sunflower oil | Brand 11 | 26 January 2025 |
26 | Canned tuna | Sunflower oil | Brand 12 | 30 January 2025 |
27 | Spiced canned tuna | Spiced/sunflower oil | Brand 12 | 19 December 2024 |
28 | Canned tuna | Sunflower oil | Brand 13 | 27 February 2025 |
29 | Canned tuna | Sunflower oil | Brand 6 | 17 March 2025 |
Locus | Code | Sequence (5′–3′) | Amplicon Base Pair (bp) | Reference |
---|---|---|---|---|
COI F | FishF2 | TCGACTAATCATAAAGATATCGGCAC | 655 | Ward et al. [27] |
COI R | FishR2 | ACTTCAGGGTGACCGAAGAATCAGAA | ||
Teleo F | L848 | ACACCGCCCGTCACTCT | 100 | Valentini et al. [28] |
Teleo R | H1913 | CTTCCGGTACACTTACCATG |
Sample ID | pH of Filling Medium | pH of Tuna Meat | Calcium Content (mg/100 mg) |
---|---|---|---|
1 | 5.6 f | 5.9 c | 62.40 d |
2 | 5.1 a | 5.4 a | 165.90 e |
3 | 5.2 b | 5.4 a | 74.45 d |
4 | 5.3 c | 5.8 b | 15.41 b |
5 | 5.2 b | 5.8 b | 14.35 b |
6 | 6.1 h | 6.5 e | 22.45 b |
7 | 5.2 b | 5.9 c | 34.15 c |
8 | 5.2 b | 5.8 b | 16.21 b |
9 | 5.5 e | 5.9 c | 24.15 b |
10 | 5.5 e | 5.9 c | 16.34 c |
11 | 5.3 c | 5.8 b | 21.25 b |
12 | 5.4 d | 5.8 b | 15.13 b |
13 | 5.3 c | 5.8 b | 54.05 d |
14 | 5.5 e | 5.9 c | 7.16 a |
15 | 5.4 d | 5.8 b | 29.45 b |
16 | 5.9 g | 6.1 d | 6.92 a |
17 | 5.4 d | 5.8 b | 23.44 b |
18 | 5.3 c | 5.9 c | 16.32 b |
19 | 5.8 g | 6.2 | 12.02 b |
20 | 5.6 f | 5.9 c | 178.02 e |
21 | 5.8 g | 6.0 d | 16.54 d |
22 | 5.7 f | 5.9 c | 63.42 d |
23 | 5.6 f | 5.9 c | 33.06 c |
24 | 5.6 f | 5.8 b | 43.80 c |
25 | 5.8 g | 6.1 d | 19.17 b |
26 | 5.9 g | 6.1 d | 27.12 b |
27 | 5.7 f | 6.1 d | 62.42 d |
28 | 6.1 h | 6.4 e | 12.9 b |
29 | 5.9 g | 6.1 d | 19.90 b |
Sample ID | DNA Yield (ug/uL) | Purity (A260/A280) | Chemical Contamination (A260/A230) |
---|---|---|---|
1 | 5.9 a | 1.24 d | 1.09 e |
2 | 11.4 b | 1.23 d | 0.56 d |
3 | 32 c | 1.71 f | 1.03 e |
4 | 15.4 b | 1 c | 0.47 c |
5 | 10.6 b | 1.33 d | 0.44 c |
6 | 2.6 a | 0.85 b | −0.39 b |
7 | 4 a | 0.89 b | 0.44 c |
8 | 6.2 b | 1.26 d | 0.41 c |
9 | 4.5 a | 1.2 d | 0.78 d |
10 | 56.3 c | 2.05 | 1.42 f |
11 | 11.5 b | 1.09 c | 0.43 c |
12 | 530.3 e | 2 g | 2.07 f |
13 | 1682 f | 2.11 g | 2.24 f |
14 | 3.6 a | 1.32 d | −1.67 b |
15 | 9.5 b | 1.6 e | −13.64 a |
16 | 26.2 | 1.80 f | 1.24 e |
17 | 3.4 a | 1.49 d | −0.37 b |
18 | 6.2 a | 1.08 c | 1.21 e |
19 | 2.0 a | 1.85 f | −0.23 b |
20 | 240.1 d | 1.93 f | 2.52 |
21 | 280.9 d | 2.1 g | 2.44 f |
22 | 3.4 a | −0.78 a | −1.21 b |
23 | 13.0 b | 1.7 f | 1.87 e |
24 | 3.8 a | 1.54 e | −0.76 b |
25 | 13.7 b | 1.07 c | 0.32 c |
26 | 7.1 b | 1.32 d | 1.1 e |
27 | 2.4 a | 1.05 c | 0.98 e |
28 | 2.9 a | 1.28 d | 0.56 d |
29 | 9.9 b | 1.39 d | 1.4 e |
Sample ID a | DNA Full Length Barcoding | DNA Mini Barcoding |
---|---|---|
1 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
2 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
3 | Yellowfin tuna (T. albacares) | Yellowfin tuna (T. albacares) |
4 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
5 | Bigeye tuna (T. obesus) | Bigeye tuna (T. obesus) |
6 | Bigeye tuna (T. obesus) | Bigeye tuna (T. obesus) |
7 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
8 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
9 | Yellowfin tuna (T. albacares) | Yellowfin tuna (T. albacares) |
10 | Failed PCR | Auxis thazard (Frigate tuna) |
11 | Auxis thazard (Frigate tuna) | Auxis thazard (Frigate tuna) |
12 | Failed PCR | Yellowfin tuna (T. albacares) |
13 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
14 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
15 | Auxis thazard (Frigate tuna) | Auxis thazard (Frigate tuna) |
16 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
17 | Yellowfin tuna (T. albacares) | Yellowfin tuna (T. albacares) |
18 | Albacore (Thunnus alalunga) | Albacore (Thunnus alalunga) |
19 | Failed PCR | Auxis thazard (Frigate tuna) |
20 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
21 | Yellowfin tuna (T. albacares) | Yellowfin tuna (T. albacares) |
22 | Failed PCR | Albacore (Thunnus alalunga) |
23 | Yellowfin tuna (T. albacares) | Yellowfin tuna (T. albacares) |
24 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
25 | Failed PCR | Yellowfin tuna (T. albacares) |
26 | Skipjack tuna (K. pelamis) | Skipjack tuna (K. pelamis) |
27 | Failed PCR | Yellowfin tuna (T. albacares) |
28 | Failed PCR | Failed PCR |
29 | Yellowfin tuna (T. albacares) | Yellowfin tuna (T. albacares) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aksun Tümerkan, E.T. Detection of Parvalbumin Fish Allergen in Canned Tuna by Real-Time PCR Driven by Tuna Species and Can-Filling Medium. Molecules 2022, 27, 5674. https://doi.org/10.3390/molecules27175674
Aksun Tümerkan ET. Detection of Parvalbumin Fish Allergen in Canned Tuna by Real-Time PCR Driven by Tuna Species and Can-Filling Medium. Molecules. 2022; 27(17):5674. https://doi.org/10.3390/molecules27175674
Chicago/Turabian StyleAksun Tümerkan, Elif Tugce. 2022. "Detection of Parvalbumin Fish Allergen in Canned Tuna by Real-Time PCR Driven by Tuna Species and Can-Filling Medium" Molecules 27, no. 17: 5674. https://doi.org/10.3390/molecules27175674